rassf6

Ensembl ID:
ENSDARG00000000804
ZFIN ID:
ZDB-GENE-030616-513
Description:
ras association domain-containing protein 6 [Source:RefSeq peptide;Acc:NP_001038804]
Human Orthologue:
RASSF6
Human Description:
Ras association (RalGDS/AF-6) domain family member 6 [Source:HGNC Symbol;Acc:20796]
Mouse Orthologue:
Rassf6
Mouse Description:
Ras association (RalGDS/AF-6) domain family member 6 Gene [Source:MGI Symbol;Acc:MGI:1920496]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21682 Nonsense Mutation detected in F1 DNA During 2014
sa12501 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21682
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000887 Nonsense 101 338 5 11
ENSDART00000136932 Nonsense 139 227 6 7
Genomic Location:
Chromosome 10 (position 13185038)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAATTATGTGTTTTGTGATTCGATCAACTGTGCCATTAGGGGTATGACA[C/T]GATGGGGAGAATTTGACAACCTTCACAATATTGCTGAACTGGAGGAAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12501
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000887 Essential Splice Site 281 338 9 11
ENSDART00000136932 None None 227 None 7
Genomic Location:
Chromosome 10 (position 13198333)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATGAAGATGTTCCTCATGGATACAGACGAAGAGGAAATTAGTCTTGAT[G/A]TAAGTCTAGCTCTTYAGGTATTACAGAAAGTGTATTYTAYTCAAATAAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/19ode9si