rassf6

Ensembl ID:
ENSDARG00000000804
ZFIN ID:
ZDB-GENE-030616-513
Description:
ras association domain-containing protein 6 [Source:RefSeq peptide;Acc:NP_001038804]
Human Orthologue:
RASSF6
Human Description:
Ras association (RalGDS/AF-6) domain family member 6 [Source:HGNC Symbol;Acc:20796]
Mouse Orthologue:
Rassf6
Mouse Description:
Ras association (RalGDS/AF-6) domain family member 6 Gene [Source:MGI Symbol;Acc:MGI:1920496]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21682 Nonsense Mutation detected in F1 DNA During 2015
sa27575 Essential Splice Site Mutation detected in F1 DNA During 2015
sa12501 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21682
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000887 Nonsense 101 338 5 11
ENSDART00000136932 Nonsense 139 227 6 7
Genomic Location:
Chromosome 10 (position 13185038)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAATTATGTGTTTTGTGATTCGATCAACTGTGCCATTAGGGGTATGACA[C/T]GATGGGGAGAATTTGACAACCTTCACAATATTGCTGAACTGGAGGAAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27575
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000887 Essential Splice Site 241 338 8 11
ENSDART00000136932   None 227 None 7
Genomic Location:
Chromosome 10 (position 13190316)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAAACAGTCCAAATGAATTTTCCCTCTACTGCATTCATCAAACTGGAG[G/A]TATGTAGAACCCTCACTTTATTCCAAATCATACAAAAGCTGAAAAAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12501
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000887 Essential Splice Site 281 338 9 11
ENSDART00000136932   None 227 None 7
Genomic Location:
Chromosome 10 (position 13198333)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATGAAGATGTTCCTCATGGATACAGACGAAGAGGAAATTAGTCTTGAT[G/A]TAAGTCTAGCTCTTYAGGTATTACAGAAAGTGTATTYTAYTCAAATAAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/19ode9si