daxx

Ensembl ID:
ENSDARG00000000729
ZFIN ID:
ZDB-GENE-010110-3
Description:
death domain-associated protein 6 [Source:RefSeq peptide;Acc:NP_001038414]
Human Orthologue:
DAXX
Human Description:
death-domain associated protein [Source:HGNC Symbol;Acc:2681]
Mouse Orthologue:
Daxx
Mouse Description:
Fas death domain-associated protein Gene [Source:MGI Symbol;Acc:MGI:1197015]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17864 Nonsense Available for shipment Available now
sa29152 Nonsense Mutation detected in F1 DNA During 2017
sa29151 Essential Splice Site, Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa17864
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093181 Nonsense 210 716 5 12
ENSDART00000122815 Nonsense 210 715 5 12
ENSDART00000123443 Nonsense 210 716 3 10
ENSDART00000124094 Nonsense 210 242 5 5
ENSDART00000125702 Nonsense 210 418 5 9
ENSDART00000129452 Nonsense 210 419 5 9
Genomic Location (Zv9):
Chromosome 19 (position 7649678)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 7108217
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTCTYTNNNNCNNNNATKTTTCAGATTGCGTATCTGGAAAACCTKTTGAAAGTGTA[T/G]AATGAGGAGATCCGSCGGCTTCAGGAGGGGGATTTGAGTTTGGATGACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29152
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093181 Nonsense 429 716 9 12
ENSDART00000122815 Nonsense 429 715 9 12
ENSDART00000123443 Nonsense 429 716 7 10
ENSDART00000124094   None 242 None 5
ENSDART00000125702   None 418 None 9
ENSDART00000129452   None 419 None 9
Genomic Location (Zv9):
Chromosome 19 (position 7643355)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 7101894
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTTTTTGTACAGGCTGTTAATGGGCAACAGAGTGAAAGCAAAGAAAAA[G/T]AAAAGGAGGAGCAAGAAGAAAAAGAGAAGGAAGATGAAGAAGAAGAGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29151
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093181 Missense 473 716 10 12
ENSDART00000122815 Essential Splice Site 472 715 10 12
ENSDART00000123443 Missense 473 716 8 10
ENSDART00000124094   None 242 None 5
ENSDART00000125702   None 418 None 9
ENSDART00000129452   None 419 None 9
Genomic Location (Zv9):
Chromosome 19 (position 7643143)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 7101682
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAATCACCTCATTTCACTGAGTTAACCCTGATTTCTCCCAATTTCAGAA[G/A]ATGATGAAGAAGATGTGGAAGAGGAGCCTGCTAACATCAGTGACAACGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link