osgepl1

Ensembl ID:
ENSDARG00000000651
ZFIN ID:
ZDB-GENE-030616-532
Description:
Probable O-sialoglycoprotein endopeptidase 2 [Source:UniProtKB/Swiss-Prot;Acc:Q32LQ3]
Human Orthologue:
OSGEPL1
Human Description:
O-sialoglycoprotein endopeptidase-like 1 [Source:HGNC Symbol;Acc:23075]
Mouse Orthologue:
Osgepl1
Mouse Description:
O-sialoglycoprotein endopeptidase-like 1 Gene [Source:MGI Symbol;Acc:MGI:1919335]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34716 Essential Splice Site Mutation detected in F1 DNA During 2017
sa41500 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34716
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000693 Essential Splice Site 62 404 1 7
Genomic Location (Zv9):
Chromosome 9 (position 42113640)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 41238810
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGAGGATTTTGGGTGAATCTCTGCATTCTCAGAAAGAGACACACCTGAA[G/A]TAAGTATAGTAGTCACAGCCTTCAGAAAACTCCTCAGTTGCTACAAAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41500
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000693 Nonsense 237 404 3 7
Genomic Location (Zv9):
Chromosome 9 (position 42115656)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 41240826
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCGACTTGCGTTTCACTTCATTTCACCAATGGGGCAGAACTACGACTG[C/A]AATTTCTCATTTGCTGGTTTGCGAACACAGATCACAGGGGCAATAAACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link