opn1mw4

Ensembl ID:
ENSDARG00000000638
ZFIN ID:
ZDB-GENE-990604-43
Description:
Green-sensitive opsin-4 [Source:UniProtKB/Swiss-Prot;Acc:Q9W6A6]
Human Orthologue:
RHO
Human Description:
rhodopsin [Source:HGNC Symbol;Acc:10012]
Mouse Orthologue:
Rho
Mouse Description:
rhodopsin Gene [Source:MGI Symbol;Acc:MGI:97914]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20786 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20786
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000678 Nonsense 185 349 3 5
Genomic Location (Zv9):
Chromosome 6 (position 41132484)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 41204084
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAATGTGTCGCTTTTTTATTATCAGGTATATTCCGGAGGGAATGCAGTG[T/A]TCATGTGGACCAGACTACTACACCCTGAACCCAGAGTACAACAACGAATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link