ptpn4a

Ensembl ID:
ENSDARG00000000631
ZFIN ID:
ZDB-GENE-030616-449
Description:
tyrosine-protein phosphatase non-receptor type 4 [Source:RefSeq peptide;Acc:NP_001007201]
Human Orthologue:
PTPN4
Human Description:
protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte) [Source:HGNC Symbol;Acc:9656]
Mouse Orthologue:
Ptpn4
Mouse Description:
protein tyrosine phosphatase, non-receptor type 4 Gene [Source:MGI Symbol;Acc:MGI:1099792]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38744 Nonsense Mutation detected in F1 DNA During 2017
sa10967 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa38744
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000670 Nonsense 120 928 4 26
ENSDART00000078823 Nonsense 74 882 3 25
Genomic Location (Zv9):
Chromosome 9 (position 30022821)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 29178767
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCGGGTGAAATTCTTTGTGAGTGACCCCAACAAACTTCAGGAAGAATA[C/A]ACACGGTGAGTTTGTCAATTTGGACTTTGCGTTTTTATTTGGTGTGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10967
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000670 Essential Splice Site 711 928 21 26
ENSDART00000078823 Essential Splice Site 665 882 20 25
Genomic Location (Zv9):
Chromosome 9 (position 29982134)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 29138080
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTCATTCTGAAAGGCACAGAAGACTACATCAATGCAAATTACATCAAC[G/A]TGAGTGACTCATAATTATTCTATTATCTCACTAAAATCTCAAGTACCCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link