dnah7l

Ensembl ID:
ENSDARG00000000606
ZFIN ID:
ZDB-GENE-030616-623
Human Orthologue:
DNAH6
Human Description:
dynein, axonemal, heavy chain 6 [Source:HGNC Symbol;Acc:2951]
Mouse Orthologue:
Dnahc6
Mouse Description:
dynein, axonemal, heavy chain 6 Gene [Source:MGI Symbol;Acc:MGI:107744]

Alleles

There are 16 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19487 Essential Splice Site Available for shipment Available now
sa5936 Nonsense Mutation detected in F1 DNA During 2017
sa14187 Essential Splice Site Available for shipment Available now
sa15767 Essential Splice Site Available for shipment Available now
sa25565 Nonsense Mutation detected in F1 DNA During 2017
sa479 Essential Splice Site Confirmed mutation in F2 line During 2017
sa19488 Nonsense Available for shipment Available now
sa19489 Nonsense Available for shipment Available now
sa25566 Essential Splice Site Mutation detected in F1 DNA During 2017
sa32658 Nonsense Mutation detected in F1 DNA During 2017
sa19490 Essential Splice Site Available for shipment Available now
sa32659 Nonsense Mutation detected in F1 DNA During 2017
sa32660 Nonsense Mutation detected in F1 DNA During 2017
sa18694 Nonsense Mutation detected in F1 DNA During 2017
sa6581 Essential Splice Site Mutation detected in F1 DNA During 2017
sa32661 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa19487
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054388 Essential Splice Site 50 3802 None 73
ENSDART00000137429   None 84 None 4
ENSDART00000141317 Essential Splice Site 240 3966 None 75
Genomic Location (Zv9):
Chromosome 1 (position 20841815)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 21313911
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTCTTCAGTACCTAAATCATCAATTAACTTTGACACATATAACCTCAAG[T/A]AAGAAATGCAGTATTTGTACACTACCATTTCAAACTCATTTATTTTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5936
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054388 Nonsense 625 3802 14 73
ENSDART00000137429   None 84 None 4
ENSDART00000141317 Nonsense 806 3966 16 75
Genomic Location (Zv9):
Chromosome 1 (position 20853381)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 21325477
KASP Assay ID:
554-3940.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACCATGCATAACTGCTGTAAGAAACACCATCGACAAGGCAGTGGGAGAG[C/T]GAGACTCTTATGTGGACAAATTTTGCCAACATCTCCAGCAAGACATCGGY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14187
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054388 Essential Splice Site 737 3802 17 73
ENSDART00000137429   None 84 None 4
ENSDART00000141317 Essential Splice Site 918 3966 19 75
Genomic Location (Zv9):
Chromosome 1 (position 20857660)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 21329756
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAATTACGGTGTCCTCTAAATGTCACATGGTCAATTATCTCTTTTATAT[A/T]GGATAAGTTKGATGAGCTGGACCCAGAACTGCTGAGCAAGCAGGTGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15767
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054388 Essential Splice Site 853 3802 19 73
ENSDART00000137429   None 84 None 4
ENSDART00000141317 Essential Splice Site 1034 3966 21 75
Genomic Location (Zv9):
Chromosome 1 (position 20863650)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 21335746
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCTGGACAAGCCTCAGGAGAAGCATCTCTGGAGAACATTCTSAGAAAG[G/A]TGATGCCTACATTTATTATTGTCTTTTAACATTATACATACACGTCTYTR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25565
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054388 Nonsense 1287 3802 29 73
ENSDART00000137429   None 84 None 4
ENSDART00000141317 Nonsense 1479 3966 31 75
Genomic Location (Zv9):
Chromosome 1 (position 20882426)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 21354522
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCATTTTTATCATAGGATCGCTGTTACCTCTGCCTAATGGGAGCGCTG[C/T]AGCTGGATCTCGGAGGAGCTCCTGCAGGTCCAGCAGGCACAGGCAAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa479
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054388 Essential Splice Site 1375 3802 30 73
ENSDART00000137429   None 84 None 4
ENSDART00000141317 Essential Splice Site 1567 3966 32 75
Genomic Location (Zv9):
Chromosome 1 (position 20884934)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 21357030
KASP Assay ID:
554-0300.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTCATTGCTCAACAACTTATCACTATTAGAAATGCCAAGGCAGCCAAG[G/A]TAAAGCACTTCCACACACACGTGCATGTTTAAACCCCATATGCTGCTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19488
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054388 Nonsense 1870 3802 38 73
ENSDART00000137429   None 84 None 4
ENSDART00000141317 Nonsense 2062 3966 40 75
Genomic Location (Zv9):
Chromosome 1 (position 20908922)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 21381018
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAGCGTAGGTGATTTATGGAGCGTCTATATGAACTTTGATATTAAATG[T/A]TTGGAGCCATGGGAAAGGATCATTCCCGTCTTCAGTTATAACAGTGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19489
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054388 Nonsense 2161 3802 43 73
ENSDART00000137429   None 84 None 4
ENSDART00000141317 Nonsense 2352 3966 45 75
Genomic Location (Zv9):
Chromosome 1 (position 20919700)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 21391796
KASP Assay ID:
2259-0521.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCATATCTTCCGTTTGTTCTGTCATGAGTGTCAACGTGTCTTCCACGAT[C/T]GACTCATAAACAACGAAGACAAAAGCTACTTCAATACCATGATCTCTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25566
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054388 Essential Splice Site 2256 3802 45 73
ENSDART00000137429   None 84 None 4
ENSDART00000141317 Essential Splice Site 2439 3966 47 75
Genomic Location (Zv9):
Chromosome 1 (position 20924508)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 21396604
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGAAACCAAGCTGGTTTTCTTTCAAGATGCCATTGAACACGTGTCTAG[G/A]TAAACAAGCAGCTTGCCTTTTCGTCTGGTGTTCACAAAAGCAGGTGTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32658
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054388 Nonsense 2263 3802 46 73
ENSDART00000137429   None 84 None 4
ENSDART00000141317 Nonsense 2446 3966 48 75
Genomic Location (Zv9):
Chromosome 1 (position 20924690)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 21396786
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTATCGTTCATCTGTTCCTCTGTCCACAGAATTGCCCGCATGATTCGC[C/T]AAGAGCGTGGCAATGCCCTGTTGGTTGGTGTGGGTGGCACAGGAAAGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19490
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054388 Essential Splice Site 2432 3802 49 73
ENSDART00000137429   None 84 None 4
ENSDART00000141317 Essential Splice Site 2615 3966 51 75
Genomic Location (Zv9):
Chromosome 1 (position 20937366)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 21409462
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGTGTTTGTTACATTGCAGTCATTTTCTGTTTCTTGGGTTTATTTTTC[A/T]GTGGCCCCGTGAAGCTCTGCTATCTGTGTCTCAGACCTTCTTCCAGAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32659
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054388 Nonsense 2831 3802 54 73
ENSDART00000137429   None 84 None 4
ENSDART00000141317 Nonsense 3014 3966 56 75
Genomic Location (Zv9):
Chromosome 1 (position 20959594)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 21431690
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAACGTCATTGGAAATGTGTTCATCGCTGCAGCTTGTGTGGCTTATTA[T/A]GGGGCCTTTACCTCCCATTACAGACAACTGGTAGTGTATTATTAAATCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32660
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054388 Nonsense 3083 3802 59 73
ENSDART00000137429   None 84 None 4
ENSDART00000141317 Nonsense 3266 3966 61 75
Genomic Location (Zv9):
Chromosome 1 (position 21017216)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 21489312
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGCTCTTCACTTCTGAGGGAAACATACTGGACAATGAGGAGCTTGTA[C/T]AAACCTTACAAGAGTCAAAGGTCAGTGGCAGAATTTAAAAGAGTTCAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18694
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054388 Nonsense 3141 3802 60 73
ENSDART00000137429   None 84 None 4
ENSDART00000141317 Nonsense 3324 3966 62 75
Genomic Location (Zv9):
Chromosome 1 (position 21022276)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 21494372
KASP Assay ID:
2259-0526.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATCATGTACTTTGTCATTGCCAGCCTGTCTGAGATTGACCCCATGTAT[C/T]AGTTCTCACTAAAGTACTTTAAACAGGTAATTTTAGTGTACAACAGCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6581
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054388 Essential Splice Site 3572 3802 68 73
ENSDART00000137429   None 84 None 4
ENSDART00000141317 Essential Splice Site 3755 3966 70 75
Genomic Location (Zv9):
Chromosome 1 (position 21046599)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 21518695
KASP Assay ID:
554-4778.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTACTGCCAGACAGGACATATACCTTGGGAWGCTCTTACATACATCACAG[G/A]TACAGTATTCGAGTGTTTATTGTAGAAGTATAGCATCACTCRTTGATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32661
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054388 Nonsense 3760 3802 73 73
ENSDART00000137429   None 84 None 4
ENSDART00000141317 Nonsense 3943 3966 75 75
Genomic Location (Zv9):
Chromosome 1 (position 21057368)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 21529464
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTACTCTGCAGAAGGCGATAGCAGGTCTGGTGGTGATGTCAGAAGAAATG[G/T]AGAAGATTTATAACAGTTTCCTGAATAACCAGGTTCCTGATCACTGGTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link