graspl

Ensembl ID:
ENSDARG00000000588
ZFIN ID:
ZDB-GENE-060312-30
Description:
general receptor for phosphoinositides 1-associated scaffold protein [Source:RefSeq peptide;Acc:NP_
Human Orthologue:
GRASP
Human Description:
GRP1 (general receptor for phosphoinositides 1)-associated scaffold protein [Source:HGNC Symbol;Acc:
Mouse Orthologue:
Grasp
Mouse Description:
GRP1 (general receptor for phosphoinositides 1)-associated scaffold protein Gene [Source:MGI Symbol;

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12137 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12137
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103343 Nonsense 178 382 6 8
Genomic Location:
Chromosome 23 (position 32443955)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGYATCACTGTGTTGYTTTTGTTCCTGTGTTTAGGCTAGAAACCGTCTA[C/A]AGCGACTCTATAAGAAAAGCAGAACTGGAAGCTCGTCTGCAGTATCTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xforis9j