ell

Ensembl ID:
ENSDARG00000000568
ZFIN ID:
ZDB-GENE-030131-3946
Description:
elongation factor RNA polymerase II [Source:RefSeq peptide;Acc:NP_956001]
Human Orthologue:
ELL
Human Description:
elongation factor RNA polymerase II [Source:HGNC Symbol;Acc:23114]
Mouse Orthologue:
Ell
Mouse Description:
elongation factor RNA polymerase II Gene [Source:MGI Symbol;Acc:MGI:109377]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11958 Essential Splice Site Available for shipment Available now
sa16550 Essential Splice Site Available for shipment Available now
sa12948 Nonsense Available for shipment Available now
sa43827 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa11958
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032770 Essential Splice Site 45 597 1 11
ENSDART00000100642 Essential Splice Site 72 660 1 12
Genomic Location (Zv9):
Chromosome 22 (position 21244726)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20899402
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTGACAGACAGCGCTCTGCGGGCGTTTRAGGACTACCAGAGCAACAAG[G/A]TAAGACGCGCGTCGAGCGCAACGCGAGGCTGGATAAAYAGAGCTAACAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16550
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032770 Essential Splice Site 101 597 3 11
ENSDART00000100642 Essential Splice Site 128 660 3 12
Genomic Location (Zv9):
Chromosome 22 (position 21197280)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20851956
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGACAATCCCCAGGGCAGCTTCGACTGCATTCAGCAGTACATTACAAG[G/A]TAAGAACAAAATTAAAYGTATMTTTYATTGTAGTGCTGTGATTWGTGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12948
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032770 Nonsense 318 597 8 11
ENSDART00000100642 Nonsense 345 660 8 12
Genomic Location (Zv9):
Chromosome 22 (position 21176548)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20831224
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAAGTTGTGTAATATTTGACTTCAGTTGAACACCCACAACCCCCAGAAA[C/T]GACCTGCAGCCGACTTCATCGATCCCCTGGCCAATAAGAAACCCAGAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43827
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032770 Nonsense 433 597 8 11
ENSDART00000100642 Nonsense 460 660 8 12
Genomic Location (Zv9):
Chromosome 22 (position 21176202)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20830878
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCGACACAAGAGGAAAGGCAGACCTCCATGTCCCCACCCCACAGCAGTT[T/A]GGACAGCTCTCTGACCCAGACCACCCAACCCTCTCTGCACGGCAAGTCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link