ell

Ensembl ID:
ENSDARG00000000568
ZFIN ID:
ZDB-GENE-030131-3946
Description:
elongation factor RNA polymerase II [Source:RefSeq peptide;Acc:NP_956001]
Human Orthologue:
ELL
Human Description:
elongation factor RNA polymerase II [Source:HGNC Symbol;Acc:23114]
Mouse Orthologue:
Ell
Mouse Description:
elongation factor RNA polymerase II Gene [Source:MGI Symbol;Acc:MGI:109377]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11958 Essential Splice Site Available for shipment Available now
sa16550 Essential Splice Site Available for shipment Available now
sa12948 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11958
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032770 Essential Splice Site 45 597 1 11
ENSDART00000100642 Essential Splice Site 72 660 1 12
Genomic Location:
Chromosome 22 (position 21244726)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTGACAGACAGCGCTCTGCGGGCGTTTRAGGACTACCAGAGCAACAAG[G/A]TAAGACGCGCGTCGAGCGCAACGCGAGGCTGGATAAAYAGAGCTAACAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16550
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032770 Essential Splice Site 101 597 3 11
ENSDART00000100642 Essential Splice Site 128 660 3 12
Genomic Location:
Chromosome 22 (position 21197280)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGACAATCCCCAGGGCAGCTTCGACTGCATTCAGCAGTACATTACAAG[G/A]TAAGAACAAAATTAAAYGTATMTTTYATTGTAGTGCTGTGATTWGTGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12948
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032770 Nonsense 318 597 8 11
ENSDART00000100642 Nonsense 345 660 8 12
Genomic Location:
Chromosome 22 (position 21176548)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAAGTTGTGTAATATTTGACTTCAGTTGAACACCCACAACCCCCAGAAA[C/T]GACCTGCAGCCGACTTCATCGATCCCCTGGCCAATAAGAAACCCAGAATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/umclkb85