LOC100005963

Ensembl ID:
ENSDARG00000000567
Human Orthologue:
ZNF281
Human Description:
zinc finger protein 281 [Source:HGNC Symbol;Acc:13075]
Mouse Orthologue:
Zfp281
Mouse Description:
zinc finger protein 281 Gene [Source:MGI Symbol;Acc:MGI:3029290]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20088 Nonsense Mutation detected in F1 DNA During 2014
sa20087 Nonsense Mutation detected in F1 DNA During 2014
sa20086 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20088
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000595 Nonsense 71 849 1 6
Genomic Location:
Chromosome 3 (position 38772125)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAGATGATCTTGAAGAAGGAGCGGGACTCGCCAGACTGTGGAGCTGGA[G/T]GAGGACTCAATACTGGAGGCATGGTTGCTGGAGGCGGCATTGGAGGAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20087
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000595 Nonsense 217 849 3 6
Genomic Location:
Chromosome 3 (position 38764802)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCGCACATCTGTGAGCACTGCAATGCAGCGTTCCGGAGCTCCTATCATT[T/A]ACGCAGACATGTGCTTATACACACAGGTCAGCATGTGTTTATACTTACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20086
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000595 Nonsense 297 849 6 6
Genomic Location:
Chromosome 3 (position 38762158)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGGCTGTATCGTGTTTTCACACACGTGTGGTTTTTTTAGTATTTTTCC[A/T]GAACAGACCGATTGCTGAAGCACAAGCGGACATGTGGGGATGCCATCAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bhzwyn8l