B0S746_DANRE

Ensembl ID:
ENSDARG00000000563
Description:
Titin-like [Source:UniProtKB/TrEMBL;Acc:B0S746]
Human Orthologue:
TTN
Human Description:
titin [Source:HGNC Symbol;Acc:12403]
Mouse Orthologue:
Ttn
Mouse Description:
titin Gene [Source:MGI Symbol;Acc:MGI:98864]

Alleles

There are 54 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8354 Nonsense Mutation detected in F1 DNA During 2014
sa17611 Nonsense Available for shipment Available now
sa15669 Nonsense Available for shipment Available now
sa16201 Essential Splice Site Available for shipment Available now
sa2520 Nonsense F2 line generated During 2014
sa9015 Nonsense Mutation detected in F1 DNA During 2014
sa21570 Nonsense Mutation detected in F1 DNA During 2014
sa7211 Nonsense Confirmed mutation in F2 line During 2014
sa18130 Essential Splice Site Available for shipment Available now
sa18663 Nonsense Available for shipment Available now
sa8776 Nonsense Mutation detected in F1 DNA During 2014
sa18518 Nonsense Available for shipment Available now
sa18121 Nonsense Available for shipment Available now
sa8651 Nonsense Mutation detected in F1 DNA During 2014
sa2521 Nonsense F2 line generated During 2014
sa21569 Nonsense Mutation detected in F1 DNA During 2014
sa10165 Nonsense Available for shipment Available now
sa21568 Nonsense Available for shipment Available now
sa656 Nonsense F2 line generated During 2014
sa21567 Nonsense Mutation detected in F1 DNA During 2014
sa21566 Nonsense Mutation detected in F1 DNA During 2014
sa14453 Nonsense Available for shipment Available now
sa10177 Essential Splice Site Available for shipment Available now
sa16757 Essential Splice Site Available for shipment Available now
sa10628 Nonsense Available for shipment Available now
sa3733 Nonsense Mutation detected in F1 DNA During 2014
sa10627 Nonsense Available for shipment Available now
sa16491 Nonsense Available for shipment Available now
sa21565 Nonsense Mutation detected in F1 DNA During 2014
sa16349 Nonsense Available for shipment Available now
sa21564 Essential Splice Site Mutation detected in F1 DNA During 2014
sa13738 Nonsense Available for shipment Available now
sa10376 Nonsense Available for shipment Available now
sa21563 Nonsense Mutation detected in F1 DNA During 2014
sa8875 Nonsense Mutation detected in F1 DNA During 2014
sa21562 Nonsense Mutation detected in F1 DNA During 2014
sa21561 Nonsense Mutation detected in F1 DNA During 2014
sa14401 Nonsense Available for shipment Available now
sa25436 Nonsense Mutation detected in F1 DNA During 2014
sa8738 Nonsense Mutation detected in F1 DNA During 2014
sa21560 Nonsense Mutation detected in F1 DNA During 2014
sa16841 Nonsense Available for shipment Available now
sa25435 Nonsense Mutation detected in F1 DNA During 2014
sa17186 Nonsense Available for shipment Available now
sa7209 Nonsense Mutation detected in F1 DNA During 2014
sa18248 Nonsense Available for shipment Available now
sa16133 Nonsense Available for shipment Available now
sa5561 Nonsense Mutation detected in F1 DNA During 2014
sa3712 Nonsense Mutation detected in F1 DNA During 2014
hu7916 Nonsense Available for shipment Available now
sa21559 Nonsense Mutation detected in F1 DNA During 2014
sa15731 Nonsense Available for shipment Available now
sa14924 Nonsense Available for shipment Available now
sa21558 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8354
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 95 27263 2 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 None None 22190 None 141

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 9 (position 43933654)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTATTTGCATGTTTTTCTATCACTCCAGTGCGTCCTGTTACTCTGCTG[C/T]AAGGTCTTTCTGACTTGACAATCTGTGAGGGTGATATCGCACAACTTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17611
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 186 27263 3 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 None None 22190 None 141

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 9 (position 43933247)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTAGTAATCACTTTGTTTCATACACAGCTWTTGGCTTCTTGACACCAT[T/G]AAAAGATGTATCCACTGTGGAAGGGACTAAAGCTGTCCTTGAGGCTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15669
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 266 27263 3 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 None None 22190 None 141

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 9 (position 43933008)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTATAAACTGATTGCTGGAAAAGTAGACTCAACATGTAAACTTTCTGTC[G/T]AGCGTGAGTATCWTTTMAAAATACTTGCMTTTCCTTAGTTTTGGTTAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16201
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Essential Splice Site 529 27263 None 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 None None 22190 None 141

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 9 (position 43931921)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGTTTAAACTTGGAAAACTCTCTGCTAACGCCAGACTGAATGTTGAAAG[T/A]ATGTTTTAATTTATCTGTCAAATATATAGTTACATAAATTTGTTTCTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2520
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 1984 27263 19 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 None None 22190 None 141
ENSDART00000002299 Nonsense 1984 27263 19 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 None None 22190 None 141

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 9 (position 43923879)
KASP Assay ID:
554-3282.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCAGAGCTAGCAACCGTGAATTCCACTCAATGTTTGGTAGAAAAGGAA[C/T]AAACCAAACCAGTGCTTGCATCAGTCAGTGATACTAAGCACACTCTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9015
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 2180 27263 19 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 None None 22190 None 141

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 9 (position 43923291)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATCCAGAGACAAGAAAAAGACCGTAAATGTCTAGCAATCAAAGAAGAG[C/T]GAGTAGAACTAACTTCAGATCATRTCAAAGACCTTGATATGAWGGTAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21570
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 2574 27263 19 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 None None 22190 None 141

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 9 (position 43922109)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAATCCAAAATGGAGAGCTACAGTATCATTGAAACTGAACATAAAAGT[G/T]AAATGAAATTAGGATCAGTCGAATATTTTAAGAGAGATGTGTGTGTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7211
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 3428 27263 27 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 None None 22190 None 141

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 9 (position 43913682)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAATTGGAAAAATCTTTGTMACWTGGTACAAGGATGGCAAACAGGCCTA[T/A]GCTTCATATAGATGCAACACAAAAGTTATCGGAAACACTTGCGTTTTGGA
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Stage Entity Quality Tag
Larval:Day 4
ZFS:0000036
larval locomotory behavior
GO:0008345
disrupted
PATO:0001507
abnormal
PATO:0000460

Mutation Details

Allele Name:
sa18130
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Essential Splice Site 4167 27263 39 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 None None 22190 None 141
Genomic Location:
Chromosome 9 (position 43905354)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTACTTTGGGGTTATACTTCATGCTACTTTGTTTTTTGATGTTCTTTAAA[A/T]GTTCCTGAAGTTCCAAAGAAGCCAGAAGTTGCACYTCAATCATCTTTAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18663
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 5085 27263 45 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 None None 22190 None 141
Genomic Location:
Chromosome 9 (position 43899750)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YAAAGAAAATGGAGGATAAGAAGGAAATAKTATTAAAACCTGTGGAACTT[A/T]AAAAGACTCCCTCKCYAAAAGCTGAGATTTCAAAACCTAAACCCACTKAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8776
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 5101 27263 45 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 None None 22190 None 141
Genomic Location:
Chromosome 9 (position 43899702)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAAAAAGACTCCCTCKCYAAAAGCTGAGATTTCAAAACCTAAACCCACT[G/T]AAAAAATTGCAATGGAAAGAAAATCTAGTGCAAAATTACCCCAGAAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18518
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 5617 27263 50 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 Nonsense 467 22190 7 141
ENSDART00000002299 Nonsense 5617 27263 50 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 Nonsense 467 22190 7 141
ENSDART00000002299 Nonsense 5617 27263 50 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 Nonsense 467 22190 7 141
Genomic Location:
Chromosome 9 (position 43895572)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCTCACRATCAAGAATGTTCAGCTGGACCAGGCTGGCGAAGTTAYATA[T/A]CAAGCTCTTAATGCTGTGACAAGTGCTATGCTCAACGTGAAAGGTAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18121
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 5617 27263 50 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 Nonsense 467 22190 7 141
ENSDART00000002299 Nonsense 5617 27263 50 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 Nonsense 467 22190 7 141
ENSDART00000002299 Nonsense 5617 27263 50 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 Nonsense 467 22190 7 141
Genomic Location:
Chromosome 9 (position 43895572)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCTCACRATCAAGAATGTTCAGCTGGACCAGGCTGGCGAAGTTAYATA[T/A]CAAGCTCTTAATGCTGTGACAAGTGCTATGCTCAACGTGAAAGGTAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8651
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 5617 27263 50 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 Nonsense 467 22190 7 141
ENSDART00000002299 Nonsense 5617 27263 50 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 Nonsense 467 22190 7 141
ENSDART00000002299 Nonsense 5617 27263 50 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 Nonsense 467 22190 7 141
Genomic Location:
Chromosome 9 (position 43895572)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCTCACRATCAAGAATGTTCAGCTGGACCAGGCTGGCGAAGTTAYATA[T/A]CAAGCTCTTAATGCTGTGACAAGTGCTATGCTCAACGTGAAAGGTAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2521
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 6378 27263 61 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 Nonsense 1211 22190 18 141
Genomic Location:
Chromosome 9 (position 43889911)
KASP Assay ID:
554-3301.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGCCACCTTTGACTGTGAGCTCTCATATGAAGACATTCCTGTTGAATG[G/A]TTTGTGGGCTCAACAAAAATGGAGCCAAGTGATAGGGTAAGTTCCTTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21569
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 6982 27263 69 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 Nonsense 1815 22190 26 141
Genomic Location:
Chromosome 9 (position 43884840)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGATCATCAGTGAAGCCCCCGCTGACTTCGCCGCTCAGCTCAGAGAC[C/T]AAACCATCACTGAGTTTGAGGATGCTGAATTCACTTGTAAATTGTCTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10165
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 7255 27263 73 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 Nonsense 2088 22190 30 141
Genomic Location:
Chromosome 9 (position 43883681)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTTCCGGGACCTGTGAAGAACCTTCATGTTGTTGATACTGCGGATGGT[G/T]AGGTCAGCCTCGCTTGGGAAGAACCGGAAAGTGATGGTGGAAGTAAGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21568
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 7932 27263 83 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 Nonsense 2765 22190 40 141
Genomic Location:
Chromosome 9 (position 43879384)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTAACAAATCCTCTACAGTTAGTTTAATTCATATCTTATCTTACAGAC[A/T]AACCTGGTCCTCCAGCTGCTTTTGATATTTCTGAAATTACCAACGAATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa656
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 8050 27263 84 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 Nonsense 2883 22190 41 141
Genomic Location:
Chromosome 9 (position 43878942)
KASP Assay ID:
554-0564.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCACCAACCAGGGTTCAGCCTTCTGATATCACAAGAGATGCTGTAACTT[T/A]GACTTGGTATGAGCCCGATGAAGATGGTGGAAGCCCCATCACTGGTTACT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa21567
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 8766 27263 93 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 Nonsense 3599 22190 50 141
Genomic Location:
Chromosome 9 (position 43875581)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATGGCACCACCATATGATGGTGGATGCCCAATCACAGGGTACATTATT[G/T]AGAAGATTGAAAAAGATGGTGACCGATTTGAGAGGTGTGTTCCAAATCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21566
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 9044 27263 95 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 Nonsense 3877 22190 52 141
Genomic Location:
Chromosome 9 (position 43874550)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTTCAGAGTCACCGCAGAAAATAAATTCGGCTGTGGACATCCATGCTA[C/A]TCTGAACCACTTGTTGCGAAGAATCAATTTGGTAAAACTGTATTTTAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14453
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 9077 27263 96 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 Nonsense 3910 22190 53 141
Genomic Location:
Chromosome 9 (position 43874367)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACGTGCCAAGAATTGGAGAGSTCACMTCTAGCACAGTTGCTCTTWGCT[G/A]GCATGAGCCAAAGGACAATGGCAGCCCTATCTTGGGCTATTGGGTTGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10177
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Essential Splice Site 9446 27263 99 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 Essential Splice Site 4279 22190 56 141
Genomic Location:
Chromosome 9 (position 43872790)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTTGGTGCTCCTGTTGAACTTGGCCCTGTTTTAGCAGTGGACCCCAAAG[G/A]TATATACAACAAARTGTTTATAGAATTCATATCTTGCACCGWWATATWTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16757
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Essential Splice Site 9650 27263 101 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 Essential Splice Site 4483 22190 58 141
Genomic Location:
Chromosome 9 (position 43872015)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAAATACCCGTGGAGTTGGGCAACGCACAATGCGAGTGGATATCTTGGG[T/A]AAGGCTTTTYAMTCAGTATCCGYATTTACTTRAGCTTGCTAATTTTCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10628
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 10598 27263 112 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 Nonsense 5431 22190 69 141
Genomic Location:
Chromosome 9 (position 43867645)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACCTTTGAAGGATGGAGGCTCAAAGATAATTGGATACTTTGTTGAATAC[A/T]AAGAGGAGGGCACAGAAGCATGGGTTAAGGTTTGTTTTAGAGCTGAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3733
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 10844 27263 115 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 Nonsense 5677 22190 72 141
Genomic Location:
Chromosome 9 (position 43866582)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGCAGCTGTAAATGCAATTGGAGTCGGTCCTTTCAACCAAACAGCATG[T/A]GAAATTGTGATTAAAGATCGCATCAGTAAGTATTTTCTAAATCAGTAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10627
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 11229 27263 119 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 Nonsense 6062 22190 76 141
Genomic Location:
Chromosome 9 (position 43865002)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAACTTGTTGAAGGCTGTGAATATGAATTCCGTGTAACAGCAGAAAAT[G/T]AAATTGGCACCGGAGATCCTAGTGTTCCAAGTAAACCTAWTCTTGCTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16491
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 13811 27263 137 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 Nonsense 8644 22190 94 141
Genomic Location:
Chromosome 9 (position 43854599)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAGRATACAAATTATGTTGTGACTGGACTCTTGGAGAACTCAGAGTAC[C/T]AACTTCGTGTTAGTGCTGTAAATAAAATTGGATTCAGCCAGCCTTGCGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21565
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 13821 27263 137 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 Nonsense 8654 22190 94 141
Genomic Location:
Chromosome 9 (position 43854569)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTGGAGAACTCAGAGTACCAACTTCGTGTTAGTGCTGTAAATAAAATT[G/T]GATTCAGCCAGCCTTGCGAAGTTCCTGAAAAACACATTGCGAAGGACGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16349
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 None 14196 27263 141 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 Nonsense 9029 22190 98 141
Genomic Location:
Chromosome 9 (position 43853026)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGTGTAGAATCAACGGCTGTAAACACAACTCTCTTGATACGTGACTG[C/A]CAAAGAACAGATGCCTCAAAATACACKATCACTCTTCGCAATTCTGCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21564
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Essential Splice Site 14822 27263 146 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 Essential Splice Site 9655 22190 103 141
Genomic Location:
Chromosome 9 (position 43850627)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGAGCCTAGTGAACCCTCAATTCCTGTGATGACAAAGCTTGTTGCATG[T/A]AAGTAAAAGATTATCATTTACACACCGGGGAAGCAAATTCATTAAACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13738
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 14984 27263 147 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 Nonsense 9817 22190 104 141
Genomic Location:
Chromosome 9 (position 43849845)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATTGACAATACTGAATCATACACCCTGTTGGTTATTCCTGACTGCAAT[A/T]GAMGTGATGCTGGAAAATATGATTTAACWTTAGAGAATGCAGCTGGAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10376
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 15176 27263 147 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 Nonsense 10009 22190 104 141
Genomic Location:
Chromosome 9 (position 43849269)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACAACCATTAAGAATTTGGACTTAACTGTGAAAAATCTTAATGAAAAT[G/T]AAGAATATGTATTCCRTGTGATGGCTGTAAATAGTTCTGGGCGAAGTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21563
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 15770 27263 147 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 Nonsense 10603 22190 104 141
Genomic Location:
Chromosome 9 (position 43847485)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCAGGTTAATCAGTACCAAGTGACAAAGTTGCTCAAAGGAAATGAATA[C/A]ATATTCCGAGTTATGGCTGTTAACAAGTATGGTGTTGGAGAGCCTATTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8875
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 16461 27263 147 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 Nonsense 11294 22190 104 141
Genomic Location:
Chromosome 9 (position 43845414)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAACTCAAATTAAGGCAGGAAGGCTGAAGACAGGCTCTGAATATCAATTC[A/T]GAATATCAGCAGAGAACAGATATGGCAAAAGCCCTATTCTTGTATCTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21562
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 16851 27263 147 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 Nonsense 11684 22190 104 141
Genomic Location:
Chromosome 9 (position 43844244)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAACCAAAAGTCCAAGCTGTAAGTCTTAAAATAACAAAACTCCTGGAA[G/T]GAAATGAATATATTTTCAGAGTTTTAGCAGTCAACAAATTTGGTGTTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21561
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 16899 27263 147 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 Nonsense 11732 22190 104 141
Genomic Location:
Chromosome 9 (position 43844099)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCCCAGATGCACCGAAAGGACTGGAAGTGTCTAATGTGAAGAAAGATT[C/A]AATGGTCTTAACCTGGGAGGCCCCAACAAATGATGGCGGTACAACCATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14401
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 17573 27263 147 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 Nonsense 12406 22190 104 141
Genomic Location:
Chromosome 9 (position 43842076)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGAATATCAATTCAGAATTATTGCTCAAAACAGGTATGGCAAGAKCTA[T/A]GCCYTGGACTCTTCAGCCGTTGTTATTCAGTATCCATATAGAGAACCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25436
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 18132 27263 147 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 Nonsense 12965 22190 104 141
Genomic Location:
Chromosome 9 (position 43840400)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCAATTCAAGGATATATTGTTGAGATTTGCAAGGCTGAAGAAGAAGAAT[G/A]GACTATGTGCACCCCCCCTACTGGCTTACGTGTTAATAAATTTGAAATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8738
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 18519 27263 147 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 Nonsense 13352 22190 104 141
Genomic Location:
Chromosome 9 (position 43839240)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGGACGTCCAAAACCAAAGATCACTTGGTCAAAGGATGGACAACAACTT[A/T]AAGTAACATCTAGAGTTACAACATCCAACACACCAACATCAACAATCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21560
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 18642 27263 147 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 Nonsense 13475 22190 104 141
Genomic Location:
Chromosome 9 (position 43838871)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCCAGAACATCCCTCAAAGTTACCAAGCTGAAAACTGGTGCTGAGTAT[C/T]AGTTTAGAGTTGTTGCGGAAAACAGATATGGTAAGGGTGCACCTTTGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16841
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 18701 27263 147 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 Nonsense 13534 22190 104 141
Genomic Location:
Chromosome 9 (position 43838693)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATCAAATGACAATTGAGTGGAATGAACCTGTGATTGATGGTGGCAGTT[C/A]AGTGATTGGATACCACCTAGAGAGTAAAGAAAGAAYAAGCATTCTATGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25435
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 19137 27263 147 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 Nonsense 13970 22190 104 141
Genomic Location:
Chromosome 9 (position 43837384)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGACTGATCTGCACTTCAAAGTAACTGGTCTGTCAGAGGGACATTTCTA[T/A]GAGTTCCGTGTGTCTGCTGAGAATGAAACTGGCGTGGGAGAATGTAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17186
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 19159 27263 147 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 Nonsense 13992 22190 104 141
Genomic Location:
Chromosome 9 (position 43837318)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGAGAATGAAACTGGCGTGGGAGAATGTAGTGATTTATCTCTGTTTTA[T/G]AGGGCAATAAATGCTACAACCCCCCCAGGCCCRCCTCATCATCCTAAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7209
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 19718 27263 147 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 Nonsense 14551 22190 104 141
Genomic Location:
Chromosome 9 (position 43835643)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTTTCAACAAATGTTGCCAGAACCTCAATCAAGGTACCTCGATTGACA[C/T]AGGGTTCTGAGTAYCAATTCCGCATTTATGCAGTGAATCGCTATGGAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18248
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 20876 27263 150 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 Nonsense 15709 22190 107 141
Genomic Location:
Chromosome 9 (position 43831891)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTTGATGGAGGAAATCCAGTATTTGGATACCATGTCCAAATGAAAGAA[C/T]GAAGCAGCATCCTTTGGCWGACATTGAACAAAACAGCAATCTCTGCAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16133
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 21210 27263 153 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 Nonsense 16043 22190 110 141
Genomic Location:
Chromosome 9 (position 43830580)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAGCTGATCAGAGGAAATGAATATGTATTCCGTGTCAGAGGTGTCAAC[A/T]AATTTGGAGTTGGGGATCCTCTGGAGTCTGAGCCTGTTATTGCCAAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5561
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 22146 27263 158 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 Nonsense 16979 22190 115 141
Genomic Location:
Chromosome 9 (position 43827281)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTGAGGGAGTCTCAATTAAAGCTGGAGAAAACATCAGGTTGAAAGTRT[C/A]AATCTCTGGAAGACCAGCGCCAAAAGTTACCTGGTACAGAGGTGATGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3712
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 22647 27263 160 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 Nonsense 17480 22190 117 141
Genomic Location:
Chromosome 9 (position 43825589)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGTTTGGGAACCTCCTACCAATGATGGTGGTGCAYGTGTTCATCATTA[T/A]GTTGTTGAAAAGCGTGAGGCAAGCCGTCGAACATGGACAGAGGCTGCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu7916
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 24824 27263 176 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 Nonsense 19751 22190 134 141
Genomic Location:
Chromosome 9 (position 43816988)
KASP Assay ID:
554-2426.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGGAAAAGCGTGAAGACAAAGAAGGAGCAGAGTGGGAATTAGTTTCAT[C/A]ATCCATCACAGGCACTTCATGCAGAATTCCTAACCTTGTTGAAAATGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21559
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 25852 27263 178 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 Nonsense 20779 22190 136 141
Genomic Location:
Chromosome 9 (position 43813716)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTGCCGATAACACCTTGAGACCTATGTTCAAACGCCTTCTTGCTAACT[T/A]GGAATGCAAAGAAGGCCAGAGTGTACGTTTTGAAATGCGAGTGTCCGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15731
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 26496 27263 178 183
ENSDART00000076454 None None 384 None 6
ENSDART00000100143 None None 484 None 5
ENSDART00000125953 Nonsense 21423 22190 136 141
Genomic Location:
Chromosome 9 (position 43811785)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACTYTTGATGTTGCTGGGGGTGGATTTTCTGCATATGCCTCACAACGC[A/T]AAGATGAGGAGCCACCAACTCCCTTTGTTCCAGAGATGACTAAAACAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14924
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 26820 27263 179 183
ENSDART00000076454 Nonsense 112 384 2 6
ENSDART00000100143 Nonsense 136 484 2 5
ENSDART00000125953 Nonsense 21747 22190 137 141
Genomic Location:
Chromosome 9 (position 43810723)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCAAGGTGGAAAATATGAAATCTTTGAAGAACATGGTTCAGCACATCTT[G/T]AAATCTATGATGCTGATCTCTCAGATAGTGGAGTATACACATGTACAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21558
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002299 Nonsense 27175 27263 183 183
ENSDART00000076454 Nonsense 296 384 6 6
ENSDART00000100143 Nonsense 396 484 5 5
ENSDART00000125953 Nonsense 22102 22190 141 141
Genomic Location:
Chromosome 9 (position 43807329)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCTTTTGTCTTTTAACCAGGTGTACCACCAAAGATTGAGGCTGCCCCT[C/T]GAGATATCAGCATTGAGCCAGGAAAGGTCCTTTCTGTAGCTTGTGCCTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Breast size: Genetic variants associated with breast size also influence breast cancer risk. (View Study)
  • RR interval (heart rate): A genome-wide association scan of RR and QT interval duration in 3 European genetically isolated populations: the EUROSPAN project. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ss1clepm