si:ch211-194d6.2

Ensembl ID:
ENSDARG00000000542
ZFIN ID:
ZDB-GENE-041210-221
Description:
general transcription factor IIE subunit 1 [Source:RefSeq peptide;Acc:NP_001038610]
Human Orthologue:
GTF2E1
Human Description:
general transcription factor IIE, polypeptide 1, alpha 56kDa [Source:HGNC Symbol;Acc:4650]
Mouse Orthologue:
Gtf2e1
Mouse Description:
general transcription factor II E, polypeptide 1 (alpha subunit) Gene [Source:MGI Symbol;Acc:MGI:192

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21495 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21495
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000566 Essential Splice Site 296 447 None 4
ENSDART00000138386 Essential Splice Site 296 447 None 5
ENSDART00000146860 Essential Splice Site 108 259 None 3
ENSDART00000148195   None 99 None 2
Genomic Location (Zv9):
Chromosome 9 (position 28727622)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 27883318
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAGTACAGTGCAGGGAGCGTACAACGAGACAGAAGCTCTGAAGAACCG[T/C]GAGTCATACCTGCTGTATTATATCATGGTGAAAGTAGTATTTATGATCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link