asnsd1

Ensembl ID:
ENSDARG00000000540
ZFIN ID:
ZDB-GENE-030616-362
Description:
Asparagine synthetase domain-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q8JFW1]
Human Orthologue:
ASNSD1
Human Description:
asparagine synthetase domain containing 1 [Source:HGNC Symbol;Acc:24910]
Mouse Orthologue:
Asnsd1
Mouse Description:
asparagine synthetase domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1917646]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17013 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17013
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000564 Nonsense 231 611 2 4
ENSDART00000131681 Nonsense 231 611 4 6
ENSDART00000133185 None None 76 None 3
Genomic Location:
Chromosome 9 (position 42160394)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGGTCTTCCCARATGTGTTTCTKTAAACACAAATAGTTCTGGACTTTA[C/A]CTGACCTCCCCTGTTTGTCCGATGAACACATCCATTTCATCACTTACAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9avg6wfg