ofd1

Ensembl ID:
ENSDARG00000000529
ZFIN ID:
ZDB-GENE-030131-5427
Description:
Oral-facial-digital syndrome 1 protein homolog [Source:UniProtKB/Swiss-Prot;Acc:Q7SZK7]
Human Orthologue:
OFD1
Human Description:
oral-facial-digital syndrome 1 [Source:HGNC Symbol;Acc:2567]
Mouse Orthologue:
Ofd1
Mouse Description:
oral-facial-digital syndrome 1 gene homolog (human) Gene [Source:MGI Symbol;Acc:MGI:1350328]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa169 Nonsense Confirmed mutation in F2 line During 2017
sa27508 Essential Splice Site Mutation detected in F1 DNA During 2017
sa34792 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa169
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000552 Nonsense 82 902 2 23
ENSDART00000099672   None 436 None 11

The following transcripts of ENSDARG00000000529 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 56720914)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 55128730
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTCTGCATGCAACAGTGTGGTGGTCGATCACCTGCGCAGCGCTGGCTA[T/G]GAGTACACACTGTCTGTCTTCCAGCCCGAATGCGGACTGAGCAAAGACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27508
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000552 Essential Splice Site 767 902 18 23
ENSDART00000099672 Essential Splice Site 301 436 6 11

The following transcripts of ENSDARG00000000529 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 56744582)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 55152396
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGCAGCCAGAGAAAATCACACTGCACGACCTGACGGAGCCCATACAGAG[T/C]AAGAGCACACACACACACACACACACACACACGTGTCTGTGTTTGTTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34792
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000552 Nonsense 837 902 21 23
ENSDART00000099672 Nonsense 371 436 9 11

The following transcripts of ENSDARG00000000529 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 56745532)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 55153346
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGGAACAAACACAAGAGCAGCGTGATGATGCTGGGGGTCATGTGACTT[C/A]AGCGGCCTCACCGACTGGAGGAGCAGAAGAGGCCAATCCGCTGCAGAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link