cntn2

Ensembl ID:
ENSDARG00000000472
ZFIN IDs:
ZDB-GENE-990630-12, ZDB-GENE-990630-12
Description:
contactin-2 [Source:RefSeq peptide;Acc:NP_571521]
Human Orthologue:
CNTN2
Human Description:
contactin 2 (axonal) [Source:HGNC Symbol;Acc:2172]
Mouse Orthologue:
Cntn2
Mouse Description:
contactin 2 Gene [Source:MGI Symbol;Acc:MGI:104518]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9412 Nonsense Available for shipment Available now
sa19006 Nonsense Mutation detected in F1 DNA During 2014
sa21903 Nonsense Mutation detected in F1 DNA During 2014
sa12173 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9412
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000486 Nonsense 109 853 3 18
ENSDART00000103800 None None 412 None 10
ENSDART00000000486 Nonsense 109 853 3 18
ENSDART00000103800 None None 412 None 10
Genomic Location:
Chromosome 11 (position 24888728)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTGTGATCAACAACCCTCAGAATGGGCGAGATGGCGGCTCGTACCAGTG[T/A]CTCGCAATCAACCGATGCRGCACCATTGTTAGCCGCGTCGCTAATCTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19006
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000486 Nonsense 109 853 3 18
ENSDART00000103800 None None 412 None 10
ENSDART00000000486 Nonsense 109 853 3 18
ENSDART00000103800 None None 412 None 10
Genomic Location:
Chromosome 11 (position 24888728)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGTGATCAACAACCCTCAGAATGGGCGAGATGGCGGCTCGTACCAGTG[T/A]CTCGCAATCAACCGATGCGGCACCATTGTTAGCCGCGTCGCTAATCTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21903
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000486 Nonsense 693 853 15 18
ENSDART00000103800 Nonsense 252 412 7 10
Genomic Location:
Chromosome 11 (position 24899036)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTCGGCCCTGGATGGATTATGAGTTCCAGGTCATTGCCAGCAACATCT[T/A]GGGCAGCGGAGAACCAAGCATGCCTTCCCCGCGTGCACAAACCAAAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12173
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000486 Nonsense 775 853 17 18
ENSDART00000103800 Nonsense 334 412 9 10
Genomic Location:
Chromosome 11 (position 24900509)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATGGACGGTGGTGAAGGTGCCAAATGTGGAGTCATCTCGATATGTGTA[C/A]AGCAATGACAGTCTGACAGCATACTGCCCGTTCGAGGTCCGAATCAAGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ktbwhagj