matr3l1.2

Ensembl ID:
ENSDARG00000000394
ZFIN ID:
ZDB-GENE-090505-1
Description:
matrin 3-like [Source:RefSeq peptide;Acc:NP_001116256]
Human Orthologue:
MATR3
Human Description:
matrin 3 [Source:HGNC Symbol;Acc:6912]
Mouse Orthologue:
Matr3
Mouse Description:
matrin 3 Gene [Source:MGI Symbol;Acc:MGI:1298379]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19083 Nonsense Mutation detected in F1 DNA During 2014
sa4559 Nonsense Mutation detected in F1 DNA During 2014
sa12416 Nonsense Available for shipment Available now
sa22477 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19083
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000406 Nonsense 338 1139 5 20
ENSDART00000136630 None None 257 None 8
ENSDART00000144168 Nonsense 338 1139 6 21
ENSDART00000000406 Nonsense 338 1139 5 20
ENSDART00000136630 None None 257 None 8
ENSDART00000144168 Nonsense 338 1139 6 21
Genomic Location:
Chromosome 14 (position 26171194)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTTAGGGCCTGATGCCAGTATGGGAATGACAAGAAAACAAACTTCATA[T/A]TCTTCAGCACCCAAGGTAATAATGTTTTGATGTTAAATTGGTCCAAGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4559
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000406 Nonsense 338 1139 5 20
ENSDART00000136630 None None 257 None 8
ENSDART00000144168 Nonsense 338 1139 6 21
ENSDART00000000406 Nonsense 338 1139 5 20
ENSDART00000136630 None None 257 None 8
ENSDART00000144168 Nonsense 338 1139 6 21
Genomic Location:
Chromosome 14 (position 26171194)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTTAGGGCCTGAWGCCAGTATGGGAATGACAAGAAAACAAACTTCATA[T/A]TCTTCAGCACCCAAGGTAATAATGTTTTGATGTTAAATTGGTCCAAGRGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12416
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000406 Nonsense 375 1139 6 20
ENSDART00000136630 None None 257 None 8
ENSDART00000144168 Nonsense 375 1139 7 21
Genomic Location:
Chromosome 14 (position 26170923)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCAACAAACAGCCTGCTTGCCTWGGCAAAACCATTTGGCACCATYTGT[G/T]AGCATCTCATCCTGAATAACAAGGTAATGGCTGTATATGTTTTAGGCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22477
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000406 Nonsense 1092 1139 19 20
ENSDART00000136630 None None 257 None 8
ENSDART00000144168 Nonsense 1092 1139 20 21
Genomic Location:
Chromosome 14 (position 26158345)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGCTTCTTCTGCTCTGGTTTCAGGTGTGGAGTTTGTGAAGATGGGATA[T/G]TATTGCAGAGTCTGCTTCCTGTTTTACTCCAATGAGGACACTGCTAAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yd6o8e7x