matr3l1.2

Ensembl ID:
ENSDARG00000000394
ZFIN ID:
ZDB-GENE-090505-1
Description:
matrin 3-like [Source:RefSeq peptide;Acc:NP_001116256]
Human Orthologue:
MATR3
Human Description:
matrin 3 [Source:HGNC Symbol;Acc:6912]
Mouse Orthologue:
Matr3
Mouse Description:
matrin 3 Gene [Source:MGI Symbol;Acc:MGI:1298379]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12416 Nonsense Available for shipment Available now
sa22477 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12416
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000406 Nonsense 375 1139 6 20
ENSDART00000136630   None 257 None 8
ENSDART00000144168 Nonsense 375 1139 7 21
Genomic Location (Zv9):
Chromosome 14 (position 26170923)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 24795622
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCAACAAACAGCCTGCTTGCCTWGGCAAAACCATTTGGCACCATYTGT[G/T]AGCATCTCATCCTGAATAACAAGGTAATGGCTGTATATGTTTTAGGCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22477
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000406 Nonsense 1092 1139 19 20
ENSDART00000136630   None 257 None 8
ENSDART00000144168 Nonsense 1092 1139 20 21
Genomic Location (Zv9):
Chromosome 14 (position 26158345)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 24783044
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGCTTCTTCTGCTCTGGTTTCAGGTGTGGAGTTTGTGAAGATGGGATA[T/G]TATTGCAGAGTCTGCTTCCTGTTTTACTCCAATGAGGACACTGCTAAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link