pde6a

Ensembl ID:
ENSDARG00000000380
ZFIN ID:
ZDB-GENE-030616-42
Description:
rod cGMP-specific 3',5'-cyclic phosphodiesterase subunit alpha [Source:RefSeq peptide;Acc:NP_001007
Human Orthologue:
PDE6A
Human Description:
phosphodiesterase 6A, cGMP-specific, rod, alpha [Source:HGNC Symbol;Acc:8785]
Mouse Orthologue:
Pde6a
Mouse Description:
phosphodiesterase 6A, cGMP-specific, rod, alpha Gene [Source:MGI Symbol;Acc:MGI:97524]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35692 Nonsense Mutation detected in F1 DNA During 2017
sa14581 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35692
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000392 Nonsense 24 858 1 22
Genomic Location (Zv9):
Chromosome 14 (position 26112057)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 24736756
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGCTGAGAAGTTTTTGGACAGTAATCCAATGTTTGCCAAGCAATACTA[T/G]GACTCCAGGTTCCGGGCGAAGGTCGTCTCTGACCTTCTTTCGACCACTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14581
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000392 Nonsense 70 858 1 22
Genomic Location (Zv9):
Chromosome 14 (position 26111921)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 24736620
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGCTCTATGGAGGAGTGTGAGATTATTTTTGACATGGTGCGGGACATG[C/T]AGGAGAACCTGCATATGGAGAGRGCCGTGTTTAACCTCATGCGGCATCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link