trio

Ensembl ID:
ENSDARG00000000370
ZFIN ID:
ZDB-GENE-030616-399
Description:
Novel protein similar to human triple functional domain protein TRIO (PTPRF interacting) [Source:Uni
Human Orthologue:
TRIO
Human Description:
triple functional domain (PTPRF interacting) [Source:HGNC Symbol;Acc:12303]
Mouse Orthologue:
Trio
Mouse Description:
triple functional domain (PTPRF interacting) Gene [Source:MGI Symbol;Acc:MGI:1927230]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22758 Nonsense Mutation detected in F1 DNA During 2014
sa4638 Nonsense Mutation detected in F1 DNA During 2014
sa17346 Nonsense Available for shipment Available now
sa10735 Essential Splice Site Available for shipment Available now
sa12241 Essential Splice Site Available for shipment Available now
sa22757 Essential Splice Site Mutation detected in F1 DNA During 2014
sa6408 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22758
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000382 Nonsense 363 2996 6 59
Genomic Location:
Chromosome 16 (position 10215353)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAGTCGGATTATGTCAGTGGGGAACAGGCTGCTGGAGTCAGGTCACTA[T/A]GCGACCCAGCAGATTCAGCAGATCTCAGGTCAGCTGGAGCAAGAGTGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4638
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000382 Nonsense 393 2996 6 59
Genomic Location:
Chromosome 16 (position 10215264)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAAGAGTGGAAAGCATTCGCCGCTGCACTGGAYGAGAGAAGYACACTGT[T/A]GGAAATGTCTGCCAACTTCCACCAGAAAACWGACCAGGTGAGGCTCATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17346
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000382 Nonsense 1932 2996 41 59
Genomic Location:
Chromosome 16 (position 10101636)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGATTTTCAGCTACGTCCTGCTGGAACTGGTGGAAACAGAAAGAGACTA[T/A]GTGAGAGACCTTGGTGCAGTCGTGGAGGTGGGCTCATATTCACTTCTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10735
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000382 Essential Splice Site 1999 2996 43 59
Genomic Location:
Chromosome 16 (position 10101017)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAGTGCTTGGAGGACCCCGATAGACTYGCACCCCTSTTTGTCAGACAG[G/A]TAGGGAATGAATCATTGTGCCATTTCACTCTYACTAAKATAAATTCSCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12241
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000382 Essential Splice Site 2228 2996 49 59
ENSDART00000000382 Essential Splice Site 2228 2996 49 59
Genomic Location:
Chromosome 16 (position 10090727)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCCACCAGATCAGCAGCATCCTGGAGAACCAGAGAAACTTCCTTAATGG[T/A]ATTATTCAGACAGTGTCCTTTAAACTAATCRTCATAAATATTTTTAATRA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22757
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000382 Essential Splice Site 2228 2996 49 59
ENSDART00000000382 Essential Splice Site 2228 2996 49 59
Genomic Location:
Chromosome 16 (position 10090727)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCACCAGATCAGCAGCATCCTGGAGAACCAGAGAAACTTCCTTAATGG[T/C]ATTATTCAGACAGTGTCCTTTAAACTAATCGTCATAAATATTTTTAATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6408
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000382 Nonsense 2456 2996 51 59
Genomic Location:
Chromosome 16 (position 10087119)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTGCTGTCAGAGTGAAAGCAGCAGCAGCAGCAGTGTGTCYACCATGT[T/A]GGTGACCCAGGACTACGTGGCTCTAAAGGAGGATGAGATCAGCGTATATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qp60g7fm