ptpn4b

Ensembl ID:
ENSDARG00000000183
ZFIN ID:
ZDB-GENE-030131-6259
Description:
protein tyrosine phosphatase, non-receptor type 4, b [Source:RefSeq peptide;Acc:NP_001037778]
Human Orthologue:
PTPN4
Human Description:
protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte) [Source:HGNC Symbol;Acc:9656]
Mouse Orthologue:
Ptpn4
Mouse Description:
protein tyrosine phosphatase, non-receptor type 4 Gene [Source:MGI Symbol;Acc:MGI:1099792]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37452 Essential Splice Site Available for shipment Available now
sa19280 Nonsense Available for shipment Available now
sa30727 Nonsense Mutation detected in F1 DNA During 2017
sa24100 Missense, Nonsense Available for shipment Available now
sa11409 Nonsense Available for shipment Available now
sa29737 Essential Splice Site Mutation detected in F1 DNA During 2017
sa32386 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37452
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000192 Essential Splice Site 82 934 2 26
ENSDART00000105792   None 239 None 8
ENSDART00000121808   None 70 None 4
ENSDART00000125423 Essential Splice Site 82 930 2 26
ENSDART00000126784 Essential Splice Site 47 185 2 8
Genomic Location (Zv9):
Chromosome 22 (position 11935896)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 11796064
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCGAGATTACTTCGGCCTTCAGCTAGCAGACGACACTTCTGACACCCAG[G/A]TAAACACCTACCTGTTACCCAAAAACCCTTTTTCATTCAACAAGCAGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19280
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000192 Nonsense 170 934 7 26
ENSDART00000105792   None 239 None 8
ENSDART00000121808   None 70 None 4
ENSDART00000125423 Nonsense 170 930 7 26
ENSDART00000126784 Nonsense 135 185 7 8
Genomic Location (Zv9):
Chromosome 22 (position 11928889)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 11789057
KASP Assay ID:
2261-6515.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTCAGCTGAACTGGGAGACTACAGTCACTCTGAGCATTTGTCCGGCTA[T/A]CTGTCGGAGTACAGCTTCATTCCCAATCCTCCGCAGGACTTCGAAAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30727
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000192 Nonsense 651 934 19 26
ENSDART00000105792 Nonsense 18 239 1 8
ENSDART00000121808 Nonsense 39 70 2 4
ENSDART00000125423 Nonsense 652 930 19 26
ENSDART00000126784   None 185 None 8
Genomic Location (Zv9):
Chromosome 22 (position 11902039)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 11762207
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGAGTCACTCAGAGGCCGACAGTCTCCGATCCTCCATTCAGCTGCTC[C/T]GAGACGGACTTGCGAGCGGCACCGTACCCGCACAGTTTGACGTAAGATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24100
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000192 Nonsense 682 934 20 26
ENSDART00000105792 Nonsense 49 239 2 8
ENSDART00000121808 Missense 70 70 4 4
ENSDART00000125423 Nonsense 683 930 20 26
ENSDART00000126784   None 185 None 8
Genomic Location (Zv9):
Chromosome 22 (position 11900588)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 11760756
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTGTACAGGAAGCGTCCCGGGATGTCCATGTCTTGTGCCAGATTGCCA[C/T]AAAATGTCTCCAAAAACCGCTATCGGGACATTTCTCCATGTAAGTGCGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11409
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000192 Nonsense 699 934 21 26
ENSDART00000105792 Nonsense 66 239 3 8
ENSDART00000121808   None 70 None 4
ENSDART00000125423 Nonsense 700 930 21 26
ENSDART00000126784   None 185 None 8
Genomic Location (Zv9):
Chromosome 22 (position 11900449)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 11760617
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATTATCTTAATATTGCTAATGTTATTTTGTGATGCAGATGACAGCACT[C/T]GAGTCGTACTGAAGGGGACGGAGGATTATATCAATGCAAACTTCATCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29737
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000192 Essential Splice Site 715 934 21 26
ENSDART00000105792 Essential Splice Site 82 239 3 8
ENSDART00000121808   None 70 None 4
ENSDART00000125423 Essential Splice Site 716 930 21 26
ENSDART00000126784   None 185 None 8
Genomic Location (Zv9):
Chromosome 22 (position 11900397)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 11760565
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCGTACTGAAGGGGACGGAGGATTATATCAATGCAAACTTCATCAATG[T/C]GAGCGGTTGACCCTGGTTATTTTTGATTTTCCAGCTGTTTAATATGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32386
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000192 Nonsense 883 934 25 26
ENSDART00000105792   None 239 None 8
ENSDART00000121808   None 70 None 4
ENSDART00000125423 Nonsense 879 930 25 26
ENSDART00000126784   None 185 None 8
Genomic Location (Zv9):
Chromosome 22 (position 11894535)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 11754703
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCACAATGGAGACAGCGATGTGTTTAATAGAAGGCGGTCAGTCAGTGTA[T/A]CCGCTGGACATCGTCAGAACCATGAGAGACCAGCGGGCCATGATGATCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link