hoxb2a

Ensembl ID:
ENSDARG00000000175
ZFIN ID:
ZDB-GENE-990415-103
Description:
Homeobox protein Hox-B2a [Source:UniProtKB/Swiss-Prot;Acc:O42367]
Human Orthologue:
HOXB2
Human Description:
homeobox B2 [Source:HGNC Symbol;Acc:5113]
Mouse Orthologue:
Hoxb2
Mouse Description:
homeobox B2 Gene [Source:MGI Symbol;Acc:MGI:96183]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33161 Nonsense Mutation detected in F1 DNA During 2016
sa14119 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33161
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007226 Nonsense 205 390 2 2
ENSDART00000146636 Nonsense 224 409 2 2
Genomic Location (Zv9):
Chromosome 3 (position 24044978)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 23623189
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGAAATTGCAGCACTTTTGGATCTAACCGAGCGACAAGTCAAAGTGTG[G/A]TTTCAAAATCGACGCATGAAGCACAAACGACAAACTACACACCACCGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14119
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007226 Nonsense 319 390 2 2
ENSDART00000146636 Nonsense 338 409 2 2
Genomic Location (Zv9):
Chromosome 3 (position 24045318)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 23623529
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCCGTATCCWACGCCTACTGCAGATAACCCCACCACAATGGCTGAGGGC[C/T]GAGCAGCTGGGCCGGAGCATTCGTTCACAGAGCCGCAGGATGCCACCTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link