hoxb2a

Ensembl ID:
ENSDARG00000000175
ZFIN ID:
ZDB-GENE-990415-103
Description:
Homeobox protein Hox-B2a [Source:UniProtKB/Swiss-Prot;Acc:O42367]
Human Orthologue:
HOXB2
Human Description:
homeobox B2 [Source:HGNC Symbol;Acc:5113]
Mouse Orthologue:
Hoxb2
Mouse Description:
homeobox B2 Gene [Source:MGI Symbol;Acc:MGI:96183]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5199 Nonsense Mutation detected in F1 DNA During 2016
sa33161 Nonsense Mutation detected in F1 DNA During 2016
sa14119 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa5199
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007226   None 390 1 2
ENSDART00000146636 Nonsense 2 409 1 2
Genomic Location:
Chromosome 3 (position 24043461)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAATGCCGCCATAGCAGGAGCGCAAAATAAATCATAGCTTTTTGGATGT[T/A]ATTTTTTGCGTGWGTTGGTGTCGCTGGACGCCCTTTTTGCCCAGGCGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33161
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007226 Nonsense 205 390 2 2
ENSDART00000146636 Nonsense 224 409 2 2
Genomic Location:
Chromosome 3 (position 24044978)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGAAATTGCAGCACTTTTGGATCTAACCGAGCGACAAGTCAAAGTGTG[G/A]TTTCAAAATCGACGCATGAAGCACAAACGACAAACTACACACCACCGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14119
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007226 Nonsense 319 390 2 2
ENSDART00000146636 Nonsense 338 409 2 2
Genomic Location:
Chromosome 3 (position 24045318)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCCGTATCCWACGCCTACTGCAGATAACCCCACCACAATGGCTGAGGGC[C/T]GAGCAGCTGGGCCGGAGCATTCGTTCACAGAGCCGCAGGATGCCACCTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link