thraa

Ensembl ID:
ENSDARG00000000151
ZFIN ID:
ZDB-GENE-990415-263
Description:
Thyroid hormone receptor alpha-A [Source:UniProtKB/Swiss-Prot;Acc:Q98867]
Human Orthologue:
THRA
Human Description:
thyroid hormone receptor, alpha (erythroblastic leukemia viral (v-erb-a) oncogene homolog, avian) [S
Mouse Orthologue:
Thra
Mouse Description:
thyroid hormone receptor alpha Gene [Source:MGI Symbol;Acc:MGI:98742]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25254 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa25254
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000160 Nonsense 97 427 5 10
ENSDART00000112817 Nonsense 91 466 4 11
Genomic Location:
Chromosome 3 (position 34799359)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGGAGGACAATACAGAAAAACCTTCATCCGTCCTATTCCTGTAAATA[T/G]GACAGCTGCTGCATCATTGACAAAATCACCCGCAACCAGTGCCAGCTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/md7xck9z