thraa

Ensembl ID:
ENSDARG00000000151
ZFIN ID:
ZDB-GENE-990415-263
Description:
Thyroid hormone receptor alpha-A [Source:UniProtKB/Swiss-Prot;Acc:Q98867]
Human Orthologue:
THRA
Human Description:
thyroid hormone receptor, alpha (erythroblastic leukemia viral (v-erb-a) oncogene homolog, avian) [S
Mouse Orthologue:
Thra
Mouse Description:
thyroid hormone receptor alpha Gene [Source:MGI Symbol;Acc:MGI:98742]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31342 Essential Splice Site Available for shipment Available now
sa25254 Nonsense Mutation detected in F1 DNA During 2016
sa31341 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31342
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000160 Essential Splice Site 78 427 4 10
ENSDART00000112817 Essential Splice Site 72 466 3 11
Genomic Location (Zv9):
Chromosome 3 (position 34799503)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 34584699
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAGGCCACTGGCTATCATTACCGCTGCATCACATGTGAGGGCTGCAAG[G/A]TGAGACTTCCAGCGTCTGAAGCGCTTGACTCGTGATAAATCTGTATTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25254
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000160 Nonsense 97 427 5 10
ENSDART00000112817 Nonsense 91 466 4 11
Genomic Location (Zv9):
Chromosome 3 (position 34799359)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 34584555
KASP Assay ID:
554-7658.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGGAGGACAATACAGAAAAACCTTCATCCGTCCTATTCCTGTAAATA[T/G]GACAGCTGCTGCATCATTGACAAAATCACCCGCAACCAGTGCCAGCTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31341
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000160 Nonsense 367 427 9 10
ENSDART00000112817 Nonsense 361 466 8 11
Genomic Location (Zv9):
Chromosome 3 (position 34786727)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 34571923
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATTCGAGCACTACATCAACCACCGCAAGCACAACATCTCCCACTTCTG[G/A]CCCAAGCTGCTGATGAAGGTGACGAACCTGCGCATGATCGGCGCCTGCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link