myh10

Ensembl ID:
ENSDARG00000000103
ZFIN ID:
ZDB-GENE-030616-162
Description:
Novel protein similar to human non-muscle myosin, heavy polypeptide 10 (MYH10) [Source:UniProtKB/TrE
Human Orthologue:
MYH10
Human Description:
myosin, heavy chain 10, non-muscle [Source:HGNC Symbol;Acc:7568]
Mouse Orthologue:
Myh10
Mouse Description:
myosin, heavy polypeptide 10, non-muscle Gene [Source:MGI Symbol;Acc:MGI:1930780]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5750 Essential Splice Site F2 line generated During 2016
sa2305 Essential Splice Site F2 line generated During 2016
sa5349 Splice Site, Nonsense Mutation detected in F1 DNA During 2016
sa33803 Essential Splice Site Mutation detected in F1 DNA During 2016
sa20627 Nonsense Mutation detected in F1 DNA During 2016
sa40631 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa5750
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046359 Essential Splice Site 171 1992 2 42
ENSDART00000046359 Essential Splice Site 171 1992 2 42
Genomic Location:
Chromosome 6 (position 7483048)
KASP Assay ID:
554-2901.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCATATCTACGCCATTTCCGAATCGGCATACAGATGCATGCTTCAAGG[T/C]AAGACCACATTTGWGAAGTATTCCTTCAGATTCCTTCCTTTYAGTGGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2305
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046359 Essential Splice Site 171 1992 2 42
ENSDART00000046359 Essential Splice Site 171 1992 2 42
Genomic Location:
Chromosome 6 (position 7483048)
KASP Assay ID:
554-2901.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCATATCTACGCCATTTCCGAATCGGCATACAGATGCATGCTTCAAGG[T/C]AAGACCACATTTGWGAAGTATTCCTTCAGATTCCTTCCTTTCAGTGGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5349
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046359 Splice Site, Nonsense 283 1992 9 42
Genomic Location:
Chromosome 6 (position 7519754)
KASP Assay ID:
2259-7110.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAAATTGGCTGTACAATAGGCTTCACTTGCCCTTAACACAATCTCAAGA[T/A]CTTCTTGAAAAGTCCAGGGCCATTCGCCAAGCCAAAGATGAACGCACCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33803
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046359 Essential Splice Site 435 1992 12 42
Genomic Location:
Chromosome 6 (position 7525151)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCAAAGTGGGCAGAGACTACGTACAGAAAGCCCAAACTAAAGAACAGG[T/A]AATGAGATAATCACTTCCCCTTTGTAAATCTGTCAGATCACCACCCCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20627
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046359 Nonsense 518 1992 14 42
Genomic Location:
Chromosome 6 (position 7528713)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCAGCAGCTCTTCAACCACACCATGTTCATCCTGGAGCAGGAGGAGTA[T/A]CAGCGGGAAGGCATCGAATGGAGCTTCATCGACTTCGGCCTCGACCTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40631
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046359 Nonsense 1832 1992 39 42
Genomic Location:
Chromosome 6 (position 7569259)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTAAAATCCAAGCTGCAGGAACTCGAGGGATCCGTCAAATCAAAGTTC[A/T]AGGCCTCTATCGCCGCCCTGGAGGCAAAGATCCTCCAGCTAGAGGAGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link