NP_956202.1

Ensembl ID:
ENSDARG00000000102
Description:
skeletal muscle receptor tyrosine kinase isoform 1 [Source:RefSeq peptide;Acc:NP_001004503]
Human Orthologue:
MUSK
Human Description:
muscle, skeletal, receptor tyrosine kinase [Source:HGNC Symbol;Acc:7525]
Mouse Orthologue:
Musk
Mouse Description:
muscle, skeletal, receptor tyrosine kinase Gene [Source:MGI Symbol;Acc:MGI:103581]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41605 Nonsense Mutation detected in F1 DNA During 2017
sa41604 Nonsense Mutation detected in F1 DNA During 2017
sa17664 Nonsense Available for shipment Available now
sa34861 Nonsense Mutation detected in F1 DNA During 2017
sa41603 Essential Splice Site Mutation detected in F1 DNA During 2017
sa1030 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa41605
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000102 Nonsense 216 941 6 18
ENSDART00000064922 Nonsense 216 941 6 17
ENSDART00000111076 Nonsense 216 351 6 6
Genomic Location (Zv9):
Chromosome 10 (position 13105786)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 13183877
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTTGTCCCTGACTTTCCTAAAGCTCCTGCCAAGATACTGAAAGTTCCC[A/T]AGGAAAAGCGAGTTCAGATTGGATCAGAGGTCACATTAGAGTGCAACGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41604
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000102   None 941 None 18
ENSDART00000064922   None 941 None 17
ENSDART00000111076 Nonsense 280 351 6 6
Genomic Location (Zv9):
Chromosome 10 (position 13105593)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 13183684
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTCATTCCCTTCTTTTCCTCTTGCTTGCTTTGGCCCTGCAGAGAAAAT[T/A]AATCGTACTTTCTTCTCATCTTACTGGAACAGAGAGCAGAGCACAGGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17664
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000102 Nonsense 268 941 7 18
ENSDART00000064922 Nonsense 268 941 7 17
ENSDART00000111076   None 351 None 6
Genomic Location (Zv9):
Chromosome 10 (position 13087274)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 13165365
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCATCTGTGGTGGAGACACTGGTGGGGRAAGTTATACTGTCAGTTCTG[C/T]AAGTGGTKGTCCATAAACCAGCACTCTACACCTKTCAGGCTACTAATCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34861
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000102 Nonsense 483 941 12 18
ENSDART00000064922 Nonsense 483 941 11 17
ENSDART00000111076   None 351 None 6

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 13060329)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 13138420
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACACACAATGTCACAGCATCGTCCATTCCATGTCAGCGATGGAACCAG[C/T]AGGTAAATGTTTGTACTGCAAAAGTCAGCATAAAATCACAAAGTTATGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41603
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000102 Essential Splice Site 599 941 16 18
ENSDART00000064922 Essential Splice Site 599 941 15 17
ENSDART00000111076   None 351 None 6
Genomic Location (Zv9):
Chromosome 10 (position 13050948)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 13129140
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACAGTTTTAACTAAATACCTCAAAACTAAACAGTTGTTCTTCCATATTC[A/G]GTAGGGTGCTGGAGACACCTACATTGACCACCCTCCCCTCAGAGCTCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1030
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000102 Nonsense 779 941 18 18
ENSDART00000064922 Nonsense 779 941 17 17
ENSDART00000111076   None 351 None 6
Genomic Location (Zv9):
Chromosome 10 (position 13049154)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 13127346
KASP Assay ID:
554-0934.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACCTGAGCGTTACCCACCCCTCAGCTGCCAGGAGCAGCTCTCCATTTCC[A/T]AACAGGTGGCAGCAGGAATGGCGTACTTATCGGAGCGCAAATTTGTCCAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link