itsn1

Ensembl ID:
ENSDARG00000000086
ZFIN ID:
ZDB-GENE-030616-226
Description:
intersectin-1 [Source:RefSeq peptide;Acc:NP_997065]
Human Orthologue:
ITSN1
Human Description:
intersectin 1 (SH3 domain protein) [Source:HGNC Symbol;Acc:6183]
Mouse Orthologue:
Itsn1
Mouse Description:
intersectin 1 (SH3 domain protein 1A) Gene [Source:MGI Symbol;Acc:MGI:1338069]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15350 Essential Splice Site Available for shipment Available now
sa25652 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa15350
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000087 Essential Splice Site 264 1746 8 38
ENSDART00000132378 Essential Splice Site 240 1722 8 38
ENSDART00000139573 Essential Splice Site 240 1221 8 28
Genomic Location:
Chromosome 1 (position 47552390)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTATTCTRATGCAGTCCAGTCTACCACAAGCCCAGCTGGCCACCATCTGG[T/C]GCGGATCCAACCTGTTTTTTCTTRCTCTGTCTCYGTCTCGCATTAAAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25652
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000087 Nonsense 1217 1746 27 38
ENSDART00000132378 Nonsense 1193 1722 27 38
ENSDART00000139573 Nonsense 1193 1221 27 28
Genomic Location:
Chromosome 1 (position 47517055)
KASP Assay ID:
2259-1008.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCGGGAAGGGCCAAATCATCAATGTGTTGAGCAGAGAGGATCCCGATTG[G/A]TGGAAAGGAGAGTTGAATGGATCCGTCGGCCTCTTCCCCTCGAACTACGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/et1jpmhy