itsn1

Ensembl ID:
ENSDARG00000000086
ZFIN ID:
ZDB-GENE-030616-226
Description:
intersectin-1 [Source:RefSeq peptide;Acc:NP_997065]
Human Orthologue:
ITSN1
Human Description:
intersectin 1 (SH3 domain protein) [Source:HGNC Symbol;Acc:6183]
Mouse Orthologue:
Itsn1
Mouse Description:
intersectin 1 (SH3 domain protein 1A) Gene [Source:MGI Symbol;Acc:MGI:1338069]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15350 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15350
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000087 Essential Splice Site 264 1746 8 38
ENSDART00000132378 Essential Splice Site 240 1722 8 38
ENSDART00000139573 Essential Splice Site 240 1221 8 28
Genomic Location:
Chromosome 1 (position 47552390)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTATTCTRATGCAGTCCAGTCTACCACAAGCCCAGCTGGCCACCATCTGG[T/C]GCGGATCCAACCTGTTTTTTCTTRCTCTGTCTCYGTCTCGCATTAAAAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/et1jpmhy