nrf1

Ensembl ID:
ENSDARG00000000018
ZFIN ID:
ZDB-GENE-001221-1
Description:
Nuclear respiratory factor 1 [Source:UniProtKB/Swiss-Prot;Acc:Q90X44]
Human Orthologue:
NRF1
Human Description:
nuclear respiratory factor 1 [Source:HGNC Symbol;Acc:7996]
Mouse Orthologue:
Nrf1
Mouse Description:
nuclear respiratory factor 1 Gene [Source:MGI Symbol;Acc:MGI:1332235]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33432 Nonsense Available for shipment Available now
sa9538 Nonsense Available for shipment Available now
sa20242 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33432
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000019 Nonsense 200 514 5 11
ENSDART00000138183 Nonsense 200 504 5 11
Genomic Location (Zv9):
Chromosome 4 (position 14164780)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 15100633
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCTGAACTTCCTCCGCTGACTATTGATGGGATACCAGTGTCTGTGGAC[A/T]AGATGACACAGGTGGGCAGCAGGTGGCGCTCTGAGCCAGGAGTCAAACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9538
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000019 Nonsense 284 514 7 11
ENSDART00000138183 Nonsense 284 504 7 11
Genomic Location (Zv9):
Chromosome 4 (position 14160662)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 15096515
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAAAAACTGCTATAAGCAGCATGGGAGAGAAGACCTGCTCTATGCCTTT[G/T]AGGACCAGGTCACCACACAAGTTGCCACAACAGCCACACACAGCAYTGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20242
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000019 Essential Splice Site 357 514 8 11
ENSDART00000138183 Essential Splice Site 357 504 8 11
Genomic Location (Zv9):
Chromosome 4 (position 14159258)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 15095111
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAGTGACAGTAGCCCAGGTGAACTACTCCACAGTGACGGATGGAGAGG[T/C]ACCATTAACACACACAGTTTCTTACCTTAATATTCCACTAGATTGCATCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link