ID: 485345259 |
View in Genome Browser |
Species | Mouse (GRCm38) |
Location | 5:66988294-66988316 |
Sequence | ACGCAGCTGGTACTTGAAAA CGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 80 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 5, 4: 74} |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
485345259_485345267 | 6 | Complete | closest: None total_pairs: 1 max_distance: 1000 |
Left | 485345259 | 5:66988294-66988316 | CCGTTTTCAAGTACCAGCTGCGT | 0: 1 1: 0 2: 0 3: 5 4: 74 |
Right | 485345267 | 5:66988323-66988345 | GGCCTCGCTAAATTAAAAGGGGG | 0: 1 1: 0 2: 0 3: 4 4: 28 |
||||
485345259_485345265 | 4 | Complete | closest: None total_pairs: 1 max_distance: 1000 |
Left | 485345259 | 5:66988294-66988316 | CCGTTTTCAAGTACCAGCTGCGT | 0: 1 1: 0 2: 0 3: 5 4: 74 |
Right | 485345265 | 5:66988321-66988343 | GGGGCCTCGCTAAATTAAAAGGG | 0: 1 1: 0 2: 0 3: 3 4: 44 |
||||
485345259_485345266 | 5 | Complete | closest: None total_pairs: 1 max_distance: 1000 |
Left | 485345259 | 5:66988294-66988316 | CCGTTTTCAAGTACCAGCTGCGT | 0: 1 1: 0 2: 0 3: 5 4: 74 |
Right | 485345266 | 5:66988322-66988344 | GGGCCTCGCTAAATTAAAAGGGG | 0: 1 1: 0 2: 0 3: 0 4: 56 |
||||
485345259_485345264 | 3 | Complete | closest: None total_pairs: 1 max_distance: 1000 |
Left | 485345259 | 5:66988294-66988316 | CCGTTTTCAAGTACCAGCTGCGT | 0: 1 1: 0 2: 0 3: 5 4: 74 |
Right | 485345264 | 5:66988320-66988342 | AGGGGCCTCGCTAAATTAAAAGG | 0: 1 1: 0 2: 0 3: 7 4: 32 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
485345259 | Original CRISPR | ACGCAGCTGGTACTTGAAAA CGG (reversed) | Intronic | ||