High Throughput Gene Targeting: Create Design

This custom vector design tool is provided by the EUCOMM consortium as a service to the research community. When using this tool, the user agrees not to submit more than five designs per day for creation without prior discussion with the High Throughput Gene Targeting Group at the Sanger Institute.

Design Type Oligo Select Method Artificial Intron Design
5' retrieval block size U block size Min 5' spacer Critical Exon Min 3' spacer D block size 3' retrieval block size
 
       
Subtype Domain Disrupted
Gene Build Gene
Start Exon End Exon
Target Start Target End
Primer Length Design Comment
Created by dk3
Valid After Annotation
not done
oligos on fwd strand oligos as ordered View gene and design in Ensembl UCSC BLAT recombineering primers
Design ID: 93323
Chr: 7
Strand: -1
Status: Ordered
BACs: RP24-443M24 : RP24-173G14 : RP24-467G12 : RP24-335I1 : RP24-417F20 :
Instance: Plate 94: Well D05: BACs RP24-173G14 RP24-467G12 RP24-335I1 RP24-443M24
Oligos on GRCm38:
Type Start End Length Seq
G5 19153554 19153603 50 TTTTGTTCTTTTGTGGTCCTGAGAATTGGACCTAGGGTCTCATATGCTTA
U5 19147593 19147642 50 ATCACATGTAGGCCAGCTTTCAAGGAACTCACATCCACCCTTTCCCTCTT
U3 19147451 19147500 50 TGATAGGATTATAGACCCAGACCACCACTACACCCAGGTGTGGGGAGTGA
D5 19144510 19144559 50 AAAAAAAGAATTCTCAGAATCACTACACTTGACCTTCATAGGGTCAGCTT
D3 19144366 19144415 50 AGTTTAAGTCCAGCCGGGTCTATAGAGCGAGTTCCAGCAACCACATGGTG
G3 19140444 19140493 50 AAGAAACTTGACTAGAGTTGCACACACAACAAAAGGAAAGGGTAGGTTCG
Oligos:
Type Start End Length Seq
D5_D3 19729765 19729858 94 GCTCACAACCATCTGTAATAAGGTCAGATGCCCTCTTCTGGTGTGCCTGAAGACAGCTACATTGTATTTACATATAATAAATAAATAATTTTAA
G5 19738903 19738952 50 TTTTGTTCTTTTGTGGTCCTGAGAATTGGACCTAGGGTCTCATATGCTTA
U5 19732942 19732991 50 ATCACATGTAGGCCAGCTTTCAAGGAACTCACATCCACCCTTTCCCTCTT
U3 19732800 19732849 50 TGATAGGATTATAGACCCAGACCACCACTACACCCAGGTGTGGGGAGTGA
D5 19729859 19729908 50 AAAAAAAGAATTCTCAGAATCACTACACTTGACCTTCATAGGGTCAGCTT
D3 19729715 19729764 50 AGTTTAAGTCCAGCCGGGTCTATAGAGCGAGTTCCAGCAACCACATGGTG
G3 19725793 19725842 50 AAGAAACTTGACTAGAGTTGCACACACAACAAAAGGAAAGGGTAGGTTCG
G5_U5 19732942 19738952 6011 ATCACATGTAGGCCAGCTTTCAAGGAACTCACATCCACCCTTTCCCTCTTCCTGTCTCTCTCCATGGTGCTGAGGGTCGGTCCCGGGTTTCCTGAATGATGCTTTTACAGCCACAGCCACAGCCCCCACTGGTGAATACTCGGCAAACTTTCTACCATTGAGCCACACCCCCATCCTCACATTGCATGATTCTAAGCATGTGGGGACATGCTCTAAGTTCCTCTTAAAACGTTCTCACTATCTGCCAAGCCTGTTTTAGGATCCCTATGAAATCAACGATATCAGTGACTGTCCCCATTTTGAAGATGAGGAAGCTGAGTCCCAAAGAGGTTAAGAAGTTAGTCCAACTAAAGTGGATCCTAAACACAGTATCTGAATGGCACCACACCACTAATTCTGAAGCCAACCTTCTTGGATTTTAATTCTAATTAGCTGTGGGACTTGGACAAAATGTAAAAACTTCAGTTTCCTCATCTGTATAGTGGAGATTATATTAGTTCAGACCTCACCAGAGAGTACACTGCTTCTGCCTAATATAGGATAATATTTAGTGGGGGTCGTATAGTGCGGGATTTGTGTACCACCAAGAGAATCTAGTCAGGTTCACCTGCCGCTGCAGCCACCACCACCACCACTCCCCTACCCGCCTACTCCCCATCTCTGTCCCCCGACCCCCATCAGATCACTTCTGCCTCCTGGCTGTTTTGGGATCTTCGGAGCCTGAGTTCCATTTCCTGACAAACTGGGGAAAGGAAGTTGGGGGTTGACAATAAAACCCTTTACCTTTCTCACTTGGAGATTGCCAGAACTACCCGGGGGTCGCACAATCAATAAGGGACGCAGGAAAGTTCCCCAGAGACGCTGCGGATCCAGCTGCCCTACCACCAGCCGCAGCTTGGCTTCTGAAAGGCTTCCGATCAGCGGGACCTTGGTTGGGAAATGGGATGGGAAAAAGAAAAATGAAAACAACCCCATTCCCACCTTATCCTGGGCGCCGTTGCCTACTAGGAGTCCTGGCTCTTCCTGGTAATGCAAATCTCCAGCATCAAAGATTTCCTAGACTGGGAGAAATCTTCAAAGCAAATCTGGTCCAGCCTACCGCAGTCCTAACGAGGAAATTGCAATCGGGTGATGGAAATTTCTAAATAGATGGCTTGGGCATAGAACTCAGTTCTACCAGTGTTGCTATGAGGACTCGTCATCTTCAGTGGGGTCTATCACAAAACAAGCCTGAAGCCTTATTTTGTTGGGTAGGGGCACGCGCTCAAGTCATGGATAAATGGCACAGGCGGCAAAAGCCAAATGATAAGACCACGGTAACCTGAGACTCAATACGAAGGGAAAGAGGGAAATGACGCTGGCTGGGCACCAGCCAGGGCTCACCCGCAGATCCCGGCTCCGTGACATCTCCTCAACCCCAGGGTGCCAGCTGTTCCAGACGATATAGAAAGCCAAGCCCATAGCCAGCGCCAGCAGCAGCAGGGGCAGGAACTGCACTCGCGGCAGAAGACGGCGCTTGGAAAGTGAGGGTGGTTTCATGAGGCCACGATCCTCGAGCCGCTGCCGGGGCCGCCCGCGGCTCCCGGGACTCATGGTAGCTTTGCTCTGAAACCAATCCCGGTATGGTGGTTTGAGTTTTAGGCCAAGATCCGCCTCGCTGAGGTTACAAAACCCAATAAAGAAGCAGAGTAACTGCGTCCTTCCCTGAGACGATTGCGATTGGCTGTCCTAAGCGCCGCCCCACCCAAAAAGGAGGGCGGAAACCTTAAGGCCCGCCTCCACGGAAGAGGACCAGTCAATGGGCTGCGTCCGAATGTGCGAAACCTTCCAAGGCGCGGGGTCACGCCCCTCACGGAAGTCGATCAAGAAACTGTCGTTCAAGGAAAAAAGGGGCGGCATCCATCCCTAAAACAAGGAGCCGATTGGTTTACCTGAAGCCATGCCCTCAAGAAAAGTGTCCGAGGGTATTTGGAAATGGGGTTGTGTTTTCCATCTTCCAACTGGACGGTTTGACGGGAAAATAATTCTAGTCAGACCCCGTATTATTTTCCTCATGAGCAGACACCCTATTGTGATCCTCAGAAGCTTCAAATCCTCCTTATAGGCATTTTCTACAGGAGAGTGCAGCCTGAAGGGTCGCTATGGTAACAGGCCACGCCCACAGCCGCTGGTATTTGGTTGCGCAGGCGCCGACGGAAGTGAGCCGCAGGAGACGGAAGTCCCGCCCTTCTCGCCCTGTACGCCAAAGGCTGGAGCAACGCGCTTGGAGGCGGGAGTGATCTGCGAGCGAAACCTACACCATGTGAGGCCGGGCTGGGCTTTGGCGGGGCCGTGGAGATGGAGGTGGACAGTTTAGCTGAATAACGGTCGAAATGGGGTGTTTTTATAGCTGAGGGTAGAGTTCCTCGGGCAAAAGTAATGTTTTTCCTTCTGGGGTATTTGAGATCGGGCTTGGGGCCTCGCTCGGATCTTGAGTTCCGGAGAGGGGACAGCTTTATTCCATAACGGGCATGAGACTCTCCGAGGTCCTGAGTCTTGTGGAAAGGAACCATAAAGGGAAAGCTGAGTCTGATGGCACATGCCTGGAATCCCAGGCCTCGAGAGGCTGATGCAGGAGGTTCGCTAGTTGGCCTTGGCCAGCTTCATAGCGAGACCGCTTCCAAAAGTAATAGTAATTTTAAATGGAAGTGGTCTTATGAATAAAGAGCTTGGCGGGGAAGGAAGAACTGTTAGAAATAGTGAAAAGTATGGGACGTAACCAGGATAAATTAGAGAACCTAACTAGAGACTGTCAGAGTAGCAGGGTACTACAGTGGTTTGGTGCGTGTTTATTCATTGAGCATATACTATGTAGACTGCTTGTAAGTTAAGACACATGGTAAATAAAAGGTCCTTGCCTCCAAGGGGGTGGGGGAATCTCCCTGGTGCTTGTAAAAAGAGTGGAGTAGGAAAGCCATAGAGTAATAAATAGGTACATACACCTTAGATAATCAGGTTTGGATGGAGAATTGAGCAGGAAAGATATAATGCCAGTAGGTAGCACAGTAGGATGCATTGAAAGCCCAGTTCTTGGGATGCAGATTTAGCTCAGTGGACAGAGTACTTACCTACTGTGGGTACTGGGTTTGGTCCTTAACCACACACAAACTAGACATAGTGGCACGTGCCTGTACTCCCAATACTCAGGAGGCAGAGACAAGTCTGAGTTCTGGGGCAGCCAGGCTTCTACAGTGAGATGTTGTGGGGTGGGGCGGAGGTTCATGGAGAGAGATGATTGAAGTTTAGGTTGCGGATAGAAAGGGCCAAGGTTTGGATGTACCATGGTGGCAGATGACAAGATATAAGGATAGAGTAAGGTTTGAAAGAAGAATCAACTGCCAGGCATGATGGTGAGCCTCTGTCATCTCAGACCTTAGGCAGTGGAGTCAGGAGAATTGAGAATTCAAGGTCAGCGGTGGGTGGAAGAGGTTAGGTAGATGAGCCGGGGCAGGCTACCATGGAAATGTCTCTCCTGCCTCCAGAAAAGACTGCACCAGAAAGGGGGCTGGGGAGACACTGGACAGTGTGGCTTTGATCACGTACATTTCCAACTTGAACCCATCTCACCCCTGGGTTCTCTATCCAGGAGTCTCCTCAATAAACCCAAGAGTGAGATGACCCCAGAGGAGCTGCAGAAGCGGGAGGAGGAGGAATTCAACACAGGTCCCCTCTCAGTGCTCACGCAGTCGGTCAAGAACAACACGCAAGTGCTCATTAACTGTCGCAACAACAAGAAGCTGCTGGGCCGGGTGAAGGCCTTTGACAGGTGAGTGCTGTCTTGGGGAGGGCTGGGTCTGGGTCCGAGGGGCCTGAAGGAAAGGTCATTCCAGAAGGATAATAAGGTGGGCACACACGGTGACAAAGCACCTTTAATCTCAGCACTCGGGGAATCACTATGAGTTGGAGGCCAGCCAGTGTCTCATGGCACGACCTAGCTCAAAAATGTAGAAAGTGGCGATGCTTAACCTTTTTATAATACATATCTTACGTGTTTAGGTGTTTTGTCTGCATATGAGTCTGTATGCTATGGACATGTCTAGTAGTTATCAGAATCCCCTGGCAGGAAATTGGACTGGAATTTCGATATTTGATTTGTTTATCTGTAGACCAGACATCAGTGTCAAATATCTTGTATTGCTTTGTAGTTTGTTTTGAGACAGGGTCTTTACTATGTAGCTCGAACTGGCTACAGATGTGGCAGAGGCTAACCTTACACTTCTAATCCTCCTGCTCCCATCTCCCGAGCGCTGGGATTACAGGATTGCATGAAGCATGCCGTCCTGCTTTATTGTTTTAGTTAGCATGGGACTTGCCTTGTGACTTAGCCATACACATCTGGCACTGTACTTTGCTCTTATTCACTGTCCTCAAGCAAGCATTTGTGGAAAGAACTGATCCAAGTGTGAACAATGGCCACCCGGCCCCATGAGGACAGGACTGTGCAGCACTGGAGTGCGCGTGTTGGGAGCCGTGTCTAACCCCAGCACCCTAAGACCCTCTGGAGGGAGCAAGTGCTTCTCTCCTGCTGTTTCTCTCAGAGTTAGAGTTAACGCCAGAGCCAGGGCCATTTTGGTGGGCTTTACTCTGCTGGGTCCTGAGTTCTTTATTCATCCAATCTTCACACCAGCCCTATGAAATAGACTGTCTCCATTTCATGAAGGGGGAAACTGAGGCACAGAAGGGACACTATAAAGTGAAATCACTTTGCAGCCTGCCCATCCCCACTGTGGAGCCTGGGCTTTCCTTATGCCTGCTGCTGGAGAGTTCACACAGTGCCAGGCAAAGGTGGGCACTCGGAATGCCCCCCCTTACTCCAGCTTCCCCCCCCACCCCTACCCCATCAGGCACTGCAACATGGTGCTGGAAAATGTGAAGGAGATGTGGACTGAGGTTCCCAAGAGCGGCAAGGGCAAGAAGAAATCCAAGCCTGTCAACAAGGACCGCTACATCTCCAAGATGTTCCTGCGCGGGGACTCGGTCATCGTGGTGCTGCGGAACCCACTCATCGCTGGCAAGTAGAGCCTGCTCCCTGCCCTGCGAAGGCCTGCAGAACCCTGCCCAGTGGGCGAGAAATAAAACCCTGTGCTTTTTGGTTTTTATGTTTTCCAGTGGTCTTCTCTGCTCTTGGGTCTTAAAAGAGTGTGTTGGGCTGAGCACTAGGACAGGGCCTGTGGGTGCTGCGGTATATAACAGCCCTGTCTGCAAAGGAGACAGTTTAATTGGACTTTTGTGTATTGTGGACAGAGGGATTCTCTGACAATGTGCAAGTGGGAAAGGGAAGCCTATTTAAGAGGCTCGTGGAGGACCCAGGGCCTTCTGCTCTACCCACAACTCTGTCTATCTGGTATCTCTGTCTGTGTCCTCCCAGGCGATCATGGGCTGGAGGTCAGGAGTCTCTGCCCTCTTTACATGTATATAAAACATGTATGGGTGTTTTGCCTGGATGTGTCTGTTCTTGGTACCCATAGGAGCCAGAAAAGGAGAGTTGGATGCCCCTAGAGGTAGTTACATGTGGTGGTGAGGCAGCCATGTGGGTGCTGGGAAAAAAACCTGGGTCTTCTACAAGAGCAACAAGTGCTCTTAACTGTTAAGCCATCTCTCTGGCCCTTTAGCTGTCCTCTTTCTTTTTTCTTTTCAAGACAGAATTTCTCTCTATAGTCCTGGCAGTCTTGGAACTCACTTTGTAGACCAGGCTGTCCTCAAACTCAGATTCCCCCTGCTTCTGCCTCATGAGTCCTGGGATTAAAGGTATGAGCTACCACCATTCAGCCTAGCTGTCCTCCTGAACTGTGGAAGTCACAGCTAACGTTATCCTGTGCGTCCCTGTACAGAACTTCGAAGCCTGCAGCCAAGAAAACTTGCATGTGTTCCCTGAGCTGCTGCCAGAAAGAACAGCTTTGTTGTGTACTTTAGAGCTCTCTCTTTTGTTCTTTTGTGGTCCTGAGAATTGGACCTAGGGTCTCATATGCTTA
U3_D5 19729859 19732849 2991 AAAAAAAGAATTCTCAGAATCACTACACTTGACCTTCATAGGGTCAGCTTGTTTCTGTCCTAGTTTCTTAGCCCAGGGATGGGAGGGAAGGCTAGAGGATACACAGGGGTCAGGTGCCTGTCCACCCCAGCCTTGGCCTGCCCTCCTTACCAATGCTCCTCAGTCGCTGGAACCAGCGGGCTGTGCGAGGGAAGTGACTGAAGAAGATCGGACTGGATGCTCCCAGAAGGTCGAGGAGGACAAAGAGCTCCTGGGGGAAGGAGTCCAGTGCTACTGACCCACCCCACCTTCCCCCGCCCCCGCCTCCTGCTACTGACCCACCCCACCTTCCCCCGCCCCCCTCCTGCTCCAGAGCCCAGAGGAATGAATCTTACAATAGCCTGGATCCTGGTGGGGCCAGGGCTGTGTGGTATAGACTCCATGATCTGAGCTAGGTGCCGGGAGCCATAGAGGGAGTCCTTTGGTCCCCACTCCTTCAGTGCCTCCTCCCCATCCAAGAAAAGCAGCTGCAGGGTCACCGGTGCTGCCTATAGGAGCAAGCTACCAAATCAGCACCAACCCTTGGCATCGGCCCACCCGTGGCCTTGCCTATTTATTTGCACATCTGGGGTGGGACAAACCAAGTGTCCTCATTCATGCAGTGTGGTGACAGAAGTCACAGGTTGAGCCAGAGGCCTGGGTTCAAGTCCACGCTGTAGGTGGTTGTTAGACAAAGTAGCTACCTTTTTGTTGTTGTTGTTTTGTCTTGAGATAAAGTTAGAACAGCCCAAGCTGGACTGCACCTTTCCAGCCCTCCTGGGATCACAGGTGTGCAGCATAATGCCCATTTTATTTTGTTTTGTCTTGTTTCTATTTTTGTGCTGCTGGAGAATGCTCTAGGGATGCCCATATGCTAGACATGCAGGGTTTCATCCAATTGCCCAAGCTACCCTTGAGCTCACTCTGTAGCCCAGGCTGGCCTTGAACTTCTCTGCTCCTCAGGCCTCCATGTCTGGAGGAGCTGGGATTACAGGCCTTAGCCACCAGGGTTGGCTCAATTTCTTCATCTATGAATGGGGTTAGCAACAGCTCTGTTCACAGGATCACATTTGAATCCAGGTCTGTAAGAACTGAAAACGAGTCAGCTCCAGTTATTATTACTTAAGTCTAGCTGGGACAGACAGACTGACAGACAGACCCACTGCACAAACAGCAAAACACAATTAGGGCAAATGCTCCCCAGATCACCAGCTTCTGAGGGTCCAGGAGGCTGCAGGTTGATCTGGCCAGCAGAGGCCACTGGGTCACTGGACAGGAGCGTTTGCACTGAGAGTGAGTTGATGGGACTTGACCTAGCAAAGAGCAAACAGTATTCCCAGGCAAGGGGACGGCCTGGACCAGAGCCGGGGCCAGGGGGCTGTGCGAGGAAGGAGAGGCGTTAGGAATATCAAGTTTTCAGGCTTGGTTTGTAACAGAAGCACTGGGGAACCAGAGGAAGGGTCTGAGGAGGACAGAGACTTGATGAAATGTGTGTTTTCATTCCACAGATTTCTACTAATGTCGGACTTTATTCTCTCTCACTCAGGGAGACATAACAGGAAGGAGAAGCCAGGTCTGTATCATGGAACATACTGAGCTTAGAGAAAAGTCATTGGCACCATAAGGAATGGGCAGTGACCGGAAAGTTACTTGGGGTGGGGGGCGGGGGGGGAAGGAGAGCCTGCCAGGAGGGGGGTTGAGGGGGGGGCGGATGACCCATAGTGAGAAGTGAGCTTTACAAGGCAAATAGTAAATGCTAATGAGGTGGAAATGAAGCCTCTGGATTGGAGGGACACTGAAAGGGGTGTGGCTAGAGTAGAGTGCACCTCAGGTCTAGCCTCAGGACTCTGGCTTAGGGTTAGGATGGGACGGGGGTCCATGGGAGAAGTCTCCAGACACAGGAAGGCAGGATGTGCCATTTAGGATGTAGATCCCTGTGGAAGACTGCGGATGTAGCGCAGCTGACAAAACCTTACTGGACATGCGTGACGCCCTGGGCTCGGTGTCCAGAACAGCATAAATAAGGCGCGGTGGTACATGTACGACTGTGATGATAGCACTTGGGAGATGGAAGCAAGAGGGTCACTAGTTCAAATGCATTCTTGAGTTTGATGTTAGTACGGCCCACCTGAGACACAGCTGGGACTTGAAGAAAGCAAGGATGACAGTAGGTCTGGTGGCCCAGACCTGCCGTGTCACGGCTTGGAAGGGTGGTGCAGAATGACTGAGTTCAAGGCTAGCTTGGGCTACATACTAGTGAAACCCTCTATCAAAAAGGGAAAGCATAGCAGACAGAAACGAGGATGTGGGCCAGAGATAGACTACCCGCCCCTTCTCCTCACCTGCTGCTTGATTCTGCTCAGCATGGCATCAAGGGCCTGGACCAACTCCAGAAGCAGGGCACAGGGCACAGCTGAATCTGTGGCCCCCACAAAGGGGGGCAACCCCGGAGGGAAGAACTTAGAGTCATAATGGCAGGCGAGGGTGAGGTGACGGGCAGCTCCTGGGTCAAGTGTGGCCACCACGTTCCCGAAGTCCAGTGGCCCCAAGGGGGTTGAGGCCGTGAATGGGTCCAGTTCAACATGCCAGCCTGCCGACAGGGACTGCAACGTAGCCTCCAGGAACTAGTGGCAAGAGAGAGGTAGGAGGGTGGACAGGGACTGGGGAGGAGGTGGGGAGAAGGGCCTTGTGACTGGAGCCACGCAGAGCAGTCGGGGTGACTAGAAAGTCCCACTCTGGTTTATGTTGTTCCCTCGACACTGACTTCTGCTGGGAGCCAGATGTAGAACCACCATACTTCTCGGTAGCAACAAAACTTGCCATGGCTTATTTTGAGACAGAATCTCACTGTGTAGTCCAGGCTAGCCTCCAGCTTGCTGTGTAGCCTAGGCTGGAACTCCAGATAATGCTTCTGCTTCCAGAATGATAGGATTATAGACCCAGACCACCACTACACCCAGGTGTGGGGAGTGA
D3_G3 19725793 19729764 3972 AAGAAACTTGACTAGAGTTGCACACACAACAAAAGGAAAGGGTAGGTTCGGGTTAACTCCATCCAGGTGGACCTCTGTCTATTCAGTCCATTCCCACTCTCAACCTGCCAAAGGCAGTATTTCCCAAAGAATCCTGGAGGCAGCTTCACTTGAAATACCTTCCTGCAAAGAGGTCCCACTGTGGAGTACTTTGAGAACCATTTCATCCTCTTACTCTGGAAGATCTCACCTTTGCAGTGAGGAAGTTCATTTAGTGACACTTTTCATGAGCGCTGTGGCCTTCCGTTCCCCTTTACCCTCGAGGTTGGCACCCCTGAGCCAAGCAGACCGTAGACCATCGAACTAGGCTTCGTCTCTGTCCTAAGTTATGAGCCCATGCCCATGTGGAGTACGGTAGCAAATGAACTGACATCAAACATTAGCCGCAATGGATTCATTTGGTTGGTGGTGCTGGTCCACGTGCCAGCCCGTGACACATCATTTGGTCCCTGGAACCTTCCAGTTATTTACTTCAGGACAGAAGCCAAAGGATTCCTTATTTCCTTTGGCTCTTTCGTGCCTCAGTGTTCCTTGCATCCTTGAAACACGGTGACTTCACATGGTTGTAGCATACATCTGAGGTGAGACTGGCCACCCTGCACTGGCTCAAGGTGCCCCTGTCCAGTCCACAGCTAAGTGTATAAGATTCCTTCAAGGTATCAGGCTGCAGGCTAGAGTCCCAGGTACTCGGCCAGGAACACAGCAAGGATGCGGCTCAGGTTATGCACAGTGGGTGGGTGGAGGTTGGCCTCGGTGTCAGCAGGTGTGTGCCACACAGCAGGGAAGGGCGTGGCAATGAGGTGGAGCACCGGGACCCCTGAGGGGACAGAATATTTCATCCATCAGATGCAACCCGAAGACAGTCAAGAAACGAGTGCTTTCTAACCTCTCAACCCAAGACCTTGGGTATGCTAAGCAAACATGCTACCTCTGAGTTACATCCCCAAACCCTGAGGAAAGATTTTAAATATAAGAAGGTACATGCTGTTTAAGAAAAGTTAGTGATGGGCCTGGTGAGATGGCTCAGCAAGTAAGAGCTCTGACTGCTCTTCCGAAGGTCCTGAGTTCAAATCCCAGCAACTACATGGTGGCTCACAACCACCCGTAATGAGATCTGACTCCCTCTTCTGGTGTGTCTGAAGTCAGCTACAATACAGTGTACTTATGTATAATAATAAATAAATCTTTGGGTCAGAGCGAGCAGAGGTCCTAAAAAGTCCATTCCCAACAACTACATGAAGGCTTACAACCATCTGTACAGCTACAGTGTACTTGCATACAATAAATAAATTAAATAAATAAATAAATAAATAAATAAAAAGAAAAGTTAGTGATGCAGCAGGCTACCACCGAGCCTGTTGACCAGAGTTCAATCTGGCACACTGTAAAAGAAAACAACTGGTTCCCAAGAGCTGACCTCTAACCTCTGACCTCCACTGGCACATCCATGCACCTGCATGCTCACAATAATGTTTTAATTGCTGGATGGTGGTGGTGCATGCCTTCCTTTAATCCCAGTAGTTGGGAGGCAGAACATGTAGGTCGGGGTGAGTTTAAAGAGGCTAGCCTGGTCTACATAAGTGAGTTCCAGAACAGCCCATACTACATAATAAAGCCCAGTCTTAAAAATAAATAAATAAATAAATAAGGACTGTTGTTTACATAACAAATCCAAGAACCTCGAAACTGAAGGACCTGTAGAGGCAGAGAAGGAGGCCCTTGTTCCTCACTGGACATATCTGATGCTATGGGGCTGCAGTGACCATGACCATCTCACCTACTTGGCTCCACCTCCCCAATGCTGGGACTACAGATCTACACCACCAAAACCAGGCTACTGACTGCTGAGGATGCAGCCCAGGATTCATGCACAAGAAGCAAGAGCTTTACCAAAGGAGCCACATCTCCTAGGTTCATCTAAGGTAGGCATCTACTGCCATTACCCTTATTTAATTAATCATGCTTAACTATTTGGTTAGAAACAGGGCCTCACTATAGTAAGATGTCCAGGCTGGTCTCATTTTCTTTGCAGGTTTTAGGATGGCTTTCTGTTGTTGGCCAGGGGGATGGGGTTTAACAGATGTGGGGATGGGGATGGGATGGTGTTGGTTGGGTGGTGCTAAGATAATTTAGGCAGAGGCTCTACCACTGAGCCTCGCCCTGACCCCTCACTAGGGGATTCTAGGCAGAGGCCCTACCATTGAACTATACTCTCAAATTTTATAGGCTTATATAATTCTCCTGCTAAGACTAGTCCTGTCCAGTACTACTGTCTTCTACTCCCATGTTACAGCTATGGAAATTGAAGCAGAGAAACAGACACACTGATTTGCCTGAGTCCTAGCCCTAGTAAACAATACAGTAAGATTTGAACCCAAAGTCCTCCCTTCCTTGTGTGTTCACAGAGGCAGCTGGCCTGGGAACCGTTAGAGTAGCTCTGACACCTCATTCCTCACCCACCTGGAGAGGCACTCACTGAAGGAAGCAGTGAGGAAAAGGATGCTCTCCTGGCATGCAAGAGGCGGCACTGTGCGCTTTCTGTATACTGGGCTCAGCTCCAAGTCAAATCTTGACCCATATTTGCATATTTAATGCCCTCCATGCTCCCCATTTTACAGATGAAGAGATCAGGACTGAGCCACTTGCCAGCAGTCCCTAGCCTTGGGAAGGAGGCTTCCTTGTACCCCTCACCCCAGCAAGTACCTCTGCGAAGGAAGGGGATGTGGTCATCTTCCACAGGGCCGGGGGGCTCCCCGGGTTGGAAGTACATCACTTCCTGGGGGTGAGACTGCAGTAGGTTCAGCCGGTGAAGGCGCTTCTCTGGAGAGGAGTGGGATTAGAGAGCAAGATTATAGTCAGCAGTCAGATATGCCACCCCAATACCAGTGCATGTATATGTGCTCCATGTGCATACAGTGCCGCGGGGCCAAAGGAGAGTGCATCAGGTCCTCCAGAACTGGAGTTATACATGGGTGCTGGGACTCGAACCCAGATCCTCTGAAAGGGCAGCCAATGCTCTTCCCCACTGAGACAGCTCTCCAGCTCCATGTGTTTCTTTTTTTTTTTTTTTTTTTTTTTGCATGTTGCCTACTCCTGGTCCCATGTACTCCTTCTCTGTGTAGGAGGAGGTGGATGCCTCCATTTCTTTTTCCTACTCGTCCTTGTGTGGTTGGGGGAGTGGACTCAGTTTTCTCCCTCCAACTTTACAAGGGTTCTGGGAATTGACAGGCTGCCAGGCTTTTGAGGCAAGCACCTTTACTCACTAAGCCATGCCGCTGACCCCCATGTCCCTCTTCTAGTCTATCTATTTATTTAGACATTTTCAGCGACAGGATCTTCAGGTGCTGCAGCCAGCCTCATACTCTATATGTGGCTGAGGATGACCACGAGCCCTCCTTAATCCTCCTGCCCTACAACTACCTCCCAAGTGCTGTGTTACAGGAGTGCACCACCAATATCAGTTATTATTTGAGATAAGACCTTGCTTCATAGCCCAGACTTGCCTAGAATTCACACTCCTCTTGCCTCAGCCTCGAAAGTTCTGGGATATAGGTGAACACTACCAGGCAGCTTATCCTAGACTGAAACTCATTATGTAGCCCAGAATAGCCTTGAACCTGCAATCTCTGTGCCTCAGCTTCCTGAGTGTTGGTATTACAGGCATGCACACCATGATGACTAGTTCACAGCAATGGCCCCTTAGCATCGTCACCATGCTTGTTTTCCATAAAAGAAATAGAGGTTTGAGAGACCAGTGTCTTGTCCAGGCAGACCCAGGGTTTGAAATCAGGTCAGTCTCACATAAGAATTCTACTGTTGCCCAGCTGTGGCAGCGCACACCTTTAATCCTAGCACTTAGAAAGCAGAGGCAGGTGGATCTCTGAGTTTAAGTCCAGCCGGGTCTATAGAGCGAGTTCCAGCAACCACATGGTG
U5_15 19732942 19747992 15051 ATCACATGTAGGCCAGCTTTCAAGGAACTCACATCCACCCTTTCCCTCTTCCTGTCTCTCTCCATGGTGCTGAGGGTCGGTCCCGGGTTTCCTGAATGATGCTTTTACAGCCACAGCCACAGCCCCCACTGGTGAATACTCGGCAAACTTTCTACCATTGAGCCACACCCCCATCCTCACATTGCATGATTCTAAGCATGTGGGGACATGCTCTAAGTTCCTCTTAAAACGTTCTCACTATCTGCCAAGCCTGTTTTAGGATCCCTATGAAATCAACGATATCAGTGACTGTCCCCATTTTGAAGATGAGGAAGCTGAGTCCCAAAGAGGTTAAGAAGTTAGTCCAACTAAAGTGGATCCTAAACACAGTATCTGAATGGCACCACACCACTAATTCTGAAGCCAACCTTCTTGGATTTTAATTCTAATTAGCTGTGGGACTTGGACAAAATGTAAAAACTTCAGTTTCCTCATCTGTATAGTGGAGATTATATTAGTTCAGACCTCACCAGAGAGTACACTGCTTCTGCCTAATATAGGATAATATTTAGTGGGGGTCGTATAGTGCGGGATTTGTGTACCACCAAGAGAATCTAGTCAGGTTCACCTGCCGCTGCAGCCACCACCACCACCACTCCCCTACCCGCCTACTCCCCATCTCTGTCCCCCGACCCCCATCAGATCACTTCTGCCTCCTGGCTGTTTTGGGATCTTCGGAGCCTGAGTTCCATTTCCTGACAAACTGGGGAAAGGAAGTTGGGGGTTGACAATAAAACCCTTTACCTTTCTCACTTGGAGATTGCCAGAACTACCCGGGGGTCGCACAATCAATAAGGGACGCAGGAAAGTTCCCCAGAGACGCTGCGGATCCAGCTGCCCTACCACCAGCCGCAGCTTGGCTTCTGAAAGGCTTCCGATCAGCGGGACCTTGGTTGGGAAATGGGATGGGAAAAAGAAAAATGAAAACAACCCCATTCCCACCTTATCCTGGGCGCCGTTGCCTACTAGGAGTCCTGGCTCTTCCTGGTAATGCAAATCTCCAGCATCAAAGATTTCCTAGACTGGGAGAAATCTTCAAAGCAAATCTGGTCCAGCCTACCGCAGTCCTAACGAGGAAATTGCAATCGGGTGATGGAAATTTCTAAATAGATGGCTTGGGCATAGAACTCAGTTCTACCAGTGTTGCTATGAGGACTCGTCATCTTCAGTGGGGTCTATCACAAAACAAGCCTGAAGCCTTATTTTGTTGGGTAGGGGCACGCGCTCAAGTCATGGATAAATGGCACAGGCGGCAAAAGCCAAATGATAAGACCACGGTAACCTGAGACTCAATACGAAGGGAAAGAGGGAAATGACGCTGGCTGGGCACCAGCCAGGGCTCACCCGCAGATCCCGGCTCCGTGACATCTCCTCAACCCCAGGGTGCCAGCTGTTCCAGACGATATAGAAAGCCAAGCCCATAGCCAGCGCCAGCAGCAGCAGGGGCAGGAACTGCACTCGCGGCAGAAGACGGCGCTTGGAAAGTGAGGGTGGTTTCATGAGGCCACGATCCTCGAGCCGCTGCCGGGGCCGCCCGCGGCTCCCGGGACTCATGGTAGCTTTGCTCTGAAACCAATCCCGGTATGGTGGTTTGAGTTTTAGGCCAAGATCCGCCTCGCTGAGGTTACAAAACCCAATAAAGAAGCAGAGTAACTGCGTCCTTCCCTGAGACGATTGCGATTGGCTGTCCTAAGCGCCGCCCCACCCAAAAAGGAGGGCGGAAACCTTAAGGCCCGCCTCCACGGAAGAGGACCAGTCAATGGGCTGCGTCCGAATGTGCGAAACCTTCCAAGGCGCGGGGTCACGCCCCTCACGGAAGTCGATCAAGAAACTGTCGTTCAAGGAAAAAAGGGGCGGCATCCATCCCTAAAACAAGGAGCCGATTGGTTTACCTGAAGCCATGCCCTCAAGAAAAGTGTCCGAGGGTATTTGGAAATGGGGTTGTGTTTTCCATCTTCCAACTGGACGGTTTGACGGGAAAATAATTCTAGTCAGACCCCGTATTATTTTCCTCATGAGCAGACACCCTATTGTGATCCTCAGAAGCTTCAAATCCTCCTTATAGGCATTTTCTACAGGAGAGTGCAGCCTGAAGGGTCGCTATGGTAACAGGCCACGCCCACAGCCGCTGGTATTTGGTTGCGCAGGCGCCGACGGAAGTGAGCCGCAGGAGACGGAAGTCCCGCCCTTCTCGCCCTGTACGCCAAAGGCTGGAGCAACGCGCTTGGAGGCGGGAGTGATCTGCGAGCGAAACCTACACCATGTGAGGCCGGGCTGGGCTTTGGCGGGGCCGTGGAGATGGAGGTGGACAGTTTAGCTGAATAACGGTCGAAATGGGGTGTTTTTATAGCTGAGGGTAGAGTTCCTCGGGCAAAAGTAATGTTTTTCCTTCTGGGGTATTTGAGATCGGGCTTGGGGCCTCGCTCGGATCTTGAGTTCCGGAGAGGGGACAGCTTTATTCCATAACGGGCATGAGACTCTCCGAGGTCCTGAGTCTTGTGGAAAGGAACCATAAAGGGAAAGCTGAGTCTGATGGCACATGCCTGGAATCCCAGGCCTCGAGAGGCTGATGCAGGAGGTTCGCTAGTTGGCCTTGGCCAGCTTCATAGCGAGACCGCTTCCAAAAGTAATAGTAATTTTAAATGGAAGTGGTCTTATGAATAAAGAGCTTGGCGGGGAAGGAAGAACTGTTAGAAATAGTGAAAAGTATGGGACGTAACCAGGATAAATTAGAGAACCTAACTAGAGACTGTCAGAGTAGCAGGGTACTACAGTGGTTTGGTGCGTGTTTATTCATTGAGCATATACTATGTAGACTGCTTGTAAGTTAAGACACATGGTAAATAAAAGGTCCTTGCCTCCAAGGGGGTGGGGGAATCTCCCTGGTGCTTGTAAAAAGAGTGGAGTAGGAAAGCCATAGAGTAATAAATAGGTACATACACCTTAGATAATCAGGTTTGGATGGAGAATTGAGCAGGAAAGATATAATGCCAGTAGGTAGCACAGTAGGATGCATTGAAAGCCCAGTTCTTGGGATGCAGATTTAGCTCAGTGGACAGAGTACTTACCTACTGTGGGTACTGGGTTTGGTCCTTAACCACACACAAACTAGACATAGTGGCACGTGCCTGTACTCCCAATACTCAGGAGGCAGAGACAAGTCTGAGTTCTGGGGCAGCCAGGCTTCTACAGTGAGATGTTGTGGGGTGGGGCGGAGGTTCATGGAGAGAGATGATTGAAGTTTAGGTTGCGGATAGAAAGGGCCAAGGTTTGGATGTACCATGGTGGCAGATGACAAGATATAAGGATAGAGTAAGGTTTGAAAGAAGAATCAACTGCCAGGCATGATGGTGAGCCTCTGTCATCTCAGACCTTAGGCAGTGGAGTCAGGAGAATTGAGAATTCAAGGTCAGCGGTGGGTGGAAGAGGTTAGGTAGATGAGCCGGGGCAGGCTACCATGGAAATGTCTCTCCTGCCTCCAGAAAAGACTGCACCAGAAAGGGGGCTGGGGAGACACTGGACAGTGTGGCTTTGATCACGTACATTTCCAACTTGAACCCATCTCACCCCTGGGTTCTCTATCCAGGAGTCTCCTCAATAAACCCAAGAGTGAGATGACCCCAGAGGAGCTGCAGAAGCGGGAGGAGGAGGAATTCAACACAGGTCCCCTCTCAGTGCTCACGCAGTCGGTCAAGAACAACACGCAAGTGCTCATTAACTGTCGCAACAACAAGAAGCTGCTGGGCCGGGTGAAGGCCTTTGACAGGTGAGTGCTGTCTTGGGGAGGGCTGGGTCTGGGTCCGAGGGGCCTGAAGGAAAGGTCATTCCAGAAGGATAATAAGGTGGGCACACACGGTGACAAAGCACCTTTAATCTCAGCACTCGGGGAATCACTATGAGTTGGAGGCCAGCCAGTGTCTCATGGCACGACCTAGCTCAAAAATGTAGAAAGTGGCGATGCTTAACCTTTTTATAATACATATCTTACGTGTTTAGGTGTTTTGTCTGCATATGAGTCTGTATGCTATGGACATGTCTAGTAGTTATCAGAATCCCCTGGCAGGAAATTGGACTGGAATTTCGATATTTGATTTGTTTATCTGTAGACCAGACATCAGTGTCAAATATCTTGTATTGCTTTGTAGTTTGTTTTGAGACAGGGTCTTTACTATGTAGCTCGAACTGGCTACAGATGTGGCAGAGGCTAACCTTACACTTCTAATCCTCCTGCTCCCATCTCCCGAGCGCTGGGATTACAGGATTGCATGAAGCATGCCGTCCTGCTTTATTGTTTTAGTTAGCATGGGACTTGCCTTGTGACTTAGCCATACACATCTGGCACTGTACTTTGCTCTTATTCACTGTCCTCAAGCAAGCATTTGTGGAAAGAACTGATCCAAGTGTGAACAATGGCCACCCGGCCCCATGAGGACAGGACTGTGCAGCACTGGAGTGCGCGTGTTGGGAGCCGTGTCTAACCCCAGCACCCTAAGACCCTCTGGAGGGAGCAAGTGCTTCTCTCCTGCTGTTTCTCTCAGAGTTAGAGTTAACGCCAGAGCCAGGGCCATTTTGGTGGGCTTTACTCTGCTGGGTCCTGAGTTCTTTATTCATCCAATCTTCACACCAGCCCTATGAAATAGACTGTCTCCATTTCATGAAGGGGGAAACTGAGGCACAGAAGGGACACTATAAAGTGAAATCACTTTGCAGCCTGCCCATCCCCACTGTGGAGCCTGGGCTTTCCTTATGCCTGCTGCTGGAGAGTTCACACAGTGCCAGGCAAAGGTGGGCACTCGGAATGCCCCCCCTTACTCCAGCTTCCCCCCCCACCCCTACCCCATCAGGCACTGCAACATGGTGCTGGAAAATGTGAAGGAGATGTGGACTGAGGTTCCCAAGAGCGGCAAGGGCAAGAAGAAATCCAAGCCTGTCAACAAGGACCGCTACATCTCCAAGATGTTCCTGCGCGGGGACTCGGTCATCGTGGTGCTGCGGAACCCACTCATCGCTGGCAAGTAGAGCCTGCTCCCTGCCCTGCGAAGGCCTGCAGAACCCTGCCCAGTGGGCGAGAAATAAAACCCTGTGCTTTTTGGTTTTTATGTTTTCCAGTGGTCTTCTCTGCTCTTGGGTCTTAAAAGAGTGTGTTGGGCTGAGCACTAGGACAGGGCCTGTGGGTGCTGCGGTATATAACAGCCCTGTCTGCAAAGGAGACAGTTTAATTGGACTTTTGTGTATTGTGGACAGAGGGATTCTCTGACAATGTGCAAGTGGGAAAGGGAAGCCTATTTAAGAGGCTCGTGGAGGACCCAGGGCCTTCTGCTCTACCCACAACTCTGTCTATCTGGTATCTCTGTCTGTGTCCTCCCAGGCGATCATGGGCTGGAGGTCAGGAGTCTCTGCCCTCTTTACATGTATATAAAACATGTATGGGTGTTTTGCCTGGATGTGTCTGTTCTTGGTACCCATAGGAGCCAGAAAAGGAGAGTTGGATGCCCCTAGAGGTAGTTACATGTGGTGGTGAGGCAGCCATGTGGGTGCTGGGAAAAAAACCTGGGTCTTCTACAAGAGCAACAAGTGCTCTTAACTGTTAAGCCATCTCTCTGGCCCTTTAGCTGTCCTCTTTCTTTTTTCTTTTCAAGACAGAATTTCTCTCTATAGTCCTGGCAGTCTTGGAACTCACTTTGTAGACCAGGCTGTCCTCAAACTCAGATTCCCCCTGCTTCTGCCTCATGAGTCCTGGGATTAAAGGTATGAGCTACCACCATTCAGCCTAGCTGTCCTCCTGAACTGTGGAAGTCACAGCTAACGTTATCCTGTGCGTCCCTGTACAGAACTTCGAAGCCTGCAGCCAAGAAAACTTGCATGTGTTCCCTGAGCTGCTGCCAGAAAGAACAGCTTTGTTGTGTACTTTAGAGCTCTCTCTTTTGTTCTTTTGTGGTCCTGAGAATTGGACCTAGGGTCTCATATGCTTAGCAAGCTCTCCCCCATGAGCTAAATCCCCAGCCCTCCATTCACTTACATATATATATATGTGCCCAAGTACAATATTAGGTGTCCTCTAACACTGCCCTTAATTCCCTTGAGACAGAGTCTCTCATTGAACAGAACCAGGCTGATGCCCAGCAAACTCCAGCAATTCTGTCTCCACCCCATGCTACAGATTCTAATTGAGGGTCTCATGCTTATATCGCAAATGCTTCTAACCACTGAACCATCTCCCCAGTCCTTCCATTAAGACAGGAAACTTCTTAGGAAGTTTCCCAGGCTGGCCTTGAGCTTGTAATCCCCCAGCCATAATCTTCCAAGCAACTAGGATAACAGACCTACGTCACCACAGCTATCCTAAGCTCATTCAGTTGAAACCACTGAGATTCAGGAAAAGCATTGACATGTCCCAAAGTCACCCATGTAAGAGATAATGAAGCTACATCCTGATAGGCAGCCAGGGCTGGTGAAATGGCTCAGTGGCTACCAAGTTTAATGCCTAGCACCCATATGTGGCAACTCCAAACCACCTGTAACAGAACCTGAGGGATCCAACATTCTACCTTCCTTGGGCACCTGCACACAAATACACATGGATTAAAATTAGATACAAAAACAGGCCAGACAGTGGTGGCATATGCCTTTAATCCTAGCACTTAGGAGGCAGAAGCAGGCAGATAGGCAGATTTCTGAGTTCCAGGATAGCCTGGTCAGAGGCAGGGAAATCTTTGTGAGGCCAGTCTGATCTACAGAGCAAGTTCCAGTACAGCCAGAGCCACACAGAGAAACCCCGCCTCAAAAACAAGTAAAATCCCAGCACTCAGGAGGCAGAGGCAGGTGGATTTCTGAGTTCGAGGCCAGGCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGACTCCAAAAACAAAAACAAAACAAAAAAAACAAGTAAAATGAAAGCAAACATGAGTGTACCCGTGATCCATCCCTACAGCTTAAGAGGCTGAGGCAGAATTGGCTGCAAGTTCAAGGCTAGCCTGGGTCTACATGGTAAATTCCTGGTGAGCCAGGCATAGTGAGTTCCTTTCAAAAAGAAAAGACTCCATTGAAAATACATTTGGAAAAGTACAGGCTGGGGTCTGGGCGCCCCCTCCATCTCCTCCCACTTAATGGTCTCCCACGATGCCAAGCCGGTAAAGTTGGGCACCTGCCCTCCCCTGCTCCTGAGGCTCTCGAGTGCTGAGGAGAAGCAGGGCCAGGCAGGGAGGCCTCTGCTCCCCACTGGGCTTCGTCAGTTTGCACTGAGAACCTAGGATCGGAGCCTCCTGGCTCACAAAACCTGCAACCTCCCTCTGCATTCTGGGAAGGAAAAGAAAGGGAGTTGGTCTCTTGCCAGGGAAGTTGGCGACTGCCATGGAGGAAGACAGCCGGCCACTCCGTGTGGTGACCTACAGAGTGCCAGTGTGGCTGCTGGGCCTTTAGAGCTATGTATTCTGGATGGCCAGGACTACACTGAGACACCCTGTCTCAAAAAGCCCAAGTAAATAATAAAAGTAAAATTGTAAGCTTTGCAGCCAAGCTGGTGGGCAATGTCAGTCCAGTGAAGCCCACTTATTTCACCCAGGAGCAGGACTGGACTGAGTCTTCAGGTCACAGGCTCAAAGCTGTAGTTCCTGCCCTGTCTGTCACCCTGAACACTCCTCACCAGACATGGAAACTTCGCTTGCCTCTCTGAATGTCAGGGTTACAGTCCAGGATACCTGGCTGTCCAAACGGTGCTTTTATCTACCTTTTTTTTTTTTCTTAATTGCATGTGACAGGGGTAGTTTGTATGTGTGCATATGTGTGTTCACATGTAAATGGGTACATGTGCACACATTTGTATGTTATGGAGACCTGGGGTCACATGGGAAATCTTCACTCTTCCCCGTATGTGGGCACTATGGGCCAGAGTTCTGGTCCCAAGACTGTTGTGGCCAGCACTTTGCCCACTGAGTGAGCCATCTCCCCTGGCCCTTTCTGTTTTGACAGGGTCTTGTTATATAGCCTAGGCTGGCCTCAGATTGGAGCAACACTTCTGCCTCAGCTTCTTGGATGATGGGATTGGGGAAAAGGCTAGCTCTAACTGGTCTGAGACTAGGCAAGTAAATAAGGCTGGTTTTGAACATGCAACAGTTCAGCCTCCGCCTTTGATTGCCTTCAGATAATCCTTTCCAGAGATAAAAGCCAAAGTGGAGGTCCTCAGACGGAGTTTAGTGACAGCTAATGCAGTAGCCCAATTAAGAACTGAGCAAGGCTGGTTCCCGCTGCTTTTGCTGTTTGAGACGATCTCCGAGGTTCAGATAGCCAACCTGTGTTCTTTCAGCTAAGCCTCCCAGATGCTGGGGTTACAGCGCCACCCCTTGTCTGGGTCTGATATTTCTGTGTTGCCTTCCAAACAAGCAGCATGCTCACATGCACGACTTTAATTGTACATATGTCTTAGATTTCAATAGAGATTAGCTCAGGGCAGGGTACAGTAGCAGTGTGGTGTTCGTGGGGTTTTTGCGCCAACACATTGCTCCAGTTGAGCCTCACTCATCTACAGCAGACGACCTCACACACACCCTAGTCATCTCCCTTTCTAGCCTGGCCTCCTCCCACTCCGTAAAGAAGCTTGATTTACTACAGTCTCCACTCCACCAGAAGCCAAAGTCTTAAATCGTGGAGTGTGAGTCAGCTATGAGACACATCTTTCTGGGAACCTTGGGGAAAAATCCAGCAGCCGCTACTAATAAAGGAGGGGTGTGGTGTGAATGGCTGTGGGGTGGGGGTGGGTGTGTCTGGGAGGCGGAAGGATCTGTCTACCTCACTGACCCCAGGCCCTCTTGCTTGGCTGCCAGCTCTCACTCATATAGCTCTGTGTCCTGCTGCTCGGCTTCTCCCACAGCCTAACACAGGCAAAGAGCCTCCCACCCCAGAGCCTTTGAACCTCTCTCCTTTGGTCATGGCAGTCTCCTTTGATCCTGGGATCCCTCAACAAATCCTTCCCACCTCTCTGTGGCCTCCGTTCTGGTCCAGCCACCTACATTCCTCTCACTGGGCTCCCAACTCACTGCCCCTAATAACGAACAGAGAACCATGGAAAACAGCCCAGGAGACACTGCTGCTAAGAATCTTGGGGGTGGAGGGCTGGAGAGATGGAGTTCTGTTAACCTACATGGAGGCTGACAACCATCCAGTCCCAGGGGTCTTCTGCCCTTCAAGCATATGCAGGGGCTGCATGCCTGCGGTGTACATCCGTACACACAGACAAAACAATCGTACACGTAAAGTAAAAATAATCAAATCTTCAGTGAGCCTGGGATGAAATTCCAGTTTCTGCACCCCCTGCCCACTTCTTCCCATCTGGAGGCCCTCGCTTTTTCCAGTGGAGCCACGGAAGCCTTTCTCCATTCTTCCTGTTCCCAAGACCTTTTTGAATGCTGTTCCATCTGCCAGCAATCTTGTCCTCCAACTCTTCAAGAGGTCTCCAGTCACTTCTTTCAAACATGACCCATGACCTAAGCATCATGTCTATCCCAATTGCCTTCCAGTTGATTGTCCTAGACACCTCAATTCTTTTCATAAACGATTCCTCCACAAATATATACACGTGGGGACCTTGTTTTCCGGTTCCTTCGCCTCCATTTCCCCAGCATTGCTCCACTTGGGGCTGGTACACAGTAGGCTCTGAATACATGCTAACTGTACAGACACGGGGGTCCCTTTACCTAGCAGTAACTTTCCAAGACCTCATCCCCAGGCACATGCAGCATCCCAGAGGGCAAGGCGTTGCCAACGGCAGCTTCTCGGCACGCAGAGCTCAAAGGCACAGCCCGGGGGGCGAGTTCCTGGTGCGGACGTGGACGCTGCTCTTGAAGACTGAGACGCAGGCGGCGGTGGCGCCAACCCTGGCGGATCTCCGACTGCACCTGCAACGCCGGGCGCTCAGGGTGACGCTGTTCCCAGGGTGGCCGCCAGGGGGCACGGGCGGGCCAGCCTCTCCTACCTCTTTGTTGATGAAGCAGTAGAGCACGCTCACCAGGAAACCCTGTCAGAGGAGGAGCGAGATCAGATCGCTGCTGTGGACTCATTGTTTCCAGCCTCAAAGTACTGTGGCTGTTACAGGCCTAGTCCTAGGTACTGAGGGCACCTGCTCACTGGCTACCAACTCTCTGTAATGCTCCTCGGACCCCCAAAGGCCGAGAACAAGTGTTGGAAGTTGAACGTCCTGAGTGTAGAACGCTATTCCCTGCTTTCCACATTTGAGGCAAGCAGTCAAACCACTCTGTGCCTCCCTTTCCTCGCCTGGAAAAATGAAGGCGGTGGTTGGAAGAGGTGCAGAATTAATGTGTAAAACGACGTAGTACTTAGCTGTGTGTGGTGGCACATGCCTTTAATTCCAGCACTCTGGTGGCAGAGGGAGACAGTTCTCTATGAGTTGGAGTATATCCTTGTCCACACAGACTTCTATGTCCAACCAGAACTGCATGGTGAGACTCAACCTCAAAAATAATAATTAGGGCTGGAGAGGTACCTCAGGAGTTAAGAGCACTGGCTGCTCTTCCAGAGGTCTTGAGTTCAATTCTCAGCAACCACATGGTGGCTCACAACCATCTGTAATGGGATCTGATGCCCTCTGCTGGTGTGTCTGAAGACAATGACAGTGTACTTATATTAAATAAATAAATCTTTTAAAATAATAATTATTAATTAATTATGGAGCTTGAGGTCTTCTCAGTATTGGAGCACATGCTTAGCGAGCTAGAGACAGAATACAGGTGTGAGCCCCAATACCTGGCTTAAATTGATTCATGAAGTCAGATATGAACATGGGCTATTATCAAGATATTCCTAGGATCTTCTACAATCCCATTAATATCGAATTCAGATCACACATCTCCCTTTCCAGAAGAGGAAAAAAGACAAAATTGAAGTTGCGCTTGGAGTCCTGGCCCCTCTCTCGCTTTTCTGCCCCTGTTGTTTAGCTCTTGCCTCTCGCTCGCCCCAATTGCTCTGGAGTTGCAGGCACCCTCACCACCCTCCAGCACACTAGCTACCCTCTTGCCTCAGGGATCTTCATTCTGGGACGTTCCCCTAGTTGTGTGACTGGCTGTTTACATAGAGTGTTCCCTCCGTCTCTCACAGAATAGGGGGCCGACCATTTGGCTCCTGGCTGTTGCTAGGTGCATATGTGCTCCATCTGTTCTTGCTTCCTTTAACGAATGCACAGTCTCACCGGGGAGACTGGTGCTATCCCCACTTTAGGGAGAAGACTGAGGCTCAGTTGGGTCCAGCAGGGTAGGGACTAGGGAAGGCAAGCACATCAGCGTTGGCCTCACGTTTTGGAACTTTCTACGTCCTTCAATTCTGCACCTTGGGCTAGAGAGATGGCTCAGCGCTTAAGAGCTCAGACTGCTCTTCCAGAGGTCCTGAGTTCAATTCCCAGCAACCATATAGTGGCTCACAACCATCTGTAATGGGATCCTCTTCTGGTGTGTGTGAAGATAGCTACAGTGTACTCATATACAATAAATAAATAAATAAATATTTAAAAGAAAAAATCTGTACCTTGAGGGTAAAGGAAACCAGAAACTAAGCCCTAACTCAGTCCACCCCACAGCCCTTCCTCCTCGTCCGGGGGCAATGCTAGGAAAGACTGTGTGGTCCTCTACATCTATCCCCACCCCCACGCCCACAGCTCAGGATAGCCTCAGTTAGGTATTTTCCTTGTGCATGCATGATGAACGAATGAATGAAATCCCTGGGTACACTCCAGTCAATAGTGGCTACTCTGGGGAATGACGATATCGCTGTGTACCAATGGAGAGAAAGGTCTAAGGTAGGAGGGCGGAGCCCCTGCACCCAGTCTGAGCACCTGGAAGGAACTTAGGAAGATTTCAAAGGCCAGTTTGGCGAAGCGCAGGGAGCCTTCAACCTGTTCCTCCGTCACAGGCGCAAACACCACCTCGTGGACACCCAGCAGGGGCACCAGTGTCAGCGTGGAGCGAGCCAGCCTGGGAAGAGACGGATGTCAGTGGCCCGCATGTCCTCGCCCCTGATTCCGGCTCCATCTGCTTCCCACATTGGGTCCTGAGCCTGCCCTCACCTTAGTCGGTAGTCGGGGCAGCGCATCTGCCGTGTCCTCAGCTTTGAAACAAGGATGCCAAGGATGCGGATGAAGATGAGGAAATTGATCTGTGAGGAGAGAGAGACTGAGCCAGAAGCCATTCGGTTTCTGGGGTGGGACAGGGGGTTGGCGCTCCTCTTCCCCAGAATGAGAAATCCCTGAGTACAGCCTGGAGGAGGCGAGACTGGCCCTACCAAGATGGTTATTAGGATGGGAGTGCGAATGATCCACCAAATGGCTTTGACTTCGTTGCGCTCCCAGCACCTAGAGGAGGCAAAGTAGAACTGAGACGCGAAATGCCCCGGCAAACCTCCAGTTACCCCCTAATCAGGCACGTTCTCTCACCAGGGCCTGCCCACCCTCTTTAAAGCCCACCTACATTCATTTAAGACCCATCCCATCCTGCTTTTCAGAAAGTCTCCTACTCCTCCACCTTTCCCAGCCCATAATTCCTTTATACCCCGCCCACCCTCTGCGCACCACCTCTTTTCCACCCTTCCCCGCCTCCTGTGCCATGTAGCCCCGCCCCCAGCCCGGCCCCGCCCCCCAGACCCTGCAACTCACTGTGTGTTCTCGCGCAGGTACCTGACGATCACCCAGGGAATGACGAAAAGCGCGGGGGCCCCTGTGCAGACCCCGATCCCCGCCCCCCACCACGCCGCAGCTGTCAGTGTGCACACGAGCCCCTTCCAGGCCCAAGACCCGCGGAATTCTTCAGCAAGGGAGTGGGAGGGGAGGAAAGGCGGATCGGCTGGGTGGTGGTGGGAGCCAAGATGCGCTGGGCTGGGCGGAGGGGTGGGGAGTGGGGGTCACAGAGTCAGGGCTCACCCCAGCCAAGAAGCAGGTAGCAGCGGAAGTGGCCCTTTTCTGAGCGTCCCACGATCACCAGCAGATGGTGCAGATAAACACCCTCCACCAGTAGCCAGGTGTAATTGGCTCCCACACAATATTGGGTCATGATCTGGGCCGTGCGGCAGGCAGCTAGGGCCTATGAAGCCATCAGACAAGGGTAGTCTCTTTGTTTTATTATTTGTATGTATTCCTTTGTGTATGTGGTAGTAAGTCTTGAACCCAGGACTTCCTGCTTGTGAGGCAGGTGCTCTACCACTGAGCCACGCCCCCAGCCCCTCACTGGGGAGTCTAGGCAGGGGCTCTACCATTGAGTTACATTCCATTTCTCTTCTCTTTGAGTCAGGGTCTCAATAAATTGTACAGGCTGTCCTTGAACTTGCTCTGCAGCCCAAGCCGGTTTTAATATATCAGTTGTGCTCAACTTACCACCTAACTGGGACTATGGGACTTCCTGGCCAAACAGGGCTCATCTCCATCTCTTGCCCTGTTTTACTCTGGGTTTCCAGTAAATGGCTTATCTTATCTCAACTTACCCACCTTCACTTGAGGACTCTTCCACATTGACACCCTTAACAACCTTGGCATTTTCTATTCTGTTACCACAGTGAAGTACCCTTAGAATCCCACTATGTAGCCTTTGCCACACTAGCTCTTTTTTTTTTTTTTTTTTTTAGATTTATTTATTTATTTATTATATGTAAGTACACTGTAGCTGTCCTCAGACACTCCAGAAGAGGGAGTCAGATCTCGTGATCGGATGGTTGTGAGCCACCATGTGGTTGCTGGGATTTGAACTCCTGACCTTCGGAAGAGCAGTCGGGTGCTCTTACCCACTGAGCCATCTCACCAGCCCCTCTTTTTTTTTTTAAATCTTATATTTTGTAGGGGTTGTTCTTGTTTTGTTTTGCTTTGCTGTGTATCCCTGGCTGTCCTGGAACTCACTCTGTAGACCAGGCTGGCCTAGAACTCAGAAATCTGCCTGCCTCTGCCTCCCAAGTGCTGGGATTAAAGGCATGCGCCACCATGCCCAGCCTGCCTCTGCCTCTTGAGTGCTAGGATTAAATGCATGTACTGGGCCGGAGAGATGGCTCAGAGGTTAAGAGCACTGGCTGCTCTTCCAGAGGTCCTGAGTTCAATTCCCAGCATGCATATTGCAGCTCACAATTGTAACTCTGGCTCCAGGGGATCTGATACCCTCTTCTGACCTCTGAGGGCACCAGGCATGGACATGGAATACATCATACATACATACATACATACATACATACATACATACAGGCAAATACTCACACATGAAATACAAATTTATAAAAAGTAAATGCCAAGCTACGCGCCCAGCAGTGTGAAGGTCAGAGACCTTTCAGGAGTGTGCCACCATGCGGGTTCTGGGGTTGAATGCAAATCATCAGGATTGTAAACCAATGCCTCTAAGTACTGAGCCATCTTTTCCCCCTCTATTTTGTGTAGAGACATTTTGCCTGCCTGCATGTCTGTGCATCGCATGCAGGTCAGAGGAGAGCACCAGACCCCCAGAACTGGAGTCACAGATGGCTGTGAGCTGCTGTGTGCATGCTGGGAATCAATCCAGGGTCCTCTGCAAGAGCAGCCAGTGCTCTTAACCACTGAGCCATCTCTTCAGCCTGGGTGGCTTCTTAATCTTTCTTTTCATTTCCCCAGTACTGAATCAGGTACTCTATTAGTGAACTTCACCCCAAGACCATCACCTCACACACACAATTATTATATAAAGTCCTCTGTTCACAGTCCTGAGTTTCATCTCCCTGCCTCAAGGAACGAACTGGTTCCTTCCAAATCCCTATTGGTTTCTTCCTCCCATCCTGTCCCCACGCTTTCACTGTCAGTGATGAGGAAAGGTACGGAAATAGATGGGAAACGTCTTGGTCCCACCGGGAAGGAGGCGGTGGAGTACCTGGTTCCACGGGGTAGGGGCCTGGTCTCCAGTGTAGGGACCCAGTGGAGGCAGCAGCTGATCTCGGGTGAGGATGGCTGCTGCCCGCAGCATGA
D3_15 19714716 19729764 15049 GGGGAGGCAGAGGCTGGCAGATCTATGAATTCAAGGCAAGCTCTAGGCCAGCCAGGGCTACATAGATGAGACCTGTCTCAAAAGAAAAAAACAACAGACATGCCAAGTGATTGAGGAAGACACTTGGTGTTGCCCTCTGGCCACCACACACTCATGTGCATTCACAGGCTCTTATATACTCCCATCCAAGCTCATTCGTATGCCATACGTAGACAGGAAATAGAGACATGAAAATGAAACACGTCAGTTGAGGAGCATGCGTGGGCTCCCAGTGCTCCGAGGCAGGATCAAGAGTTTGAGGCCAGGCTGGAGTACACACTGAGACCCTAGAGAGAGATGTAGGGATTATTTTTTTATGATTTATTTATTATGTGTATATGAGTACACTATCACTGTCTTCAGACACACCAGAAGAGGGTATCAGATGGTTCTGAGCCACCATGTGGTTGCTGGGATTTGAACTCAGGACCTCTGGAAGAGCAGTCAGTGCTCTTAACCTCTGAGCCACCTCTCCTGCCCTAGGTGAGTTAATTTGAAGTGCTTTGCTGCTAACTGCTATTGTGACTAACATGTTTACGCTGCCTGTGAGTGGATGTCTTTCCCCTTCCTGTGAGCTATTACTGGGGAGCCCAGTGTCATCAGTGCATGCATTCAGGAGGGGCCCACAGTGTGTGTATCTCAGGGTGCGGGAATGTGCATCCTCTAATTACGAGGAGCACTTGATGAGGGTGTGGAGCGTGTAGCCCTGCTCCTATCAGCTTCCCTCTCAAGCAGTCTGGGATCGCTGAGTTAATGGTTCTCATTAAAACTGTGGATGACAGGTCTGGAGAAATGGCTTCGCAGTGAAGAGCATTTGCTGCTCTTTCAGAGGGCCGGAGCCGGTTTCCCAGCGCCACATCAGGTGCCCTCATCGTTTGTTTTTATTACCTTTCAAGTGTGTGTATGGGCACCTAGATTCACATGTACTTACCCACACTCAGACACACAAGAGGCCCATACACACACTTGAACGGTAATAAAAACAAATCCTTAAAACTGTAGGTTTGTGGAATTCTTGGCTCCTGTGGAAAAGCCATACACATCTTTAGCTGATAAACCATCTCTCCAGCCACCAGCACTGCACTGAAAGCCACCGTTGAGTTTCACTTGAATCAGCCTGACATAGGCCAGAAACAACACAAGGTGTTTTAATTTTAGGATAAAGTAAAAGTCATTATTGAGTGATTTCCTGTTGTTCCCCTATAGGGAGCGTAAGACAGAAAAGAATGGACATGTCCTTCAAGGCCAAGGCCATGACTGTGGGGACCAGTACAGGGTTAGTAATTGATTTTGGCTGTTCAAATGAGATCTGATGTAGTCTAGGCTGGCCTTGAACTCCTGACCCTCCTACTTTGTTTCCTAATTCCCACCTTCTTTATATTCAATATTTTAAATATATTTTGCCCACACTTAGTCTGTGTACCCCATGCATGCAGTGCCCATAGTGGTCAAAAGAGGGTGTCAGTCCTCTGGAACTGGATTTACAGTCGATTGTGATCTGCCTGCCATATAGGTGCTGAAGCTGAACCTGGGTCCTCTGCAAGAGCAGCCAGAACTTTTAACGCTGAGCCATCACTTTAGCCCCTCGTTTGCCTGTTTGTGTGTTTGTGTGTGTGTGGGGGGGGGGGGGTCGTTGTAGTTTTGCTCATTCCATTTTTATGATTTTAATTTTTATATTACAACAGTCTCACACTATATAACCCAGATTGGCTTAAAACTCTTCCTCCTTCAGCCTCCCAGACTACTGGAATTACAGGCATGAGATGCCATTCCTGCTTGCCTATTTGATTTAAAGGCAAGGTGACTAAGGCTCTGGGTGTCCCACCGAGAAATTTCTCTATCCCCACCACAACTGGTAAACAAAGCTAGAGTCTCTGACCTCTCTCCCATACTCTTCTTTCTGCACCAGTCCTCAATCTCCTGGCGCAGTGTCCCTTTAAATCTTTAACGTCAATCAGGGCTCTGGTTTTAAGGGAACATCGAGTAATATACCTCCCTTTGAGTGCATCTGCCTGTGTCCGGACCGGGTTACCAGGTTTCCGGTTCGGCAGTGTTGGGCTCTGGGAATTTGTCCCTACTCCCGTAATACTGTTTCCATCCCGCCCACCTCCTCCCAGTAACCTCCCGCCTACTTGCTGTCCTGGCCCCTTTGCCAGGGCCTTCCTTATTTGGGCACGGCTCTGAACCCCGGTCGCTCATTGGCTCGGGCCGTCACGCGCGCGTCTGTCAACAAAGGGGCGGATCGGAGTGCGCAGCGTGCCTGCCCGCGCGAGGGGGGCGGGCCCACAAGGCTAGAGTGCGCATGCTTGTAGGTCGCCCTTCTCCCTACCGCCTGGAGGAGGCGCTGCGGGTGAGGGCGCCTGGGGGGCGTGTCCGGGTGTTTGGCGGGGGTCACCGGAGGGGCTCCAAAGGAGGCGGGTCCAAGATCTGGGGGATTCGTTTGCTTCTAAGCGATATTTGAGCTATTGGGGGAAGTTGTGGATGTGGAAGGGGTACTTTAGGGTTCCCTGGGGCTTAAGAAACCTTGGGTTCACGTTATTTTGTAATGTGGAAGGCTTGGTTGCATTTTATGAGTGGCCTTTGTGGCTGTGGCTGGGGGTGTATGGTGGGCACAAGATGAGAATATTTCGGGGCCAGAATCCTTGGGCTTGAATACTTCCTACCTTTGTCACCAAGGGCAGGAGGACACTTTCCTTTCATGGCTCATCTGCAAACAGCTGCGGGATTCGGGACACATGTCTGCTATTGTACCTCTCCTGGTAGCACTGGGGGCTATTGAAATGTATTTGGTTTGGGATTCGTTTTAAATAGGGTTTTATTATGTCTGGGTTCTTTCAAGGTTCCTGAACTTCGGGGGAATGAAGGGGTAGAGAGTCAGGATTGGTGTCTGGAATGAGCTAAGGCCCACTGAGTCACTTGTGATCTCAAATACTTGAGATTCAGGTATTTTGTATGTCTTCAGATATATGGAAAGTTATTGATGGTTGGACTTTTCTGTGCTGGACAACATACTGGTTTGTTTTGTTTTGTTTTTCGAGACAGGGTTTCTCTGTGTAGCCCTGGCTGTCCTGGAACTCACTTTGTAGACCAGGCTGGCCTCGAATTTAGAAATCCGCCTGCCTCTGCCTCCTGAGTGCTGGGATTAAAGGTGTGCGCCACCACCGCCCGGCTATTTTTTTTTTTAATTTTAATGTATATGGTTGTTTTGCATGCATGTGTATGCATCACATACGTACCTGGTGCTGTTGGAAACCAGATCTTCTGGAACTGGAGTTATAGAGAGCCTCCCTGTGGGTGCTGGGAACCAAACTTGGGCCCTCTATAAGAGCAACAAGTGCTTTTAACTGCTGAGCCATCTCTTCAGCCCTCTAGTCTTATTTTATTTATTTATGAGACAAGGTCTCTCGGTAGCACTAGTTGGCCTAGGACTAGATATATAGAACAGGCTGGCCTTAAGCTCACAGAGATCCACTAGCTTCTACCTCCCAAGTGCTGGAATTGAAGGTGTGCACCACTTTGGGTTGGTTGGTTTGTTTCGACAGGGTCTGGAACTCCTTAGCCTCCTGTCTGATGTCATATCCTCCCAAGTGCTGGGACTACAGGCATGTTCCACCAGGCTGTGGGGGAGGAGATTGAGTTTTTAAAGGAGAATTTGAAAAAGTCTGGACATTTGGTGGGACATTAAGGTACTGGAAATGAGGGTAGGAGGTTTGGGTGAGAATTCTTAAGACTGGGGTCCTGTCACTGGTGATGGTGTGTGGAGGCTGAGTTTTGAATGGCACCTGCAGGACCGTGAAGTGCTAGTTTACCAGAATTGTCTGGACTTAGAGTGGGCAGTCTATCCCACAGCATCAGCTAACTTTTTCTGTGACGGACTAGGTAATGAACTATTTCCAGCCAAACAGTTATTGATGCAGCCCTGTTCTTTTTGCATGAAAGCAGCCATAATTTGTTTCCATAAAACTTAATTTACAAAGACACACAGTGGACTGGACCTAATTCTCGGCATGTAGTTTTACTTTAGTTCTGTTTCATTGGCATGATCAGGGCTTAAAAGTATGAAGGGTTATTCTCTTCATTTTTGTTTGTTTGTTTGTTTGGTGGTTTATTTTTAGACACGGTCTGACAATGTAGCCCAGGTTGATCTGGACCGCTGCATCTTTTTGCCTCAGCCTCTCCAGTTCTGAGATTACAGGCATAAATTACCATGCCCTGCTGGAGGGTTATTTGCATGTTGAGATGTCTGGAAGGGATGGGCCAAAGATGGAGACAAGGGGTCTGCTACTCACTGGTAAGTAGAAAGTGGAACAGAAAATGTTGCCATCGGACTCGTTAACAAAACTGCTTCCAGATTAGTTGATGCATGCAAAGTCATGGAAAAACAGAAAAGAATCATTATTAAGGATACCCTCAATAGATGCTGTGACTGGGGCCTGTGGTCCCACATACCTGGGAGGCTGAGGCAAGGTGACTGCTAGGAACCTGGTGAGAGCCTGTCTTACCTAGTGAGTTTCAAGGCAGCTGGGGGCTAAAGAGTGAGATCATGTCTCCAAAAATAAACAATCTCAAAAAAACCATGAGTATAGTGTTTTACCTTTGTAACCCCAGAATGAGGAATCCCAGAGGATTGGGTTGCTGTGAGTTCAAGACTAGCCTGAGCTACCATGAGGCCCTGTCCTCAAAAGGACAGAAAGACCCATCGCCATCGTATTTAAGTACCCCATGGCCAGGCTGGAGAAATGGCTCTACAGTTAATAGCACTAACTTCTCTTCCAGAGGTCCTGAGTTCTAATCCCAGCAACCACATGATGGCTCACAACCATCTGTAATGAGGTCTGATGCCCTCCAGTGTGTCTGAATACAGCTACTGTGTATGTGTATGTATGTGTGTATATATACATACATATACATATATATATATACATATATATATACATATACATATACATATACATATACAAACAAGTGGAGAGTGAAGTCCTTTTTTTTTTCTTTCTATTTTTATTTACTTTATGTCTATGAGTGCTCGGCTGCATGTACAGCTGCATGCCAGAAGAGGGCATCAAATCCCTTTTAGATGGTCATGAGCCACCATGTGGATGCTGGGAATTGAACTTAGGACCTCTGAAAGAGCAGACAGTGCTCTTAACCGCAGAGCCATCTCTCCAATCCTAAGAGTGAATTTCTTAAGGGCCTGTCTAGATCTAGCTTCATATTTTTCTCCCCTGTCTAATCACTTCATCCCTGTGTGTGCTCCAGCAGCCGAGACTATGGAGAAGGCTGGACCTGGCTGCTGGAGGGCACATGTAAGAAGGAGGAGCCTGGTCAGCCTGGTACTTTCCCTTAAAGGTCAAGCCAGGTGTGGTATTTCACTCCTTTAATTCTGGTACTTGGGAGACAGAAGCAGGTGGGTCTCTGAGTTGAAGGACAGCCAGGTCTATGTAATGAGTTTTAGGACAGCCAGGGCTACACACAGAGAGACCCTGTCTCAAAAAAAAACAAAAACAAAAACAAAAACCAGTTATAGGAGACCAGGAAATTTGGGGGCATCCCTCTGCTTACCTGATGTGGGGCTAGAAGAGTTTTGTTCTCTTGGCCATGCTAGAGACACAATCCAGCCTAGTAAGTAGGCTACCACTGAGCCACAGCCCAAGTCCCTCACTGGGTAAAGTCATGCGAGTGCTGTTGCTGTACCACAGAACCACACTCCCAGCTCTTTTCTGGGGGATTCCAGACAGTGGCTCTTACCAGTGAGCCACGTCCCTAGCCAAAGAGAGTTAGAAAGTGTGTGTATGTGTGTGTGGTCTCATTCCTCCTCCTACATGCAGTGGTTAGGCTTGCACCCCTCCACTCTCTGGGACACACAGTTCTCAGTGCCTTAAGTTGGCCTGTCCCCTGGGCAGAAGTTTAAGTGTGGGTGGTGTTGGTAAGAAAGGCCATGAGCTCACTGTTGCAGCCTTCTGTGTCTGCAGGTGGCCTGGAGAGCTCCCCACTACCATCCTGGCCCTGAGGCTGAGTGACTACCTGCTGCTGCTTGTCATTGCTGCCCAGCATGGACAGGGGCAGCCTCCTGCCCTTCCAACTCTGGTGCCCCCGGCCCTTCAGCAAGTATTCCCAGAACCAGCCGCGCCCACCTTCCACAGCCCTCAAGCCGCCAGTCTGTCCTGACACAAGCAGCGGGACTGAGCCCGACCACAGGCCTGCGCACTTGGAGAGCACACCACCTGCCGTGGCTGCAGAAGCCCCCACCTCCCAGCCTGCTCCACTCCTCTCTACAGCAGCTTCCGGTGATGAAGGTCGGGTCCTGCTGGACACGTGGTATGTTATCAAGCCTGGAAATACAAAGGAGAAGGTGGCCTTCTTTGTGGCCCACCAGTGTGGTGGAAGTAGCCGGGCCAGCTCTATGAAGGTCAAAGGGCACTGGGGCAGTGACAGCTCCAAAGCTAAGAGGAGGAGGCGCTGCCTTGAGCCCACCAAGGCTCCTCCAGACCAAGGGGGCCGAGAAGGAACCCCTGCCACTGAGGTGACCCCCACATCATCTGGGGATGATGTAGACCTGGTCTCTGTAGCAGAAATGGTGGCCCTGGTTGAACAGAGAGCTGCCCTGGCCCTGCAGAGTTATCCGCGCCCCAGTACCCCAGCTCCCGTGGTCTTTGTGTCAGCTGATCAGGGGGGACCAGCCAAGGGGCTAGGGTCGGAAAGGCGGTCTGGTGGTGGTGACTGCAGCCGAGTTGCTGAGGCAGTGGCCCACTTTGAGGCCCAGCGGGACAGCCCTCCTACCAAGGGTCTCCGCAAGGAGGAACGGCCAGGCCCTGGGCCCGGCGAGGTGCGTATAGCTTTCCGAATCTCCAATGTCCGAGAGCCCCATTCACCAGATGGCAACTTACCCAATGGGGGTGGAGGCCGGCCTGGTTGTGCCTACCCTGGTAGTCCTGGACCTGGGACTCGAGCCAAAGACAAAATCACCTGCGACTTGTACCAGCTTATCAGCCCCTCCAGGGATGCCCTTCCCAGCAATGTGGAGTTCCTATTGGCCAGGGCTGATGAAGCCAGTGAGGGTGAGACACCAGCCCCCACCAGGCCTGAGGACACTCCACCAGCACCGCCTCCACCCCCTGCCCGGGACTGTGGTGCATCAGGATTCCATGTAGATGTGGTGGTAACAGGTGTAGTGGATGCGTGCATCTTCTTTGGCAAAGATGGCACCAAGAACGTGAAGGAAGAGACTGTGTGCCTGACAGTGAGCCCTGAGGAGCCACCCCCACCTGGCCAGCTCTTCTTCTTGCAGTCCCGTGGTCCAGAAGGGCCTCCTGAGCCACCCCCAGCTGATATACCAAGCACAGTGCCAGGCCCCGATGATTCTGAGGGCACAACGGACACCTCCCTCTGCCGCCTGTACCGGCATGTGTCACACGACTTCCTGGAGATTCGCTTTAAAATCCAGCGTCTTCTGGAGCCACGGCAGTACATGCTGCTGCTGCCTGAGCACGTGCTCGTCAAGATATTCAGCTTCCTGCCCACGCGGGCCTTGGCAGCCCTCAAGTGCACCTGCCACCACTTCAAGGGGATCATCGAGGCTTTCGGTGTGCGTGCCACGGACTCTCGCTGGAGCCGGGACCCGCTCTACCGAGACGACCCTTGTAAGCAGTGCCGCAAGAGATACGAGAAGGGTGATGTGTCACTCTGCCGCTGGCACCCCAAACCCTACCACCATGACCTGCCTTACGGACGTTCCTACTGGATGTGCTGCCGCAGAGCCGATCGTGAGACACCAGGCTGTCGCCTGGGCTTGCATGACAACAACTGGGTACTGCCGTGCAATGGAGTGGGTGGAGGCCGTGCTGGCCGGGAAGAGGGGAGGTGAAGCCCGTGGATGAGGGGACACCTGCGATACCTAGCCCCTCCCCGCTTTGCCGGGAGCTGGGGACCAGGACTGAGTCACCAGCCGACACCTACCAGTCCATGCGGCAGCATCCATCTCCCACCAGAACTGGGACCAGGTTTGGGGATCAACAGGGCAAATACCTTGCTTGACCTCTGTTGGTTTTTTATTCTTCAGAGCCAGGGCCATGGACCCTCAGAGAGGGGTGTGGTTTTTTGCTTTTTTTTTTTTTTTTTTTTTTTAAATCAGCATCTCAATTTCACCTCCATCGAGTCTCTCCACCCCAGGGACCCACCAGCAGGGGGCAGACGGCAGCTAATTTTGGTACCACCTGAGGCTTTCCTCAAGCTGGCCCTTCGTTCTGTGCCTCCCCCAGTTGTCTTTGGAGCTGTGCTTACCAAGGCGCTGCATGCTCTGAGGGTGGCTCATCCAGGCCCTTAGCTCACAACTCAAGTCGGCACTTTTTTGAGGCAGCCCAGCATTTCTAGATGTTTCCTCATTAAATAAAAAAAAAGTTTTCTTCTGAACCTCAAACTACCAGAGTCTCTAGGGAAAGGAGGGTTGAAGTCCCCTCAAGCGTAGGAGAACCCCTTAGGCTCTTGTCACTGACTCTTTCCTCAGTAAAGCTGTGAAGCCCCTTGCCTCACTCCTGGATGACAAGCAAGCCAGAGGGACAGGCCAGTGGGTCTGAATTTCGCCAGGATTCTTCTTCCACTTTGGGGTCCTCTCTGAGGCATTAGGGTCTCTGCAACTACCCCACCCCAGCCACAAGTTTCTTTAGAATCTCTTGGTTAACTGGGACCTTAATTTTGAGGCAGTTTGGTCCAAAATATTTTTGTTTGGGGTTTTTCCTCGTTTGGGGGTTTCATTTTCTTTTCTCCTTCATTGTGGCTCCGGGAGCGTCTCGTGTGTGGCGTCTGACCAATTTTGAATTGGTCGTTTCTATAAAATCAATATTTATAACGCTGTGCCCAGCCTGGCGTGTGTGATGTTAAGAAGGGAGGTAACGGAGAGACCCATAGGTCTGCTTAGCAGAGTGGACTGGAAAGGGAGAAGGCACCCATCCCTAGCCGAATCCCTAAGCCTCAGAAAGACTTAGTTGTTTTAAATGTCTCACAACAGTGGTAGCTTCAACAGGGTCATTTTTTATTTCTCTCAAGAACCCATCCCTGGGGGCCCTCATCTCTGTGGTCTGTGACTGCAAGGGAGTCCTCCTGTGACAGAAAGGGAAGTCCCTTGGTGGCAGAGGAGCTCCACACACTGTGAATACCTCTCATCCATCAGAACTCAGATGTGCGCTGTCATGCTCAGCTTATGTGGAGGGTGAGGTTTGGATTTCAGATCTTCATGCTTGCATGCAGCCACTCCACTACTGAACTGTCTCCACAGCCTCTCATTTTTATATACATGAGACACGCTGGGGGCAGGTGCCAGGCAGTGGTGGCCCACGACTTTCGTCCCAGCATTTGGAAGGCAGAGGCAGGCAGATCTCTGAGTTCATATCCTTTTGTGCGTGTGATGTATGAGTAGCACAGGTGCACATGTGGGACTGCACGTGTGTATAGGTCTCTTCCCACAGTAGGTTCCAGGAATCAAACTAAAATCATCAGGCTTAGGCAACAGCATTTCTATCCACTGAAACTTTTTCACAGACCCAAAAAATTCGTTTCCTATCCCATATACAAATAACCAGATGGTGAGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTCGCTGAGAATGGAACCCAGAGCCACACGTGCTAGGCAACCGCTCTACCACTGAGCCATGCCCCCAGCCCCTCACTGAGGGATTCTAGGCACTGAGCTACATTTTCAGCCCACTTTAGATAGGGCCTCACTAAATTGCCAAGCAGGTTTGGAATTCATTCTATCCCAGGCAGGCCTTGAACTTAATGAGCAAAGATGAACAGACCTGTGTCATCATTCCTGGCTCTTCTGTGAGTTATGGCTCAGGTTCCCAGGAACTGTGCTGAAGTTGACTAGAACTAGTGGACTCCCTCATTATTAGCACTTCATCTTACTTAGATGGATGGTTTTGCACACACTAAGCAAATCCTAGGTGACCGACTGGGCTCATCCTGGTTCCCACCACCTGTGGTTTTCCTGGAGTGTGTTTCCTAAGCAACTGTGCATTCACCAAACTGGCCTTAAGAGTAAGTTGGTCTAATTGAGACAGGATTCATTGTGTAACCCTGGCTGTCCCCGAAATCTACTTGCTTCTGTCTCTCGGGTACTGAGATTGAAGGTGCAGTCATGACCCACTATGATGTGATGATGCCCTGTTGGTACTGTAGTAGGTTTGGGGTGAATCTTGGAAGCCTGTTTTATTTTCATTTTATTTTTTTATTTTTGGTTGGTTAGAAGGGATATTTTTGGTTTTTAATTTTTTGGTTTTGTTTTAGCTTTTTGAAGCAGGGTTTCTGTGTTGGCCCTGGCTGTCCTGAAACTTACTCTGTAGACCAGGCTGGCATGGAACTCAGAGATCCACCTGCCTCTACTGCCTGAGTGCTGGGATTAAAAGCGTGCGCCACCACCACCCAGCTAGGGAGCCTGGCTTGTTTTTGTTTGTTTGTTGGGCTTGAGAACCTCTGGCTGGCTATGGCAAGGTATAAACCTGTTATCCCAGCACTCAGGACTGAGTAGGAAGATTCTGAGCTTGTGGCTAATCTGGACACCATAACTCCAGAGAAGTCAGGGCTATATAGACCTCATTTGGAGAGATGGCTCAGTGGTTAAGAGCAATGGCTACCCTTCCAGAGGATCCAGGTTCAATTCCCAGTGTCTGTATATGGCAGTACACACGTGGCTTTAATGCCAGTTCTAGAGGATCTAACACTCTCACAAAACACAACTGCACATGAAATAAAATTATAAAAAAAAAAAAAAAAAGAAAGCAGTAGGGCTGGGTGTGGTGGCTTTTCCTTTCAATTCCAGTGACGGTGGAGTCACGGCTCTTGTGTTCAAGATCTACATAGAAAGTTCCAGGCCAGCCAGGCAGTGGGGGCACACGCCTTTAATCCCAGCAAGTCTGGAGGTAGAGGAAGGTGAATCTCTAAATTTGAGGCCAGCTGGTCTATAGATTGAGTTTCAAATCAGGCAGGGCTACACAGAGAAACAAAGTCTCAAGAAAAAAGAAACTTGACTAGAGTTGCACACACAACAAAAGGAAAGGGTAGGTTCGGGTTAACTCCATCCAGGTGGACCTCTGTCTATTCAGTCCATTCCCACTCTCAACCTGCCAAAGGCAGTATTTCCCAAAGAATCCTGGAGGCAGCTTCACTTGAAATACCTTCCTGCAAAGAGGTCCCACTGTGGAGTACTTTGAGAACCATTTCATCCTCTTACTCTGGAAGATCTCACCTTTGCAGTGAGGAAGTTCATTTAGTGACACTTTTCATGAGCGCTGTGGCCTTCCGTTCCCCTTTACCCTCGAGGTTGGCACCCCTGAGCCAAGCAGACCGTAGACCATCGAACTAGGCTTCGTCTCTGTCCTAAGTTATGAGCCCATGCCCATGTGGAGTACGGTAGCAAATGAACTGACATCAAACATTAGCCGCAATGGATTCATTTGGTTGGTGGTGCTGGTCCACGTGCCAGCCCGTGACACATCATTTGGTCCCTGGAACCTTCCAGTTATTTACTTCAGGACAGAAGCCAAAGGATTCCTTATTTCCTTTGGCTCTTTCGTGCCTCAGTGTTCCTTGCATCCTTGAAACACGGTGACTTCACATGGTTGTAGCATACATCTGAGGTGAGACTGGCCACCCTGCACTGGCTCAAGGTGCCCCTGTCCAGTCCACAGCTAAGTGTATAAGATTCCTTCAAGGTATCAGGCTGCAGGCTAGAGTCCCAGGTACTCGGCCAGGAACACAGCAAGGATGCGGCTCAGGTTATGCACAGTGGGTGGGTGGAGGTTGGCCTCGGTGTCAGCAGGTGTGTGCCACACAGCAGGGAAGGGCGTGGCAATGAGGTGGAGCACCGGGACCCCTGAGGGGACAGAATATTTCATCCATCAGATGCAACCCGAAGACAGTCAAGAAACGAGTGCTTTCTAACCTCTCAACCCAAGACCTTGGGTATGCTAAGCAAACATGCTACCTCTGAGTTACATCCCCAAACCCTGAGGAAAGATTTTAAATATAAGAAGGTACATGCTGTTTAAGAAAAGTTAGTGATGGGCCTGGTGAGATGGCTCAGCAAGTAAGAGCTCTGACTGCTCTTCCGAAGGTCCTGAGTTCAAATCCCAGCAACTACATGGTGGCTCACAACCACCCGTAATGAGATCTGACTCCCTCTTCTGGTGTGTCTGAAGTCAGCTACAATACAGTGTACTTATGTATAATAATAAATAAATCTTTGGGTCAGAGCGAGCAGAGGTCCTAAAAAGTCCATTCCCAACAACTACATGAAGGCTTACAACCATCTGTACAGCTACAGTGTACTTGCATACAATAAATAAATTAAATAAATAAATAAATAAATAAATAAAAAGAAAAGTTAGTGATGCAGCAGGCTACCACCGAGCCTGTTGACCAGAGTTCAATCTGGCACACTGTAAAAGAAAACAACTGGTTCCCAAGAGCTGACCTCTAACCTCTGACCTCCACTGGCACATCCATGCACCTGCATGCTCACAATAATGTTTTAATTGCTGGATGGTGGTGGTGCATGCCTTCCTTTAATCCCAGTAGTTGGGAGGCAGAACATGTAGGTCGGGGTGAGTTTAAAGAGGCTAGCCTGGTCTACATAAGTGAGTTCCAGAACAGCCCATACTACATAATAAAGCCCAGTCTTAAAAATAAATAAATAAATAAATAAGGACTGTTGTTTACATAACAAATCCAAGAACCTCGAAACTGAAGGACCTGTAGAGGCAGAGAAGGAGGCCCTTGTTCCTCACTGGACATATCTGATGCTATGGGGCTGCAGTGACCATGACCATCTCACCTACTTGGCTCCACCTCCCCAATGCTGGGACTACAGATCTACACCACCAAAACCAGGCTACTGACTGCTGAGGATGCAGCCCAGGATTCATGCACAAGAAGCAAGAGCTTTACCAAAGGAGCCACATCTCCTAGGTTCATCTAAGGTAGGCATCTACTGCCATTACCCTTATTTAATTAATCATGCTTAACTATTTGGTTAGAAACAGGGCCTCACTATAGTAAGATGTCCAGGCTGGTCTCATTTTCTTTGCAGGTTTTAGGATGGCTTTCTGTTGTTGGCCAGGGGGATGGGGTTTAACAGATGTGGGGATGGGGATGGGATGGTGTTGGTTGGGTGGTGCTAAGATAATTTAGGCAGAGGCTCTACCACTGAGCCTCGCCCTGACCCCTCACTAGGGGATTCTAGGCAGAGGCCCTACCATTGAACTATACTCTCAAATTTTATAGGCTTATATAATTCTCCTGCTAAGACTAGTCCTGTCCAGTACTACTGTCTTCTACTCCCATGTTACAGCTATGGAAATTGAAGCAGAGAAACAGACACACTGATTTGCCTGAGTCCTAGCCCTAGTAAACAATACAGTAAGATTTGAACCCAAAGTCCTCCCTTCCTTGTGTGTTCACAGAGGCAGCTGGCCTGGGAACCGTTAGAGTAGCTCTGACACCTCATTCCTCACCCACCTGGAGAGGCACTCACTGAAGGAAGCAGTGAGGAAAAGGATGCTCTCCTGGCATGCAAGAGGCGGCACTGTGCGCTTTCTGTATACTGGGCTCAGCTCCAAGTCAAATCTTGACCCATATTTGCATATTTAATGCCCTCCATGCTCCCCATTTTACAGATGAAGAGATCAGGACTGAGCCACTTGCCAGCAGTCCCTAGCCTTGGGAAGGAGGCTTCCTTGTACCCCTCACCCCAGCAAGTACCTCTGCGAAGGAAGGGGATGTGGTCATCTTCCACAGGGCCGGGGGGCTCCCCGGGTTGGAAGTACATCACTTCCTGGGGGTGAGACTGCAGTAGGTTCAGCCGGTGAAGGCGCTTCTCTGGAGAGGAGTGGGATTAGAGAGCAAGATTATAGTCAGCAGTCAGATATGCCACCCCAATACCAGTGCATGTATATGTGCTCCATGTGCATACAGTGCCGCGGGGCCAAAGGAGAGTGCATCAGGTCCTCCAGAACTGGAGTTATACATGGGTGCTGGGACTCGAACCCAGATCCTCTGAAAGGGCAGCCAATGCTCTTCCCCACTGAGACAGCTCTCCAGCTCCATGTGTTTCTTTTTTTTTTTTTTTTTTTTTTTGCATGTTGCCTACTCCTGGTCCCATGTACTCCTTCTCTGTGTAGGAGGAGGTGGATGCCTCCATTTCTTTTTCCTACTCGTCCTTGTGTGGTTGGGGGAGTGGACTCAGTTTTCTCCCTCCAACTTTACAAGGGTTCTGGGAATTGACAGGCTGCCAGGCTTTTGAGGCAAGCACCTTTACTCACTAAGCCATGCCGCTGACCCCCATGTCCCTCTTCTAGTCTATCTATTTATTTAGACATTTTCAGCGACAGGATCTTCAGGTGCTGCAGCCAGCCTCATACTCTATATGTGGCTGAGGATGACCACGAGCCCTCCTTAATCCTCCTGCCCTACAACTACCTCCCAAGTGCTGTGTTACAGGAGTGCACCACCAATATCAGTTATTATTTGAGATAAGACCTTGCTTCATAGCCCAGACTTGCCTAGAATTCACACTCCTCTTGCCTCAGCCTCGAAAGTTCTGGGATATAGGTGAACACTACCAGGCAGCTTATCCTAGACTGAAACTCATTATGTAGCCCAGAATAGCCTTGAACCTGCAATCTCTGTGCCTCAGCTTCCTGAGTGTTGGTATTACAGGCATGCACACCATGATGACTAGTTCACAGCAATGGCCCCTTAGCATCGTCACCATGCTTGTTTTCCATAAAAGAAATAGAGGTTTGAGAGACCAGTGTCTTGTCCAGGCAGACCCAGGGTTTGAAATCAGGTCAGTCTCACATAAGAATTCTACTGTTGCCCAGCTGTGGCAGCGCACACCTTTAATCCTAGCACTTAGAAAGCAGAGGCAGGTGGATCTCTGAGTTTAAGTCCAGCCGGGTCTATAGAGCGAGTTCCAGCAACCACATGGTG
GF3 -1 -1 1 CTGAATGAGCTTAGGATAGCTGTGGTGACG
GF4 -1 -1 1 GAATGAGCTTAGGATAGCTGTGGTGACG
EX52 -1 -1 1 GAGGAGCATTGGTAAGGAGGGCAG
EX32 -1 -1 1 GAAGTGACTGAAGAAGATCGGACTGGATGC
GR3 -1 -1 1 GTTGGTCTAATTGAGACAGGATTCATTGTG
GR4 -1 -1 1 CTCATCCATCAGAACTCAGATGTGCGCTG
Comments:
Created
Target: 2803Ensembl ENSMUSG00000030407 -- 19730009 -- 19732500 ENSMUSE00000198564 -- ENSMUSE00000235369
creating candidate regions
attempting to insert candidate regions into db
done inserting candidate regions
running aos on us and ds
running aos on gaps
finished running aos
AOS Produced 8 oligo candidates from u/d regions
AOS Produced 14 oligo candidates altogether
inserted results of aos runs
Aligned target to NCBIM37 assembly: chr: chromosome:NCBIM37:7:1:152524553:1, start 19730008: end 19732500
Found 5 RP24 black6 bacs on NCBIM36
Found enough RP24 bacs: not looking for RP23
D52:7:19729729:19729848_49 was rejected with 5 alignments
Entered all non-repetitive oligos
Sequence count reduced by 1 by bac-alignments
finished aligning oligos to bac
ACCEPT (0) gap pair G5:7:19738000:19738999_903 G3:7:19725509:19726508_284
REJECT (1) gap pair G5:7:19738000:19738999_903 G3:7:19725509:19726508_472
ACCEPT (0) gap pair G5:7:19738000:19738999_903 G3:7:19725509:19726508_668
ACCEPT (0) gap pair G5:7:19738000:19738999_186 G3:7:19725509:19726508_284
ACCEPT (0) gap pair G5:7:19738000:19738999_186 G3:7:19725509:19726508_472
ACCEPT (0) gap pair G5:7:19738000:19738999_186 G3:7:19725509:19726508_668
ACCEPT (0) gap pair G5:7:19738000:19738999_77 G3:7:19725509:19726508_284
ACCEPT (0) gap pair G5:7:19738000:19738999_77 G3:7:19725509:19726508_472
ACCEPT (0) gap pair G5:7:19738000:19738999_77 G3:7:19725509:19726508_668
DESIGN COMPLETE
U-type: U1
D-type: D1
Creating display features: mapping to reference assembly
Created display features
Inserted short and long range genomic sequence arms

webmaster@sanger.ac.uk

Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SA, UK  Tel:+44 (0)1223 834244