High Throughput Gene Targeting: Create Design

This custom vector design tool is provided by the EUCOMM consortium as a service to the research community. When using this tool, the user agrees not to submit more than five designs per day for creation without prior discussion with the High Throughput Gene Targeting Group at the Sanger Institute.

Design Type Oligo Select Method Artificial Intron Design
5' retrieval block size U block size Min 5' spacer Critical Exon Min 3' spacer D block size 3' retrieval block size
 
       
Subtype Domain Disrupted
Gene Build Gene
Start Exon End Exon
Target Start Target End
Primer Length Design Comment
Created by
Valid After Annotation
not done
oligos on fwd strand oligos as ordered View gene and design in Ensembl UCSC BLAT recombineering primers
Design ID: 55295
Chr: chr12-03
Strand: 1
Status: Ordered
BACs: RP24-445C11 : RP24-446B11 : RP24-257N4 : RP24-150K7 : RP24-114M14 : RP24-445A9 : RP24-529E5 : RP24-535K18 : RP24-140M12 : RP24-133P10 : RP24-477D24 : RP24-216E12 :
Instance: Plate 76: Well E05: BACs RP24-445C11 RP24-446B11 RP24-257N4 RP24-150K7
Oligos on GRCm38:
Type Start End Length Seq
G5 51350388 51350437 50 TATGGAAGTCGGTGTTTATTTTTTCCTCCCAAACAAAAAGTCAGTTTTTT
U5 51355369 51355418 50 GTGTATTTTATCTCAGCAATCTCTCGAGCCGTGGTGTATTTTATCTTTAA
U3 51355463 51355512 50 AAACCCAGGGACAGGAAGTGAAATAGAGACTGGAAGAATGTGGCTTTCTG
D5 51356162 51356211 50 GAATGATGACAAATGGCCTAAAGATATAGTTCCCATGTAAAATTACTTTT
D3 51356275 51356324 50 TACTTGTATATAATCTATTCTATCACATGATTGTCCCTGGAGTTCATTCT
G3 51361188 51361237 50 AGTCACTATTGAAACTTGTATTGTAAATTCTTATGAGGCTATTCCAAGCT
Oligos:
Type Start End Length Seq
D5_D3 52277832 52277894 63 TAAAGTTGTACTGAATTTATACATACAAATTCCATTTGCAAGATATATGAGTGTGTGAGTGTG
15_E_15 52261989 52292944 30956 CCCCTGCATGCTGGATGTTTCTGCAAAATAAACACTCTTTATTTTTGCATACTATTTGAGTCACGAGTCTTCCTTCAGCAATTTTTGAGTCCTTACACCTGTGTTTCTGGAATGCTGGGATTAAAGGCATCCACCATCTCACAGCTGGCTTCAAGGATTGAATTTTTTAATACTTGAATTTACCTTCCCAATTTGTCAATTCCCACAGTTACTGAAGCCTCTCCAATTGTTGAAGCCTCTCGTGGAAGCTCAGAGACTATTCTAAACTCATGGGGTTAACTATATTACACACTTAAGGGGATTAATGCATTTGATTACCCTAATTTATCAGGTGTGAGAGGCAATGGATTTAATGACTGTATAAAAATCTATTGACAATTCATGGAAAAATAAGAATAGCGATTATACTGGTCAGTTACTCTTAACATCTCTGGATAAACTGACAAAGGATAAGAATGAGTGCTGTGATAAAACTAATCAACTTTTAGCATCTTAGGGTACAGTGAAGGATAACAATGAACTTAGTGATAAAACAGGTGTTCGAGAATAGTCTAAGAGTTTCTAAGTATGCCCTGGAAGAGAATCTTCCCTCCACAGAGCTCAAGTTGTAGAAAATTAAACTGAAGCCCTCGGTTATAAAGTTGGCTAAGTTACAGTGAAAATTCAACCCCTAGCCTTGGAGGGTGTCAGCAGTTAAAGTAAGGGCATAAATGGTAAAGAATGGGATCCTGTAACATGGGATGCATCTATAGCCTCATGCGTTGTGCGCTACAACGGACTGAGGAAGAGAAGTCTAGAACCTGTTTTACTGATTGTTCTGCGTGTTATACAGGCACCACTCAGATGTGGACAGCTGCCCCATCACAACCCCTATCTGGGACAACTCTGAAAGACACTGGTAAAGGAAAAATTTCATAGTGGACAGACCTTCAGGCAATACACATAATCATACATTTTATTTTGAAGGAGAAATAGCCAGATGTGATTGTTCATTGACTCATGGATTGTAGCCAATGGATTGGCTGATGGCCATGAACTTGGAAAGGACATGATTGGAAAATGGATGAGAAAGGCATCTGGGGTAGATCTCTTCAAATGGGTAAAGGATGTGAGGATTCTTGTTTCCCATATAAATAAATGTTCATCAAAAGGAAACTTCAGCTGAGAAGTTCAGTAATCAAGTAGATAGAATGATCTGGTGGAAGCACAGTCAACCTCTTTCCCCAGCCATTCCTATCATTGCCCAGTGCACCCAGGAACAAAGAGGCCATGGTGACAGAAATGAGGGTTATTCATTGGCTGGACAATACTCCACTCATGGAGGCTGACCTGGCTATCAGTGCTGCTGAGTGCCAGATCTGCCAACAAGCCAAGACCAACAATGAGCCCCAGATATGGCACCGTTCCCCATAGTAAGCAGCCTGTGGCCCGGTGGCAGGTTGACTGCCTTGGACCACTTCCTCCATGGAAAGGACACTGTGTTGTCCTTACCTTTCCTGGATGTGATGTTTCTGCCAAAACTTGGATGTTTCACGGACTTACAGAATGTTTTATCCACCGTCATGGTATTCCACACAGTTTTGCTTCTAACCGAGGAACTCACTTCACTGTCAGAGAAGTGAAACATTGGGCTCACAACCATGGGGTCTGGTTTTACCATGTTCTCCAGCATCCTGGGGCAGCCAACATGATAGAAAGATGGAATGGTCTTTTGAAGATACAGTTACAGTGTCATTTAGGTGGCGGCAGCAGGGAAGGTTGGGGCAAAGTTCTCTAGAAGACAGTATAAGCTTTGAATCAACATCTGATACATGATATGGTTTCTTCAATAGTCCAGGAAACAAGGGGTGGAAAAGGGAACAGTTCCCTCACTGTCACCCCTCATTAGCCACTAGGAAACCTTTTTTGCTTTCTGTTCTGCTAGCCTAGATGTTTTGGTTCCAGAGCTGGGAATCCTCCTTCCTGGAGCCATAGCAAACATTCCATTGAACTAGAAGCTCAGACTTTTCCCTGGCTACTTTGGACTTCTGATGCCCTTAAGCCAATAGGCTAAGAAAGGAATAATAGTATTAGGAGGGGTGGTTGATCCAGATTACCACAGGGAGAATTGGATTGCTTCTCCACAGTGGAGGTAAGGAGGATTATGTCAGATCCGTTAGGTTAGGGCATCTCTTGAAGATACCACATCCTAGGATTAAAGCCTATGGGAAATTAATCCAGGCAGGATGATAAAAGGCACACAGACCCTTCAGAAATGCGTCACTCCTCTAGAAAGAGATCCAATGCCTGCTGAGGTGCTTGCTGAGGGTAGAGGAAATACAGAATGGGTAGGAGAGGAAGGTAGTTGTAAATACCAGCTAAGATTATGTGACCAGTTGCAGAAAAGGAGGATTATAATTGATTTGAGTGTTTCTGTTGTATTTTGTTAAAAATGAGTTTGTACGATACTTGTGTTTTCATTTCTCAATTACTTTATCATATGATGTATCCTCAATTAGGCATAGTTATGACCTGGTGTGTTGGTTAGTTTTGTGTCAACTTGATACAAGCTGGAGTTATCACAGAGAAAGGAGCTTCAGTTGAAATGCCTCCATGAGATCCAACTGTAAGGCATTTTCTCAATTAGTGATCAAGCGGGAGGGCCTAGCCCATTGTGGGTGGTGCCATCTCTGGGCTGGTAGTCTTGGGTTCTATAAGAGAGCAGGCTGAGCAAGCCAGGGGAAGCAAGCCAGTAAGGAACATCCCTCCATGGCCTCTGCATCAGCTCCTGCTTCCTGATCTGCTTGAATTCCAGTCCTGACATCCTTTGGTGATTAACAGCAATGTGGAAAGTGTAAGCTGAATAAACCCTTTCCTCCCCAACTTCCTTCTTGGTCATGATGTTTGTGCAGGAATAGAAACCCTGACTAAGACAAATTGGTACCAGGAGTGGGGTATTGCTATGATAGGCCTGACCATGCTTTTATTTGAAAGAATGTGGATTTTGGGACTTTGGATTTGGAAAGCAGTGGAATGCTTTAAATGGGGCTTAATGGGTCATCCTAGTAGAAATATGAAAGACTTTGTTGCTGGGAGTGATTTGAACTGTGTTGACCTGGCCCAAGAGATTTAAAGGAGAAGAATTTCAGAATGTGCCATAAAGATTGTTTTTGTGGTATTTTGGTGAAGAATGTGGCTACTTTTTGCCCTTGTCTGAAAAGTCTGCCTGAGACTAAGGCGAAGAGACTCAGATTAATTGCATTGACAAAGGAAGTTTCAAAAAAGCCCAGCAGAGACTTTGTTCTCTGGTTAAGTCTTATGGAGAGAAGCTTGAACAAACATAGCAAGCTTAGAAAGGAAAAATATAAAATATATGGTTTGAGTATTAAAGGGTACCAGGAAGTGAAATGGAGCAAAATCCTGTGTTCTAGGAGATAACAGATTAAGGGAGTGGGACCTTGGGGCAAATCCTACCCAGCTAAGTTTAGATCCAGGCATGGTGGTACACACCTTGAATCTCAGAAGAAGGGCATGGTGATCTCTACATTCAAGGTCAATCTACAGAGCAAGATCTAGAATAGCCAATATTAGGTAGTGAAGGAGTTGGAGAACAGAAAGCTGGTGTTAATGTAATAGAACAAGAGGGCCATGATCCAGCTCCTGCAAGCAGCAGAACTCTGCAGTTTCAGCCATGTGGCTCTGGCTTTAGAGTGAATAATAGAAGGGACTACTTGGACAATGATGCTGGTTAGCTGGAGCTAAGAAATTAGCGGTGATTAAGAAGAGACCAGCATTGCTGAGGTCAAATCTTCTGGGAAGTGTTTTCTGCGAGCTGTGTTTCAGAGATAGCCAAGGTTGTACCTCCCACTGCAGCTGTACTTGGTAATGGGAAAGAGTCACTAAGGTGGTACTGGTTTTGAAAGCATGAAGGGGTTATGAAGAGCAGCCGAGGCTTGGCACTGTGAGAAGCCGTGGAAGGCCATTGGTGAAGGTGCAGCCTCAGTTGCAGTTGATGGCCCAGGACTGAAGGGGTCATGCGGAGGATTTGAGGCTTGGCACCATGAAGAGAGCCTATGAGAGGCTATTAGTGAAGCCTAGTTGGAGTGGAACACCCCAGTGTATTGGAGATGTCAGTACCATGGGATGATCACCAAGAACAGCAGCCGTAGTGGACTGGATCAACCTGAGCTTAGAGTGCTACAGAGGGCAGAGCTGGAGAAGTGATGCAAGCCCTTAGGAGGAGTCCAAAAGATCAAGTGGAATCCAAGACACTGAAACAAGAAGCTGTAACACTGAAATTGCCTTGGAGACTCAATGATGTTAAAGATGCCAGAGTCATGGAATACATGCTGAGGAAAGCTGCTAACAGGGAGTGGAACCAGCCCAGGAGAAAGCAGTTTGTTGCAGATGAAAAAGGAGTGGATATCTGAAGATTGCTTTGACATCAGCCATGGAGATGCAGTGTTTGGAATTTGCCCAGCTGGTTTCCTGTCTTTCTTTGAGGATTACAGTTAAGAGATTGGATGAATCTCAGAAGAGACCTTGAACTTTAAACTTTTAACATTTTGAGACTGCTATATACTATGAGGACTTTGAAAGTTGGACTAAATGCATTTTGCATTATGCTATGTTTAAGTATGCCCCCCCCCCCATGGACTCAAATGTTTGAACAATCTTTGGGGGCCAGGGAGTGGAATGTGATGGTTTGTATATGCTTGGACCAGGGAGTGGCACCATTTGGAGGTGTGGCCTTGTTGGAATAGGTGTGACCTGTTTGGAGTAGGTGTGTCACTGTGGGTGTGGGCATAAGATCCTCACCCTAGTTGCCTGGACATCAGTCTTCCACTAGCAGCCTTTGGATGAAGATGTAGAACTCTCAGCTCCTCCTGCACCATGCCTGCCTGGATGCTGCCATGCTCCCACCTTGATGGTAATGGACTGAACCTCTGAATCTGTAAGCCAGCCCCAATTAAATGTTGTCTTTTTATAAGACTTGCCTTGGTCATGGTGTCTGTTCACAGCAGTAAAACCCTAACTAAGACACCTGGTTAAATACATAATGTGTTTGCAATTGTACATGAAATAGTTATTTTATGTTTAGGTGTTATGATGTCCTGGTTATTGTTTTCATTTGGAAATTAGTTAGCAAGGAGTGAATTTATGATGACTATTCTTGGTTGTCAACTACATCTGGAATAACTTAAAGCTCAAAGACGGAGGGCACCCCTGTGAGGGATTGCTGCTTAATTTGAAGTGGGAAGATCTACTTCTAATTCAGGTCTTTGAGATAGGAAGGCACACCTGCCATTTAGATCTTTAACAACGAACTAATCTGGTCCACACTTTCTGCTGGAGCCTAAGGACACAGAAGAAGGAAGCTTTTTCTCTTTTCCTGCTTGCTAGCAAGTCTATTCCTTTCCTGGCATTGGAGCCAGGATTCCAGTGTACGCTGAAAACCAGCAGAGACATCCAGCCTTATGGTCGGAGCAACTTAAGGATTCTTGACTTCTCCGTTCCTAGGCAGCCGCTGTTGGATTAGCTGGACTTCAGCCTGAAAGTCAATCTAATAAATCACCTTTTTATATAGATTCATTCTATAAATTCTGTAAGTCTAGAGAACCCTGACTAATACAAGGAGTATTCTCAAAGAAATGTGAATACACTGTACATTTTGGATTTCTGTGGGTGGGGTGGATTTTTGTTTTTGTTTGTTTGTTTTTTGATGGTGCCACAGATTAAGCACTAGAAAAATGCTCTATCACGATGAGAAACTAGGAGTTAGACACCCTGGTTGGCAGACAGGTAAGGAGCAGGCCAAGGGAAGGGAATATAAAGGTGGGAAATTTCAAAACAGCGGGCTTCTTCCTCGCCATCTTGATTTGAGGAAAGAACCCAGCAATTTAAAACAAAGGCCCTGTAGGCTTCCTGCCTCCTCTCCGCAGGCCCCCTGCTGAGAGACTGGCAGAACTGGTTCAAGGCAAGATCAGGACCGGTTACACCACAGTTGTGGGCTAATTAACCCCCCCCCCCCCCATGTGTCTGCTGTAGGACTGTGTGTGTTTACTCAATCCCAGGAACTGCCTTCTGTAGCTGATGCTGCCTCTGGTATTGAGATTTTTGTGATGCTGACAGTTATACTCAGGATTTTTCCTGCCTTTCAATTCTTTAACAGGAAGAGACAATGAACCAATCAAGACCTCTTGACTATATCAACTGAACTACACTGCCTACCCCAGAATATTTAACTTTTTTTGAAGGTCAGCTTGAGACTTTCAGTTCCCGAGAAAGATAAAACTTACTGGAGAGAAAGTGCAACGGATTGTAAAATACATAGGAACATTTATTTAGTTTCTGCCTTCAATATATATTTAACAGGTACATAATATTAATGTGGAAAATTAAGTAGTAAAACAAAAGAAGGGCAAAATATGTGGCTATATCATTCTCTTTTCCTGTTTGTTTTGCTTTTTCGAGACACGGTTTCTCTGTATAGCCCTGGCTGTACTGGAACTCACTCTGTAGACCAGGCTGGCCTCGAACTCAGAAATCCGCCTGCCTCTGCCTCCCAAGCGCTGGGATTAAAGGCATGTGCCACCACTGCCCTGCGACTACATCATTCTTAATTTTTGTTTTTATTTTATTTTATGTGTTCGGGTATTTTGCCTGCGTGTATGCACATCTTGTGTGCTCAGTACCTGAGGAGACCGGATTCCCTGAAACTCAAGTTCCAGGTTGTGAACCATCATGTGGGTGCTGTAATTGAATCCAGGACCAATGGAAACGCAGCCACTGCTCTTTGCTGCTGGTCCTTGTCTCCAGACCTTCAATTACTGTTGAACGAATGTAAACAACCTAGCCAACTAAGATACATTCACACATTCATTTACCCTGCCTGTTTCTGTATTTAGAATATATTCCATTCCTAACACAAATTTGGCAGTATCAAATAGTCTTAATCTGAATATTCAGCTGTTTATAACGTTAAAAAAAATTCCTCCCCCTTTTGCCCTCCCTATTTACCAATCACACTGCCAGATTTGATTAATTAGTACAGTTTGCTCTCCCATCCTGAAACTTTGTATTGCCACAGGCACACACATACATACTTCAAGAGAAGGGCATTACATAGTCCTTCTAAAGTTGGCTTCTTAGTATTTCAAAATCTTATCTTTGAACGCTTTCAGTATCAGCATACAAAATCCAATAGCTGAGGAGTCATACTTTATTGTTAAACATCATTTCCCACTGTTAAAAAACGTTACATCGGTTAAAAATTACAATCTACCTTCGTGTTAGGTATCTAGATTCTAGAAATCCAGCAAATCTTTCAAGTTGTGTTTTGAAAGGCGCTGAGGAAGCGCCGCTAGGATAAATCAAGTGCGAATCCGTTCTATCAGGTGTTAGTTGACCCGCTATTAATCCTAGCTCTAATGCTTACAGTTCTGATCTTTCAGATATCTGCCTAAAAGATCTAAATGCTTGTGGAAGTCTCTTAAACCCCCTCAAATGTAATCCTTTCAGAAACTCCAGACATCTCTGGGATTAAAATTTTCATTCTGGCCCTCGCTGAAGAAAACCGACCTCCCAGAGCCAAGCGAGGAACTTTTAGGACAATAGGGAAGTGTGATGCAAAAGAATTCCTTGCGGGAGAGGGCCGGGAGAATTCGCCTTCGCGCGCCTTCTCATTAGCATGGGCAAGCCTCCTCCCAGCGTGTGGCCTGTTGGGGGGTGACTGGTGCGCTCCGCACGCCTCCGCGGACGTGCAGGACCGGGAGTTGTTTTCCTGGCCGGGTCCGCGCAGCCACCCCTGCGCGCACGCCCGAACTTCATTCCCACCCCCACCCCGAAAGCCAAGGCGCAGACGCAGCCTCCCTGCGTCCACTTCCCCGGGGAGGGGCCGAGCAGCCGTGGGTTCCGGGTCGCAAACGGAAGTGGACGACGAATTTGAATTGTGCGAGCCGTTGGATGGGGCTGAGCGGGTTGGGCGTACGGCAGCGCTGCGGTCGACGTGAGCGGTAACGCGGCGAGCCTGGGACTTGTGCCCCGCGCCTGGTGAAGACGTGCCCGGGGACAGACGGAGGTGTCACGGGCGGCCGGGTAGGTGTGAGCGGTAGGGGGCTTCTCCACGCGCTGGACGTCCGCGCCCTGCCGCTGTCGAGCCCCGAGCTGCTCTTTATTAATTAAAGAGGGAAGGGGGGAGGGCTTCACGGAGGGGTGCCCGTTGTGGCTCCCAGTTGCTCTTGAGACCGGTCCCTCACCGCAGAGAAATGACAGCCTTGAAATGCCTCGAGGGGATTTAAGCTGAAATCCGAGTATCCTTTGTGTTTAAAACCGGGGTATTTTTCTTTCACACCTTGACACTTCTTGTGTACCGCAAAAATCCGAGCCCTATTGCTCATTTAAACTGGCTACAGTAGCAGCGGTGGCTCACAGATGTTAAGTTTGCTAACAATGGGGATAGGGTCTAGTGTCACCCCCAACCCCCACCCGTTCCGTCCCGTCCCCGCTTTTCACCCTCTTCATTCATTTGGTGATTGTTATTATCGAGTTATTTTAGAGGGACTCAGTGCCTCAGGAATTGAGTTTTCTTCGGGCGTTTTTGCTTGTTTGTTTTTTTGTTGTTTTTGTTGTTCATCTTTTATGATGAACTGGACTCTCACAAACCCCGACAAAAAGCCACACTTTTTTGAATAGCTGAGATGTACACGGTAAACATAAACTTTCTTTTGAAACAAGTTATATACTTTGCCTTATTAAAAACTGACAGGTTGCTTGTGTGTTTTGTAGAAAAAAGGTAACATCCTTTTAAGGTTTTACCAACTGGGTGACGGTGTCGTTAAAAATGCTTAAACATTTTAAAGTGGTACTTAGTAACATCCGAAGTAAGACCATTTCTTCATCCTCTTTCATGCCTGCTAATGAATGCTGTTTTCGATATTCAAGTAGGAAAAAAATTAAAAAGGAAGATCATTGAAAGTGTTTTCAATGAGTCTGCCACAAAGCTATTGGCTGGCCTTTCTCAAACAGTGCAGTCAGATCTGCTAGCTTCCTAAATGGTACCAGCAAGTAACCTGTTGTAGATTTTCTGTATCCTAATGTGCCTTTTGTTTGTTTGTTTGGTTGGTTGTGTTTTGTTGTTGTTTACCCACATCAGTAAATGTCACACTTCATTGTATGCATACTCCTTCCTATAAGGGCTCCCAAGCTGATGGCCTGTACTCAAACATCAGAGATTTTAACTTTCTAGAGGATGGACTTGGATAATGCCTTTTAACTGAAAAGTTAGACTAGTCTACCAGAGGTTTCAAAACATGGACTTCCTAGAACAACCTGGTAATATATTAGTTAAAGACATACAACTAGAACCAGACTTCTTGCTTAGAATTCCCATCCCTAGGACCTCATAGCTGTGTGACCTTGACTAGGGAAGCTGTTTAGCCTCTCTGATTAAAGTCTCTTAGGTAATGGGGATAAAGACTTCCTTGTGTGATTATTGTGGGAATTCTAGGAACTATTACATGTATGAGAACAAGATGCCAAAAATATAGCTACTAACCATGATGTAACTATAGCATGCATTTCCTTTTTTTTCCCCCTTTTTTCTTTTTTTCTTTTCAGTTTTTCGAGACAGGGTTTCACTGTGTAGCCCTGGCTGTCCTGGAACTCACGCTGTAGACCAGGCTGGCCTCGAACTCAGAAATCCGCCTGCCTCTGCCTCCCGAGTGCTGGGATTAAAGGCGTGCGCCACCACCACCCGGCACAATGTCTTTTTTTTTTAATTATAATTATTATTTATTTAATGTATACGAGCACTCTGTAGCCTCCCAAGTGCTGGGATTAAGTGTGTGCGCTACCATGCCCAGCTCTGAGTTATGTTCTTTCTTTATGCATCCCAAATGTAAATCCTTTGTCAGATACATTCAGCAAATGTTTTTTCATTGCACATCTTTCCATTTTCTTAACTTGGAAAATTCTTCCTTTGTCAGGATCAAAACTAGTTTTTCTCTTAGAGCGTTAATGTTTTTGGTGTAGTTTTTCTGTATGGAAGTCGGTGTTTATTTTTTCCTCCCAAACAAAAAGTCAGTTTTTTCTATAGTATTTATTGGATAGATTGTCACTTCTGGAGTTTAATTACCATCCTTTCTTTGCTGGGTAGCCATTAGGCGGAGTGGGAGGGAATTCAGCTTACTGTTATATTATCCATCTATTAACACTCTAAATCACCTCTGGAACTCGGTTTAAAATAAAACAAAAGTTATGGTAGTATGTCTGGATCAAGAATTAGGGACCACCTCAGGGCCTCTCTGAAGTTACATCAGACTCTGTCACCAGAAGTCTTAGATGGCAGCTTGTGCTTATATCATAAAGCTCATGTCTAAAGTACTGCATTCCATACTGAACAGACTTCTTCAAGAAACGTCTTGGAAGTTCTTGTCATCTGGCAGTAAGCTTCTAGACATGACCAGAGAATAAGAGGAGGTAGCGCACGTTTATGACATGGCAGTATATAAATTATAAGTGGTTTGAGCACTGCTGAGCAGGACAGTATGGCAAGTTCTCCAGGCACAATAGAAAGTCATAAAGTAGTGTTGTACAGGGTACTAACATGGGAGCCGAATTGCTCACAGGATGCCAGTGAACAGGTTTTCAAATTAAATAGAGTGCTTTGTTTTTCACAGGAGTTGCAGTTCTGGACAAACACAGTCCTAACATAGCCAAAGAAAGGGTCAAAGGAGAAGATGTTTAATGGGTATTGGCTTAATATTTATTCAGAAATGTAAGAGTCCAGGCAGTTATGTTGTGTAGGACTTTGTGGTGCACCATAGGGCATCTCACAATCTAGTACTTAAATGTTTTAAGAAATACTCTCTCCAGTATCTTCAAATCTGCCACTCTACTTGAACTACTACTTGTTCCCAAGTGAGGAAGTTACATACTGTATTATATAGTATGAAGTGATTATTACCTGATTATACTTATATACTGACTAAATTTAATAAAATGGTTAATGTGAGATTTTTGAAATTAAGATATCAATATGCTTTTATTTTTCCTAGTAAAATGAATGAAAATAAACCTGATAATTCACAAAGTCTTGGTAAGTAACTGAATTTAAAATATTTGTATTATAATAAAATCCATTTAGAATGCTATCCAGCCAGCACGAATGAGTATTCCGATGTATGCTTAGTTAATATGTTCTATTAAATTATTGTGATTATGTTCATTTCCACAAGCTAGATTTGCTGCTAGAAGACATCTTGTCAAATTTATTTTTCCATATTTTATAAGATCAGATATATTTTGAATCTGAGAAAACTTTAATTTTTAATGGTTTTCCCTTTGATAAATGAGGCCAATGAGTAGACAGAAGTCTAACGTGAAAAGGAAAATTTCTAAGTTTACAATTTTCCCTGTTGATACATCGCTGTTTTAGAAACAGAACCTGTTGACTTGCTACCATGAATGGTGAGGAATCTAAATGATTACTGTAGACTTGGATGCACTGCTCCTCCACTTAGGCTTGGTGGGGCTCTTACTTGTTTGGTTTTGAGACAGTCTCACTATGTTTTTTTCTGACTAGCAAATGCAATGTGCTCACTATGTAGACCAGGCTAGCCTTGAACTCGAATCCACCTCCCTCCCTTGTGCTTGGATCAAAGGTGTGTACCACCATGCCTGTGCCTAGCTTTTTTTTTTTTTTTTTTTCCGAGACAGGGTTTCTCTGTGTAGCCCTGGCTGTCCTGGAACTCACTCTGTATACCAGGCTGGACTTGAACTCAGAAATCCGGCTGCCTCTGCCTTCCGAGTGCTGGGATTAAAGGCATGCGCCACCATGCCCAGCCTCATCGACTCTTGAACTCCTCTATTTGGTTCAACTGGCAAGGAAAGCATCCAGGTTTCTGGCCCTTGGCACAGGAATTATAGACATGCACAGTTGAGTCAACCTTTTTTTTTTCCATTTTCAAGACAGGGTTTTTATATAGCCCCGGCTGTCCTGGAGCTCATTTTGTAGACCAGGCTGGCCTCAAACTCAGAAATCTGCCTGCCTCTGCCTCCCGAGTGCTGGGATTAAAGCCGTGTGCCACCACTGCCCGGCGAGTCTACCTTCTTTATCTGTTGACTCTACCTTATTTTGAATAAGGAATTTTGCTCCTACAACTCCTGCACCCCATATACCTGTTGTCTTGTTATGCCTCCTGATTATATCAGTAATGCCAGGAGTTGGGAAATGTTGATGATTTATGTAATACCGTTGAACATTGGTTGGATGTCTTCTTATCCCAACTTAATTTCCCACCAGGTTAATGCCTCTAGTCTTTACTTATATTAGTGTGCTTAATAGGAACCAGTATTTGCTGTCGTAAAAGGTAATTTTAACAGTAAATATAGTGAATTAGAACAGTTTTAATGAATTTTAACTAGTCTGATATAAAAATTAGAAAGTTTGTTATAAAGATGAATGCTTGAACCATTATTGATTCAAGGTCTTCTTAGTATTGGGTTGGATGTACCTCGAGATCCTTCAGCAGCCCAAGTTTGTCTTTCTTGTATTTTTATGAGCTTGGTCTATGTGTGCACATAAGACCCCGGTGCACTTTAATACATGTGTGAGCTTTTTAAACCCTTACTCCCAGATAGATCCATTCTTCCCAACTTCTAAACCAGGTTGGTTTTAGCCAATCAGCTGCGTGCCCCAGACTTTTACGACTATGGTTTGTTTAACCCTAAGAGAATTCTGATGCTGGTAAAAGAAGCAGGCATTTGCCTTCATCCCTTAGGGAGTTACCACATAGGTGTAAAAGCACAACCACCTTGATCTGGGAATGAGGTCTGAGTCACTTCCTTTTAGTCTAGCAGTCTGTTACCATAGACATGAATGAACCAACCAAGGACATCGAGACAAAATTGATCTGGGGATGTGCAGCAGCCGGTAAGATACTCGTCCTGCTGGTCTGAATGCTTGAGTTCCCGTCTCTAGAACTCACATAAAGTTGGGCATGATAGCACATGGCTATAATCCTAGTGTTCTGGGAGTGAGGCATCGGCTGGACACTCCCAGGAAGCCCGGGAAGCAGCTAGGAAAAGGGACATTAAAAGACATGAGGTCTCCTGACCTCCAGATGTGACCCATGGCCACTGGTCACATGTGCACACTTGTGCACATGCACATACACTTAGGAGAAGCACTAATCCTATACATTATTTTGTAATTTTAAATTTCTTTTCTTTTTTCTTTTTTTTTTTGCTGTTAGCTTGTGTTTTCTGCCGAAAAAATGATGACTGTCCCAATAAATACGGAGAAAAGAAAACATATGAAAAATGGAATTTTAGTGTCCACTACTACTGCTTGGTAAGTCAGGTGGTCTGCATTGCCTCATTGCTCATGTATACATCTGTTAATTCCTACCCGTTTTGGAGTGTATTTTCTAATTGAGAATATATTCATAGTTAATGTCAAGTGGAATTTGGCAGAGAGGTAAAGAAGAAGAAGGAGTTTATGGCTTCCTAATAGAAGACATCAGGAAGGAAGTCCAGAGAGCCTCCAAACTGGTAAGTACTTGCTATTCAGTACGCTGGGTACCACAGTGCTGCTGCTGCTGCTGCCTTGGGAGGGTTCTTCAGTCAGTCTGGATTAGAAACTTGACTACAGTATCTTATTCTGATGGATATTGTTACCACATATGATACGTTTTATTAAACATTTTTATATTTTTACAAAGAAGAGCTTAACCTACACTGAAAAACAGTTTATCAGGAGGGAACTTCTGTTCATTATTTCACTCATTCTCGGTTTGATTTAGTTTTTGAAGTTGGTCTACAAGCGTTGTTCTTTTTTTCTTCTTTTTTCTTTTTTTTGTTTTTTTGTTTTTTTGTTTTTTTTCGAGACAGGGTAACAGATGGGGAAGTATCACTAGTTACAAATGACCTAGTTTGTGATGCCCTGCAATCTCTAACATAGTCCAGTTCTGCCCAGCCCCATTCTCTCAGAAATAAGACTCAGACTCACAATAAATTTACAGTGGTCTTATTGCTAGGCTCTTCTCTTACAAGAATCATAACTTGCCAGGCAGTGGTGGCACATGCCTTTAATCCCAGCACTTGGGGGGCAGAGGCAGGCGAATTTCTGAGTTCAAGGCCAGCCTGTTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAGCCCTGTCTTGAAAAAAACAAAAATAAAAACAAACAAAAAAAGAATCATAACTTAACCCATTTATTTTAATCTCCATTCTGCTGTGTCTGGGGTTCCCTGTCTCAAGTACCATGTGTCTGTCTCCTCTCATTTCTTGGGCAACTCTCCTGCCTGGCTCTATCCCAGAATCCTTCTTCTTTCCTGGATGTCCCACATCTATTTCCTACCTAAGCCATAGGCTTTTTTATTGACAGGTGACGAATCAGGATACAACATACAATGTATCCTCTCTACAAAGTAATATATTTCTCTCCCCTGTCACTGTAGTCCATCTCAATGTGTGCCAGTTGTAAAAAGTAAGGTTGCTGGGAAAAGAAAGCCGTGTCACTCATGAGAACTTAACACAGAATACATAGAGAGGAAGCATTTATTTGCTGGAGATGGTCACTATATAAAAACGTTGGGTGAGTGGTTAGCATAAAGGGAGCCAGTGGTGAAATAGGATCTGGGGCTCTAGAGGAACATGCTCTGAATGGTTCCAGTAAACCAAAGGACTTGGTAGGGATGCAGTGTCAAGATTCCTTAACATCTTAATAGCAAACTTGGAATTAAGAGGAATCCTCCTTACAAGTTTTGGTAGCTGCTAGTTTTCTTAATATATACAAATTCTCTGCGTGCACTGTGAACCTTTGGGAATATTTGCACCTGAGCGGAGTGCTCCCACACCAGAAAAAGGTATCAGATCTCATTACAAATGGTTGTGAGCACCATGTGGTTGCTGGGAATTAAACTCAGAACCTCTGAAAGAACATGCAGTACTCTTAACCACTCATCAATCTCTCGAGCTGTGGTGTATTTTATCTCAGCAATCTCTCGAGCCGTGGTGTATTTTATCTTTAATTCCCATGATTCAGCCTTTTGTTGAGGGAAGGTTCTCAAGACAGAAACCCAGGGACAGGAAGTGAAATAGAGACTGGAAGAATGTGGCTTTCTGGCTCGCTGCCCATGGCTAGCTCAGCCGGCTTTCCTATACAGCCCAGGACCGCAACGCAGCCACCGTAGGTGGAGATACCACACACCCATCACTCACTGATGGTGAAAATACCCCCACAGACTTGCCTACAGGCCAATCTGGTGGAGGCATTTTCTTAATTTGAGCCTCCTTTTCTCTAATACTAGACTGTCAAACTGACAAAAAAGGAAAAACTACCCAATACAGATCTTAAAACTTTGTCATTTGGGTTAGGATAGAATATATTATAGCAATAATTTTCAGTCTTTCCACTAGGAACACTCATTATTTTATCAAACTGTAGTACTGAAAGTTTTTTTATTATACTCCTGTTTTCATATTTCTTCTAGAAGTGTACAGTTTGCAAGAAGAATGGTGCTTCAATTGGATGTGTGGTACCCACGTGTAAACGAAGTTATCACTTGCCTTGTGGACTTCAGAAAGAATGTATTTTCCAGTTCACTGACAATTTTGCGTGAGTTATTTAACTGCTAATTAAATACTAAATATGAGGAGCTGGGAGAATGATTCAGCAGTTCAGAATATTGGCTCCTCTTCCAGGGGACCCAGGCTTGGCCTCCAGCACCCACCTGGCATCTCGAAACTGTCTGAAACTTTTGTTCTTGTTAAAGAATGATGACAAATGGCCTAAAGATATAGTTCCCATGTAAAATTACTTTTTAAAGTTGTACTGAATTTATACATACAAATTCCATTTGCAAGATATATGAGTGTGTGAGTGTGTACTTGTATATAATCTATTCTATCACATGATTGTCCCTGGAGTTCATTCTATCTGGTGAAACTTGAGTTGCAAGGCTATCTGAGATGGACGCCAAGATTATTACTCACATTCAGCCTTCAGCTCGAGGATGAACTTTTGATTTATATTTCTGTGAAACATTTTATCACTCAGTTCAGAAATTAAATTGCCTTATAAACTTTGTTGAGTTAAAAAAAAAAATCAAACTTACTATGGCGTACCCCCTGAGTACAGCTTCAAACAAGAAGATTTTGTGAATTTTGGCATTTGGTACCCTGAGTATTTCTTGAGTTTTTTGTATTTCTATTTATATAATGGTTAAGCAAAATGGGATATAAAGGAGCCTTAGAGAATACAAAGGAAAGAAGAAGATTAGGAACAGTTTGTCACTTGCATGTGACGTGTCACATGATAGATGTTAAGTTCTTTTAAGTTAGGTGATACTGAATACAGTAGTGTGTGCTCCCTGGGTACGAGGGTAAATAGACTATTAGTAATTAGTCCAGTAGTGTGTGCTCTGCTGGAGTACAAGGGTAAAGGTCCTCTGTTACTAACAAAATACTGATACTAGTCTTGAGGGAGTCTTACCTCCCAGAGTTTGTTTCAAAGCATTTGGCTTTCCTTGAGTACAGGATGCTAGACTATAGGGCCCACATATGTGAAACAGAAGAGATTATAAACTGAGTTGTGTTTTTCTCTTCCTTATATATTCTTTACAAATTTCTACTTTTAGGTCATTTTGCTGGAAACATCGACCCGTTCAAGCAATTACATCTAATAAATATAGTAGTTCTTTACCATGTACTATCTGTTTGGAATTTGTCGAGCCTATTCCTACTTATAACATACTACAAAGTCCCTGTTGTAAGAATGCTTGGTTTCATAGAGACTGTTTACAGGTAAGATAGCTTTTTAATCTTTGACTCCATAATATAAAATCTATTGCTTATCAATTTGAATTTTAATCTGGTGTCATGAAATATATCATAAAATACCAGTATTCCTCTCTTGGAGCCTATTACACTCTTGGGAGCTCTCGTCTCACTTCTTAATCTGTGTTTACTCTGCTCAAACGAAGAAACAGTATCCTAAAAATCAGAGGTCGGCTCCTCATCGAGTGTGTGTGAGTCCCCTTGGATTAATACTCACTGAAAACAGTCCGGTGGACTGCATTCTCAACTTGATTGAATGGCTTTATTTAGAACATTCTTATGGTATAGAAAGTGTTGTTAGTCAAAACCAGGCCAAATAAAGATTTACTTAACTTTTTAACTTGCTTTGTAAAGCTTAGATCTTGGTTTGCTTAGTAAAATAAAATGGTTTGTTATTAACTGTTCAGAGTTATCAGATATTAAGTTGCCTTCTATTTCAAAAAAGACTCAATGGAGCTTATCTGATTTCTGGTTTTGTTTTGTTTTGTTTTTAATAATCTTAAACTTTTATACTTCGGTTATTCAGTTAGAGGTGATAAATTGGAGCCTGTTTTCTTGGAAATGTTTGCTAATTCTCCATACAAACGTATGTTTTAGAGAACAGTTAATAACCATCATGATGTGCAATTTAATTTTATGTGAGAGCCTTTTAAAAAGGAATATTTCTTAAAGATTTGTGTTTAACGGACTTTAATTATTGATGAGTGTGTCTTAATTTTATAAAGATTTGCTTTGTATTTGTTAATAATAAAGTAGAGAGAGTTCTTAGATTTGGCCTAATGTTTTCATGAACTCTTTGTCATTTAAAACTAGAAGCATTGGACTGGGATCTAGCTCCTTATAGAATGCCTGTCTGTCTGTCTGTCTGTCACACAGACACAGACACACAGATACACACACACAGACAGTACTATATAGGGAGAGGGAGGCAGACCGTAGAAATAATGCTAACAAAAAACTGTTGTTTTTATTTCAAAACATTAATTCAGAATTAAATCCACATAGCAACCTGACGGTTACATAAATGTCAGTAGGAGTTGCTATAATTAGAACTTGTTAATTCTTCAGTCACTTTCTCTTAACAGAATCTATAGAGACTTTTCCACTCATGATTACAGAACCTAACGAAAATCTGAACTAAACCCACTCTGGCTTACAGTATATGGCTAAACAATATTTCTGACTACTTTGATTACTGCATGTAGAAATTTTGTGAAAAGAGACTAGACATTAAAATGAAAAGAGTGCTACTGCCCCAGTTTGGATCTCTCTGTCATGGTCTGGTATCCTCCAAATGTTTTGTGCTTGCTGTTCAACCGGTTTTGTCTCTGGGGTTGTTTCTGCTTGTTTCATTTTCTATCAGATATGTCTTTGTATTAAACCTCATGTTTAGTAAGATACCTTCTTTTGTCTGCAATGAGTTACTGTTGCAATGTAGTACTTGGTGTGTGTGGGTATCATTTGCCTACCATCCTCTTTCCTGCTTTAGCATCCATCAGCTGTCCCTTCAGCTGTATCAGTCCACCTTGTATTGTGTGTCCTTCTCTCTTGTAACCACTCACTCGCTTCTCTAAAATACCAATTGGAATTCTAGGTATATTATTTCCTATCAGTTATGCTATTCTTAAAGCATAGTCTTTCTTCTGCATTTGATTCACCTGTTTAATCTTATTAATAGTTCAATTTGCCCAGAATGTCATATCAAGATATATTGTCAATTCTAATTTTCCTAATTGCATGTTCTCTGTCTATCCATGGATGTGGTCCTTGAAATGTCTTCCTATTTTCCTTTGTTTCTTCTAAATGGGTTTTTTTTTCCTCTTTCTTCATGTATATACTTTAAAAAAAAATGGCACTTTTAAAGCTAGGCATGTCAACACAGTAGTACTAGGCAGTAACTTCAGCATAGGCCTTTATAGGATGGTAGTGGAAGGGTTCAGAGATAAGATTCTTGGAGCTCATTTCCCAAATCAGTCTAGCTGAACAGATGAAAAGACTGACTTCAGCCTCTGACCTCCATATGCACACCCACGCACACTCAGGAAGACAGACATACACTACATACACATATGAATAATACTTTTACACATCTATGTTTGCACACGGTAGATAACATTTTCTGAGCAGGAAGCAGCTGCTCCAGGCTCCTGCTCTGAGTTTCTTCTCTCAGTGATGGTGTGACCTAGGAGCTGTAAGACAAAATAAAAATAAACCCTCCTCTTCCGATGTCAGTGTTCATGAGTGTTTTCTTAATAGTGACAGAAAGCAAACTAGAATAGTATTAAAGTTTATGAAAGCAAATTGCTGACTGCTGAAAAGGCAAAAATCATGTATTCATTAGATGTTTTTAAACTGAAAAAAAGAGTTGTCTTTGTTTTGAGTGGCTTTGCTTATCGTTCTAACAGGAAATATTCTCATGATACAGAAAGGCAAAGAGCATGTTCTGTTAGTTATTTAATTCACAATCTGATGAGAAATGCATTGCTAACAATAGATTTTCCCATTTTTTGCTGTAGGTCCAAGCAATAAATGCAGGAGTGTTTTTCTTTAGATGTACACTATGCAATAATACAGACATCTTTCAGAAGGAGATGTTGAGAATGGGAATTCATATTCCTGAAAAGTGAGTAACATTTGGCTTTTTGACCAAAAAGCATTTAAATGTAGTATTTACTAACATTAACAATGACTGTGTGTGTCTGATTAGTGATTGTGGCTAAGTAGCCATGCTGCATTGAGTCACATGCCTCGTCCCAGGTGGCCAGCTTTTGGAGAATGTGCACTATAATGACAGTACCCAGTTAGATGCTGTGTCTCCGTCCAGTCCAGTTCTGGGTGATTTGTATAGCATCTTTAAGTGATCTGAGCCAGGCTAAATGGGTTTAAAATGGAAAAGGAGAATTTTAGTAATGCCCCACGGAGAGAAATCCTGAGTAGTGATAGCAACCTTGAGAGTAAAGCTTTGGATGCCCATCCTTGAGAGGCTGAGGCCCCCATGGGCTGGGAACTGAGTTCCAGGGTTGCCCAGGCTCCAGTCTTGGGGCAGAGAGTGAGAGAAAGAAATAGCAAACAAACATGTATAGTCCTAGCACTTGAGAAGCTGGAGAAAAGCTTGAATTTGAAGCTAGCTTAGAGTGTAACAACAAAAATTGAAATACTAGAAAAATGTAGGTTTTAGAAAGTTTGTTCAGCTTCTCACATAGTATTTGAAAGTTCACTGTGAAATTGACTATAAGGGGGCTGGAGAGATGGCTCAGCGGTTAAGAGCACTGACTGCTCTTCCAGAGATCCTGAGGTCAATTCCTAGCAACCACATGGTGGCTTACAACCATCTGTAATGGGATCTGATGCCCTCTTCTGATGTGTCTGAAGAAAGCTACAGAGTGCTCTTATACATTAAATAAATAATAATTATAATTAAAAAAAAAAGACATTGTGCCGGGTGGTGGTGGCGCACGCCTTTAATCCCAGCACTCGGGAGGCAGAGGCAGGCGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAAAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTCGAAAGACATTGTAAGGTAAATTAACATAATGAGTTTCTGTGATGAAGAGATCAGCCTAAAAATGCTAACTTTAATCCTTGTCTGTAAATGACCTGTTAAACCAAAGCACACTTTATACCTCCTCTCATTATAGAGATGCATCCTGGGAATTAGAAGAAAACGCGTATCAAGAGCTGCTGCAGAGCCACGACCGCTGTGATATTCGAAGATGTCACTGCAAAAAAGGCCGAGACTACAACGAACCTAACAGGTGATTCTGCAAGCTTATGTTGAGTTGTCCCTTCCTGAGATTTAGCTAAGAAGGTTGCTTTTCTGGTGACTTAGAGGATGCTTGAGGCTTTAACGTAAGATTGAACATGTTTATTTAGTGTGTAAGCAGAAATACTTTGTAGTCACTATTGAAACTTGTATTGTAAATTCTTATGAGGCTATTCCAAGCTGAGGGGATGTTGTAAGTGTAAGTTACACAGAGCTCCTCTAACAATGCACGGAAGATTGTTCAGAGGCTAGAGTCCCAGAACTAGGGCCTTGTGACTGATTTCTCAAGAGTTGTCTAGAGATGATGCAGGTGTCTGTCTCTCCACTGTGGTTTTCTCTCTTGTCTGTGGCCTATCATTCTCTCTCTAAAAACATGTTATTGTTCCTGTTCACATAATCTTATCATAAGAGGCATAGAGTGAAGGAGACTTTTTTTTTTCATAAAAAGTGGTCTCATGTATCATGTTGTGGATGTGATAATCTCTGAGTGCTGGCCAGCTTTTGAATTCTTATTTTGTATTACTATCATGGTTTAACCTTTTGTCTCAGGACACAAACAGCTGGTACCTAGATGTTTGCCTCAATTATTGTACACTTTGCATTCTAATGGTAAAAGGCAGCTTAGGATAGTAGCTGGACCATGGGTCTAAAATCAAGGTAAAAACTTTGTGGGAAACCTTACTCTAAGGCATGCAGCAATATATTAGCTTAGGGAAATTAGCCCTGTGTGATTAGGTTTCCTCCTCTTAAAGAATAGTGCTTCTTTCTTCTTTCAAAATTGGGAGAATCTTAAAGAGGGCCTTGTATGTAATAAACACTTATTTTCACTGTCTTTTTCCTCATTGTGAGTGGGCAGAACTATCTTTTAGAAGAGAGTCAGGCACTTATGCCCTATCCATCCACACTCTCAGGAGAAGATGCCCACACATACAGGTGTTGGGAGAATATCTAGCACCTAACTGCCACCAATATTTTCATATATTTAGGGAATATATTTGTCTCTGTGCAAAGATTGTGTACTCATTCCCACACAGTGTGAAAGAAGCATCCTGCCTATTACCTTTATGTGTGTTGAATAGTTTTATGTCAGCTTGACACAAGCTAGTCTTCTGAGAGGAGAGAAACTCAATTGAGACAATGCTTCCATAAGATCTAGATGTAGGCATTTTCTTAATTAGTGATTGATTTGGGAGGGGCCAGTCCATGTGGGTGGGGCTGCCCTTGGACTGGTAGTCCTGGGTTCTAAATGAAGGCAGGCTAAGCAAAATATGAAGAGCAAGCCAGTAAACATAACCCTTCCATGGCCTTAGCATCAGCTCCTGCCCTTGGGTTCCTGCCCTGAGTTTCTGACCCATGTTCTTACGGTGATGGGCCCATAAACCCTCTCCTCCCAAAGTTACTTTGGGTCATGGTGTTTTACCACAGCAACAGAAACCCTAATATGCACCTGTATGGGAATGTATATGGATTGTCCTGTTACAGGGCACAATGAGAGATGGAGGAGCAAGAGTATGAATCTGAGCCAGGAACAAACTATAGATCGTGCTATGCTGCACAGCGCCTGAAATGTCACAGCAAGGTTTTTTATTTGTTTGGTTAAGGATATATACTGTGTACCTTGATGCTGCAGATCAGATACTGCTAATACTTGATGCTTCCATATCAGACACAGTGAAAAAGTAGTCTCTCTGTAAACGCACTGTCTCAAATGTAAAGGAAAATATTTTTTTCTGCTTATCATAAGCCTCTCTGATAACTACAGTCTTTGTATATATGTGTGTGTTGGTATTAGTTGAGGTTTTTAAGGATGTTTGGAGGAAGAGATTACAAACTTAAAATGAGAAAAAATACTTTAGAGTCAGGTGTGGTGAGGCATGTCTGTAATCACAGCACTTGGGAAAATGGCCAGCCTGGGCTACATAGTGATTCCAGGCCAACCTGGACTAGAGTCCAGACCTTTCCTAAGTCAGTCAGTACTTCAGAGGGGGAAATGAAATCATATAGTCTTTCCTTCCTTTGGTAGACTGGTTGTGGTTTATAGCAGTGGGCTGAACTGTAGGCACAGCTAGTGATCTGACTGTAATCCAGCACTAACAGAACACACATCTATACTTTCCTTTATGTCCTCAGCAAATGGGAAGTAAAGCGGTGTCAGAGTTGTGGTTCTAGTGGAACACACTTAGCCTGTTCCTCACTACAGTCTTGGGAACAAAATTGGGAGTGTTTGGACTGTAGAAGAATTACCTACACTTCAGGTAATAGTTTGTAATTTTGAATAAAGATGCTTCTGTTCAAGTGCATGTTGTTGAAAATGTTTTGCCTATGTTTTTATTGAGCTAACTTCGAGATTTAAATATGTAGATTTCCAAAAGGCCCCCAAACACCCATTAGCCAACTCTACTAATGTGACAGTTACTGACTGCTTGTTGGAAGAGTCATCATCTAAGCTCCCCAGACAGTCAACTGTAGCCCAGCATAAAGAACTACTGAGGTAAGTAAACATAAAAATCACTTTGAAGAAAATTATGACTTCAGATGCCACTCGTACACAGGCTATTGGCTGATCATGCAATTATTTAGAAGAATGAATTTTCAAACTGTAGGGCCTATCATGGGATGCAAGAAGTCAGGGAAAGGTGAGGGAAAATAAAGTAGCTGAGGGTGCTCACATAGCTGTAGTTTGAATTGGAGACCAGCTTGAGGCATGAGGATCTGTGTCATAAAGGAAGTTAGGGAGGAAGAGTGAAGGGAGGGAACTGGGGTGAGGACAGCAAAATGTCAGGCTACATTAATCAATTAGAGTCTATACATTAATCTATACTGAGTCATAATATAAAATAATCTTAAAGATATAAACATCATAGAAAAATATCTTTCCAACATTACTTGATTCCAGACTAAAGCAAGAAATTCAGTTATCAACCACAGCATGTATTTTTAGAAGACAGTCCTGTTTAACACAAAGGTTGGTTTTTGATGCTAGAATCATTGCTTGCTTTCTATATATAATCAATGTCAGGAGCCTTAAATGTCAGCTCTTTCCCTTTAGAAACTCAAGGCTTATCTGTAAATATTATTGTGCTTATTTATTTCTACTTCCACAAAGTTCTAAACTAAGTAATTCTAAATTTTATGTTTTATCGGGTATATTTTTATAGTTATGATTTTTAACTTTGCATAACTAAAAAAAAGTTGGAGTCTTTGCACTGTAGAAAAATGTAACTGCATGAAGTTCTTTGTTGTAAAAAAGGCTTTAAAACACAAAAAAGGGAATTTTTTTGAAAATATTTGATAATTCTGTTTGCAGAAAAGTAGACTATTAGATACTTGCCAAAAAAGTGACTTACTAATTCAACTGAAAAGCTTCTTACAATAAATTAAGTACTTTTATTTTAAAAATGATTCATTGTTTTATATTTATATAGTTTGAAAATAATTTTGATGTTTAGCTTTCCAAAGATGTTGCACTAGATGAACTTGACAGTTTGTTTCTGTTTTAATGTCCAGTCATATGCCTGAAGAGTAGCACTGACATTTTAAGGAGCAAGAACTTAGCTGTTATAATACCATGTGTGTGCAATGTTTGGGGTAGGACAGTGTTACAGAGAGATGATCTGTGTACATTGAGTCCATTACTTCTACCTGCAGATGGAAAACCTGAGGCAGCAAAAAGCTCACTCATGTGACCCATGGATGTTAGCACACAGAGAGTGGTTCGGATTGGAGCTCAGGGATGTTTATTTGTAACTCGCTCATGTATGATGCTGTTGCTCTAGGACCACACATTTAAGAATTGTTGACCTAGAGGGTCTAGACTAAAATTTAAGTGAATGTGAGTTCTGTTGCTAATATTAGCTGTATTATCCGTTAAAGCTTCATTGTAGATAATTGTTTTAGTTATTGGCAAGGAAGGAAGCAAGAATTCAAATTTTATACCCTTAAATCTGAGTCCACATTAGGCATTCAAATAATCTTCAAGTTGCTGCAAATGATCATAAGTCGGTAGATAGTTAGAATGGGGGAATTTAAGAGTAGATAATCAGATAAATGTTTTTGGTTTGGTTCCAGTATTATAAAAAGAATATCTTTTTAAAATTAAAAACCGAACAAAACAGACAAACCTACAACTTTTAATGCTCTATACCTGCTGTTTCACATAAACTCCTTTAATGTTCTTTATTCAAATCTGTATTTTATAGGCAAGGCAGCAAATTTAGGAGAGACATTTCAACAATATTGATAGAGTTAGGATTCCAAATTAAAAAGAAAACTAAGACATTATACATCAACAAAGCCAATGTGTGGAGGAGTGCCTTAGAGCAGTTCCAGAGCCAGAAGTTTAACCCTTCATGCTCCATTGACGTAGTGTATGTTAATGGCAATGAGGTTGGAAGCCAGCATCTTGGATCAAAGCAGGAATTTCTGAGTCACTTAATGCACCATCTTGAGAATTCATCAGTGTTTGAAGGGTCCTTGGCAAAGAACTTGTCTCTAAATTCTCAAGGTAATTATTTTTATTATTATACACACTGAAGGTAGTATGTGTAGCCAAAACCAAAGTACTTGGTTTGAATATTCTTTAGGTATATCTGGAATAAATAATTTACATTTGTCGGTGAATCGGAATTTGATGGTTTTGAAAGTAAAGGCTGGAGTCCATCTGGGTTTGGAGAAATGACTTAGTGCTAGGAATGCTTGCTGTGCTTGAGACGACTCAAGTTCTATTTGCAGTGCCCACAGTAAGCAGCTCACGGCTCCAGCTTCAGGGCATCCAACAGCTGGGCCCTCCTTGGGCACCTGAACTCTTTTAGATACACACACACAAGGTTTAGTTATGCAGACTTGGAATCAAAACATAATTCTTATATCTGTACTATAGCCGTATGCTCAATGATTTCATAATTAAATGTTTATTTAGATTTGTATTTTCTTGAATTTCATTTGACTCACATCACCAGGTGAAATGAATAGTTATTTGGGCTCTTTTTGTTCATTCTTCTTAGATTTTTGAGACAGGGTTTCCCTGTATAGCCTTGGCTGACCTGAAACTTGCTCTGTAGACCAGGCTGGTCTTGAACTTAAGAGCCCAGCCTACCTCTGCCTCACAAGTGGGATTGAAGGCATGTTCACTGTAATTAAGCACTCGGTGTTTTTTTACCACATGGACCTTATGTTAAGTTTGTTTTATGATTTATGTCTGTCTTTTTTTAAATGCACTAAGTCTCAGGAATGAGAAGCTAGTGTGGGGCTACTGCTCTGGAGTTACCACTTTTACATGGACTTGGTGTACAGGGCTTTCTTTTAACAATTTCATATGTGCCTTTCTATCTTCAGGTAATGATCTATTTTGGTTGAGTAAACACTTGAGAACAATGGGTAATGTGTTTCTTCTTAGGAGTTTTTTGTTACAAGGAAGTTGAAAAAGAATAAGGAGATTTATTACATTTTAATTTCTTCCTTTGTCTTATTGCCTGAAGCATACTTTTTTTCTATTTATAAACAACTTAGTTCTACCCCAATAATGCCTTCCCAAATACTGAGTTGTTACTCAAGGTAACTCTGGCACGGTGAGTGTAAAGCACGGGAATGTAGCTATGAAACCTGAACTTAAGTCTGTCTATAGCCATCTAGTGGCTCTCACTTCCATGATGAATTACCCTCCCGCATATAGGGTTGTTTTTTTTTTTAATCAGCTAGAAAATCTAGCTGCAAATAAGATTGTTAATGAAGATATAATATTCTAAATGTTACTTATTAATTGTTTTGAAGAACTAGTATAATTATAAAATAACATTTACATAGCTTTCTTGCCCATCAGAGTTACTGATAAACATTAATAACCTTTTTTAAATATTTAAAGCTATGAGTGTAGTATGGTAGCATTTAGTATTGAGTAAACCTCCCCTTTTGTAAGATAATAATATATAGCACAACCTTAAAAATGTTCATATGCTTTGATTCACTAATACCGTGTGTATGAATGGATCTGCTCAGATCCTGTAAGTGATTGAGCCAGCATATGTAAGCTGCTGGTGGTTATAACATGTCTCACAATTAAGTAGGTTACCGAACCTGGAGAGCCAGGAGGAAAGGATGCGTTGCACGGTAGTACATTCTAGTCTAATGCATCTAAGAGCTGTGGTGTAAACCTGTTTTGAATAAATTTAGAAAATTTTACATTATTGTGCTTGGGAAAAACAGGAATCTAACTATGTGTATATTTCCTCAATAACAGACCAAAGTAAGCCAGGGGATGTACACTTAACTGAGATACAATTAATTATAATCACAGTTTCAAAGATTATTTCGTGTGAATGAGTGTTTTGTTTGCCTGTATGTTTATGCACCACTCATGTGCCTGGCGCCTGCAGAGGTCAGAAAAGTGCAGCAGATCTCCCTGGAGTTGGAGTTACAGATGATTGTGAGCTACTGTGTGGGGGCTGGGAACAGAATCCATGACTTCTGCAAGTGTCATAACTCCAGCCCCTGCTCATAGTTTCTTTTCCCAGAGATTTACATTTTGTTCTACATTAGGTTATTTCTATCCAAGTGGGATGTTTTCAAATAGATTTCTAGGGAAGGTCGATATACAGGATGGTAGCTTCCTATATATACAGGATGGTTATTTTACAAATGTTTCCATTTTTAAGTTTCTTTCTAGCTATATATGTTTTTATTTTAAATTGTCCTTTATAGTTTATTTTTATCTGTATTTACAGCTGTGAAAGAGAATCTTTACTATGAAGTTGGCAAAATGCTTGCCATTTCTTTAGTTCATGGTGGTCCTTCGCCTGGTTTCTTTTCTGAAACCTTGTTTAACTGCCTTGCTTATGGACCAGAAAATACTCTACCAACTTTGGATGATGTATCAGACATTGATGTTGCACAGATTATAATCAAGGTAAGAAATATACCCGCTCCTTAAAATATAAATTACATTCTAGTTGTATTTTAGTATAAGTGATAAATCTGTAATATGTACCTAAAGAGTTCAGAACCATTTCAGAAACCAATATAGGTGGGCATGGTTGAACATGCCTGTATAAATGTCACCAATTTAAGGCTTCAAGGGTAACCTAGACTGCATAGTGAGACCTGTTTTAACAACAATAGGGGCTGGCGAGATGGCTCAGCAGTTAAGAGCACTGACTGCTCTTCTGAAGTCCTGAGTTCAAATCTCAGCAACCACATGGTGGCTCACAACCATCCATAATGAGATCTGATGCTCTCTTCTGGTGTGTCTGAAAACAGCTACAGTATACTTACATATAATAAATAAAACTTAAAAGTAACATAAAAGTCAAGATAGTTAGAGGTAAGCATGCTAGATTTTAGAGAGTGGGGACTAGCAGATTAATAGTCTGCAGGATTTGCTGGCTGTGGTAAGTGTTCATGCCTCAGTGTGTATGTAGATGCCAGGATGCCAGAGGGGGGAACCTGTGGGAATTGGTTTTTTTTTTTCATCATGTGGTTTCTAGGATGGAAAATGGACATCTCTTATATATTTCTTGGCATAATTTTATTCTACCCTGTTTTACTAAAGAATTGAGTATAGGACTGGAGATATGGCTCCATAGTTAAGACTGCATCTAGTGAGTCACGGGGCGTGGTGCTGCATGCCTTTCATCCCAGAGCTTAGCTGGCAGAAACAGGTGGATCCTACAGGTCATGGTCAGCCTGGTCTGCAGAGAGAATGCTAGGCCTGACAAGGGACTGTGTAGTAAAGACTCTGTCTCAAAAAAGATGCTACTGCTTTTGTCAGGAGATGCAAATTAGATCCCAGCATGCATGCATGGCAGGCAGCTCCCAGTCACTTGTAGCTCCATATCCTCTACAGGCGCCTGTACTCACAAGCACGTGCCCTATACACAGAAAAAAAAAAAAAAAATTAAAGAACTTTATAAAAATTGAATAAAAAATGTGTTATCATTTGAATTGCAGCAATCGCTGAGAATAAATGGGTAACATGAGTATATTTTTCCTGTTACAGATAGATTCTGCAACTGATTTAAACATTTTAAATTCAGTAATAAGCCAACACTATAACTACTTAGAGGTCAGTGGATGTTTAAGACTTACGACATCATTAAGTGATAAATTCATGTTGGTAAAAGACATCCTTTTCTACCATGTAATTAATAGAGTCAAGGCACCTTTTGAGAGGTAAGTTGCCTATTTCTATGTTAAAGATTCTATAAAATTACTTATTTATTTGGTAATAAATATAAATGTTTAATTTCAGGGAATGTTAATGCTATTTAAAATGTTAACCTCTCCTGAATAAGCCCTGCTTTAATTCTGTCCAGATTACAGGAACGGGTTCCTCAGGGACAGCCAATCAGCAGTTCAATTAGTAGTCTTTTTTTCCTAATGAAAACTCGCTTTTGTAACCATTTGAACTACTGTGTCTACTCATTCGTGTAGTCAGTATTGCACACCTGTCATCTGTTGGGTAAATAGGAACCAAATACATTTGGCTTTTACTTTTTTTCTTTAAGGCCCAGGCTGTCTTCCAAGTGTTTACATAGCTAAGGATGACTTTGAGCTGTGTTATGCCTTTTCAACTTCCCAAGTGCAGAAATGACAGATATATGCTGTCATATCTGGTCAGTAATCCCAAGTCAGTCCAATACTTAAGGATAATGTGGAATTATGGGCCAAGGTTCTTAACCTTCCTAATGTTCCAATCCTGTAACACAGTTCCTCGTATTGTGCTGACCCACAACCTTAAACTTGGGTCATTGCTACTTCTTAATTACTTCTATTTTTTTAAATATTTATTTATTATTATAAATAAGTACACTGTAGCTGTCTTCAGATTCTCCAGAAGAGGGCATCATATCTCATTATGGATGGTTGTGAGCCACCATGTGGTTGCTGGGATTTGAATTCAGGACCTTCAGAAGAGCAATCACTGATCTTACCCACTGAGCCATCTTGCCAGCCCCCCTACTGTGGGGAATTGCAGGCTGGTCTCCAGTCGAGCTGAGGTCTGAACCCCAATGGTCATAATTCATCTTCATGACATTGTAGGCATTCCCTCGTGCTCCTGGAACTCTGGCCCCTGCCTAAGGTACCGCCTCCCACAGCCCACACAAGAGAGAAGCATGGTCAGTAGTCACATAGACAAAACTTCTGTAGCCCCAGGTGTATAGGGGAGAGGTTCCCAACACTGACCAGAGTGTGCAGCAGATCTTGATGGAGCAGAGACTCTTTATGGTTTAAGAGCTTTATTGTAGAAATGCAGGGGAAAGAGAAGGGAGAAAGAGAGGGAGAGCTAGAGAAAGAGAGAGGAGGAGGAGGAGAGAGAAGACAAAGAGAGGGAAGAGGAGAGAGAAGTAAGAGAAGTGAGAGGTAAAGGAACAAAGGAGTAAGAGAGAGTAAGAGAGCAAGGTGGGGGCTGAACAGCCGTTTTAATGGTCTTCACTGTTGCTAGGTAACTGGGAAAGAGTTTAGCTTGAAGGTCAGAAGCTTGGGCCATTGCTTACATGATTACTGGCCATGCTTCTCTTGTGGAGGCTGTGGGAGGTGGTACTTTAGGCAGGGGCCAGAGTTCCAGGAGCATGAAGGAATGCCTACCATGTGATGAAGGTGAATCATGACCTTCGGTGTTCAGACCTCAGCTCGACTGGAGACTAGCCTGCAATTCCCCACACTCTACCTGTGTTTCTTGCAATCAAAGTTCATGGTGCATGTACACAATGTAGGGTTTTAACATATAGTTTGATGGGCAACCAAGAGCACTGGCAGTCACCTCTTTTACAGACCTCTGAGCCACCTTCTTAAGGGACTTATCCTTAGGATTCCTTTTATTATTCCTCCTCCTCCTCTTTTTTTTTTTGTTTTTTGTTTTTTTTGTTTTTTTGTTTTTTTTGTTTTTTGAGACCGGGTTTCTCTGTGTAGCCCTGGCTGTCCTGGAACTCACTCTGTAGACCAGGCTGGCCTCGAACTTAGAAATCAGGCTGCCTCTGCCTCCCAAGTGCTGGGATTAAAGGTATGTGCCACCACTGCCCGGTCCTAGTATTTCATTTAGTAGCCATGTATAGGAAGTTTATCCAGTCATGCAACGTAGTACTTACTACTTTCAATAAAATACAATTTTAAATCTAGAAAGGCAAGTGATTATTTTCATAATTATTAATCCAGTTGCTTGTTGATTTGAAAGTATATCCTAGTATCTTATCTCATATCTAAAGGCATGTAATAGTTCTTGTTGGGCTGTTTTGTTTTTTGTTTTAATTGGCTATTTATAAAGTGCCAGGTAAGGGC
G5 52272008 52272057 50 TATGGAAGTCGGTGTTTATTTTTTCCTCCCAAACAAAAAGTCAGTTTTTT
U5 52276989 52277038 50 GTGTATTTTATCTCAGCAATCTCTCGAGCCGTGGTGTATTTTATCTTTAA
U3 52277083 52277132 50 AAACCCAGGGACAGGAAGTGAAATAGAGACTGGAAGAATGTGGCTTTCTG
D5 52277782 52277831 50 GAATGATGACAAATGGCCTAAAGATATAGTTCCCATGTAAAATTACTTTT
D3 52277895 52277944 50 TACTTGTATATAATCTATTCTATCACATGATTGTCCCTGGAGTTCATTCT
G3 52282808 52282857 50 AGTCACTATTGAAACTTGTATTGTAAATTCTTATGAGGCTATTCCAAGCT
G5_U5 52272008 52277038 5031 TATGGAAGTCGGTGTTTATTTTTTCCTCCCAAACAAAAAGTCAGTTTTTTCTATAGTATTTATTGGATAGATTGTCACTTCTGGAGTTTAATTACCATCCTTTCTTTGCTGGGTAGCCATTAGGCGGAGTGGGAGGGAATTCAGCTTACTGTTATATTATCCATCTATTAACACTCTAAATCACCTCTGGAACTCGGTTTAAAATAAAACAAAAGTTATGGTAGTATGTCTGGATCAAGAATTAGGGACCACCTCAGGGCCTCTCTGAAGTTACATCAGACTCTGTCACCAGAAGTCTTAGATGGCAGCTTGTGCTTATATCATAAAGCTCATGTCTAAAGTACTGCATTCCATACTGAACAGACTTCTTCAAGAAACGTCTTGGAAGTTCTTGTCATCTGGCAGTAAGCTTCTAGACATGACCAGAGAATAAGAGGAGGTAGCGCACGTTTATGACATGGCAGTATATAAATTATAAGTGGTTTGAGCACTGCTGAGCAGGACAGTATGGCAAGTTCTCCAGGCACAATAGAAAGTCATAAAGTAGTGTTGTACAGGGTACTAACATGGGAGCCGAATTGCTCACAGGATGCCAGTGAACAGGTTTTCAAATTAAATAGAGTGCTTTGTTTTTCACAGGAGTTGCAGTTCTGGACAAACACAGTCCTAACATAGCCAAAGAAAGGGTCAAAGGAGAAGATGTTTAATGGGTATTGGCTTAATATTTATTCAGAAATGTAAGAGTCCAGGCAGTTATGTTGTGTAGGACTTTGTGGTGCACCATAGGGCATCTCACAATCTAGTACTTAAATGTTTTAAGAAATACTCTCTCCAGTATCTTCAAATCTGCCACTCTACTTGAACTACTACTTGTTCCCAAGTGAGGAAGTTACATACTGTATTATATAGTATGAAGTGATTATTACCTGATTATACTTATATACTGACTAAATTTAATAAAATGGTTAATGTGAGATTTTTGAAATTAAGATATCAATATGCTTTTATTTTTCCTAGTAAAATGAATGAAAATAAACCTGATAATTCACAAAGTCTTGGTAAGTAACTGAATTTAAAATATTTGTATTATAATAAAATCCATTTAGAATGCTATCCAGCCAGCACGAATGAGTATTCCGATGTATGCTTAGTTAATATGTTCTATTAAATTATTGTGATTATGTTCATTTCCACAAGCTAGATTTGCTGCTAGAAGACATCTTGTCAAATTTATTTTTCCATATTTTATAAGATCAGATATATTTTGAATCTGAGAAAACTTTAATTTTTAATGGTTTTCCCTTTGATAAATGAGGCCAATGAGTAGACAGAAGTCTAACGTGAAAAGGAAAATTTCTAAGTTTACAATTTTCCCTGTTGATACATCGCTGTTTTAGAAACAGAACCTGTTGACTTGCTACCATGAATGGTGAGGAATCTAAATGATTACTGTAGACTTGGATGCACTGCTCCTCCACTTAGGCTTGGTGGGGCTCTTACTTGTTTGGTTTTGAGACAGTCTCACTATGTTTTTTTCTGACTAGCAAATGCAATGTGCTCACTATGTAGACCAGGCTAGCCTTGAACTCGAATCCACCTCCCTCCCTTGTGCTTGGATCAAAGGTGTGTACCACCATGCCTGTGCCTAGCTTTTTTTTTTTTTTTTTTTCCGAGACAGGGTTTCTCTGTGTAGCCCTGGCTGTCCTGGAACTCACTCTGTATACCAGGCTGGACTTGAACTCAGAAATCCGGCTGCCTCTGCCTTCCGAGTGCTGGGATTAAAGGCATGCGCCACCATGCCCAGCCTCATCGACTCTTGAACTCCTCTATTTGGTTCAACTGGCAAGGAAAGCATCCAGGTTTCTGGCCCTTGGCACAGGAATTATAGACATGCACAGTTGAGTCAACCTTTTTTTTTTCCATTTTCAAGACAGGGTTTTTATATAGCCCCGGCTGTCCTGGAGCTCATTTTGTAGACCAGGCTGGCCTCAAACTCAGAAATCTGCCTGCCTCTGCCTCCCGAGTGCTGGGATTAAAGCCGTGTGCCACCACTGCCCGGCGAGTCTACCTTCTTTATCTGTTGACTCTACCTTATTTTGAATAAGGAATTTTGCTCCTACAACTCCTGCACCCCATATACCTGTTGTCTTGTTATGCCTCCTGATTATATCAGTAATGCCAGGAGTTGGGAAATGTTGATGATTTATGTAATACCGTTGAACATTGGTTGGATGTCTTCTTATCCCAACTTAATTTCCCACCAGGTTAATGCCTCTAGTCTTTACTTATATTAGTGTGCTTAATAGGAACCAGTATTTGCTGTCGTAAAAGGTAATTTTAACAGTAAATATAGTGAATTAGAACAGTTTTAATGAATTTTAACTAGTCTGATATAAAAATTAGAAAGTTTGTTATAAAGATGAATGCTTGAACCATTATTGATTCAAGGTCTTCTTAGTATTGGGTTGGATGTACCTCGAGATCCTTCAGCAGCCCAAGTTTGTCTTTCTTGTATTTTTATGAGCTTGGTCTATGTGTGCACATAAGACCCCGGTGCACTTTAATACATGTGTGAGCTTTTTAAACCCTTACTCCCAGATAGATCCATTCTTCCCAACTTCTAAACCAGGTTGGTTTTAGCCAATCAGCTGCGTGCCCCAGACTTTTACGACTATGGTTTGTTTAACCCTAAGAGAATTCTGATGCTGGTAAAAGAAGCAGGCATTTGCCTTCATCCCTTAGGGAGTTACCACATAGGTGTAAAAGCACAACCACCTTGATCTGGGAATGAGGTCTGAGTCACTTCCTTTTAGTCTAGCAGTCTGTTACCATAGACATGAATGAACCAACCAAGGACATCGAGACAAAATTGATCTGGGGATGTGCAGCAGCCGGTAAGATACTCGTCCTGCTGGTCTGAATGCTTGAGTTCCCGTCTCTAGAACTCACATAAAGTTGGGCATGATAGCACATGGCTATAATCCTAGTGTTCTGGGAGTGAGGCATCGGCTGGACACTCCCAGGAAGCCCGGGAAGCAGCTAGGAAAAGGGACATTAAAAGACATGAGGTCTCCTGACCTCCAGATGTGACCCATGGCCACTGGTCACATGTGCACACTTGTGCACATGCACATACACTTAGGAGAAGCACTAATCCTATACATTATTTTGTAATTTTAAATTTCTTTTCTTTTTTCTTTTTTTTTTTGCTGTTAGCTTGTGTTTTCTGCCGAAAAAATGATGACTGTCCCAATAAATACGGAGAAAAGAAAACATATGAAAAATGGAATTTTAGTGTCCACTACTACTGCTTGGTAAGTCAGGTGGTCTGCATTGCCTCATTGCTCATGTATACATCTGTTAATTCCTACCCGTTTTGGAGTGTATTTTCTAATTGAGAATATATTCATAGTTAATGTCAAGTGGAATTTGGCAGAGAGGTAAAGAAGAAGAAGGAGTTTATGGCTTCCTAATAGAAGACATCAGGAAGGAAGTCCAGAGAGCCTCCAAACTGGTAAGTACTTGCTATTCAGTACGCTGGGTACCACAGTGCTGCTGCTGCTGCTGCCTTGGGAGGGTTCTTCAGTCAGTCTGGATTAGAAACTTGACTACAGTATCTTATTCTGATGGATATTGTTACCACATATGATACGTTTTATTAAACATTTTTATATTTTTACAAAGAAGAGCTTAACCTACACTGAAAAACAGTTTATCAGGAGGGAACTTCTGTTCATTATTTCACTCATTCTCGGTTTGATTTAGTTTTTGAAGTTGGTCTACAAGCGTTGTTCTTTTTTTCTTCTTTTTTCTTTTTTTTGTTTTTTTGTTTTTTTGTTTTTTTTCGAGACAGGGTAACAGATGGGGAAGTATCACTAGTTACAAATGACCTAGTTTGTGATGCCCTGCAATCTCTAACATAGTCCAGTTCTGCCCAGCCCCATTCTCTCAGAAATAAGACTCAGACTCACAATAAATTTACAGTGGTCTTATTGCTAGGCTCTTCTCTTACAAGAATCATAACTTGCCAGGCAGTGGTGGCACATGCCTTTAATCCCAGCACTTGGGGGGCAGAGGCAGGCGAATTTCTGAGTTCAAGGCCAGCCTGTTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAGCCCTGTCTTGAAAAAAACAAAAATAAAAACAAACAAAAAAAGAATCATAACTTAACCCATTTATTTTAATCTCCATTCTGCTGTGTCTGGGGTTCCCTGTCTCAAGTACCATGTGTCTGTCTCCTCTCATTTCTTGGGCAACTCTCCTGCCTGGCTCTATCCCAGAATCCTTCTTCTTTCCTGGATGTCCCACATCTATTTCCTACCTAAGCCATAGGCTTTTTTATTGACAGGTGACGAATCAGGATACAACATACAATGTATCCTCTCTACAAAGTAATATATTTCTCTCCCCTGTCACTGTAGTCCATCTCAATGTGTGCCAGTTGTAAAAAGTAAGGTTGCTGGGAAAAGAAAGCCGTGTCACTCATGAGAACTTAACACAGAATACATAGAGAGGAAGCATTTATTTGCTGGAGATGGTCACTATATAAAAACGTTGGGTGAGTGGTTAGCATAAAGGGAGCCAGTGGTGAAATAGGATCTGGGGCTCTAGAGGAACATGCTCTGAATGGTTCCAGTAAACCAAAGGACTTGGTAGGGATGCAGTGTCAAGATTCCTTAACATCTTAATAGCAAACTTGGAATTAAGAGGAATCCTCCTTACAAGTTTTGGTAGCTGCTAGTTTTCTTAATATATACAAATTCTCTGCGTGCACTGTGAACCTTTGGGAATATTTGCACCTGAGCGGAGTGCTCCCACACCAGAAAAAGGTATCAGATCTCATTACAAATGGTTGTGAGCACCATGTGGTTGCTGGGAATTAAACTCAGAACCTCTGAAAGAACATGCAGTACTCTTAACCACTCATCAATCTCTCGAGCTGTGGTGTATTTTATCTCAGCAATCTCTCGAGCCGTGGTGTATTTTATCTTTAA
U3_D5 52277083 52277831 749 AAACCCAGGGACAGGAAGTGAAATAGAGACTGGAAGAATGTGGCTTTCTGGCTCGCTGCCCATGGCTAGCTCAGCCGGCTTTCCTATACAGCCCAGGACCGCAACGCAGCCACCGTAGGTGGAGATACCACACACCCATCACTCACTGATGGTGAAAATACCCCCACAGACTTGCCTACAGGCCAATCTGGTGGAGGCATTTTCTTAATTTGAGCCTCCTTTTCTCTAATACTAGACTGTCAAACTGACAAAAAAGGAAAAACTACCCAATACAGATCTTAAAACTTTGTCATTTGGGTTAGGATAGAATATATTATAGCAATAATTTTCAGTCTTTCCACTAGGAACACTCATTATTTTATCAAACTGTAGTACTGAAAGTTTTTTTATTATACTCCTGTTTTCATATTTCTTCTAGAAGTGTACAGTTTGCAAGAAGAATGGTGCTTCAATTGGATGTGTGGTACCCACGTGTAAACGAAGTTATCACTTGCCTTGTGGACTTCAGAAAGAATGTATTTTCCAGTTCACTGACAATTTTGCGTGAGTTATTTAACTGCTAATTAAATACTAAATATGAGGAGCTGGGAGAATGATTCAGCAGTTCAGAATATTGGCTCCTCTTCCAGGGGACCCAGGCTTGGCCTCCAGCACCCACCTGGCATCTCGAAACTGTCTGAAACTTTTGTTCTTGTTAAAGAATGATGACAAATGGCCTAAAGATATAGTTCCCATGTAAAATTACTTTT
D3_G3 52277895 52282857 4963 TACTTGTATATAATCTATTCTATCACATGATTGTCCCTGGAGTTCATTCTATCTGGTGAAACTTGAGTTGCAAGGCTATCTGAGATGGACGCCAAGATTATTACTCACATTCAGCCTTCAGCTCGAGGATGAACTTTTGATTTATATTTCTGTGAAACATTTTATCACTCAGTTCAGAAATTAAATTGCCTTATAAACTTTGTTGAGTTAAAAAAAAAAATCAAACTTACTATGGCGTACCCCCTGAGTACAGCTTCAAACAAGAAGATTTTGTGAATTTTGGCATTTGGTACCCTGAGTATTTCTTGAGTTTTTTGTATTTCTATTTATATAATGGTTAAGCAAAATGGGATATAAAGGAGCCTTAGAGAATACAAAGGAAAGAAGAAGATTAGGAACAGTTTGTCACTTGCATGTGACGTGTCACATGATAGATGTTAAGTTCTTTTAAGTTAGGTGATACTGAATACAGTAGTGTGTGCTCCCTGGGTACGAGGGTAAATAGACTATTAGTAATTAGTCCAGTAGTGTGTGCTCTGCTGGAGTACAAGGGTAAAGGTCCTCTGTTACTAACAAAATACTGATACTAGTCTTGAGGGAGTCTTACCTCCCAGAGTTTGTTTCAAAGCATTTGGCTTTCCTTGAGTACAGGATGCTAGACTATAGGGCCCACATATGTGAAACAGAAGAGATTATAAACTGAGTTGTGTTTTTCTCTTCCTTATATATTCTTTACAAATTTCTACTTTTAGGTCATTTTGCTGGAAACATCGACCCGTTCAAGCAATTACATCTAATAAATATAGTAGTTCTTTACCATGTACTATCTGTTTGGAATTTGTCGAGCCTATTCCTACTTATAACATACTACAAAGTCCCTGTTGTAAGAATGCTTGGTTTCATAGAGACTGTTTACAGGTAAGATAGCTTTTTAATCTTTGACTCCATAATATAAAATCTATTGCTTATCAATTTGAATTTTAATCTGGTGTCATGAAATATATCATAAAATACCAGTATTCCTCTCTTGGAGCCTATTACACTCTTGGGAGCTCTCGTCTCACTTCTTAATCTGTGTTTACTCTGCTCAAACGAAGAAACAGTATCCTAAAAATCAGAGGTCGGCTCCTCATCGAGTGTGTGTGAGTCCCCTTGGATTAATACTCACTGAAAACAGTCCGGTGGACTGCATTCTCAACTTGATTGAATGGCTTTATTTAGAACATTCTTATGGTATAGAAAGTGTTGTTAGTCAAAACCAGGCCAAATAAAGATTTACTTAACTTTTTAACTTGCTTTGTAAAGCTTAGATCTTGGTTTGCTTAGTAAAATAAAATGGTTTGTTATTAACTGTTCAGAGTTATCAGATATTAAGTTGCCTTCTATTTCAAAAAAGACTCAATGGAGCTTATCTGATTTCTGGTTTTGTTTTGTTTTGTTTTTAATAATCTTAAACTTTTATACTTCGGTTATTCAGTTAGAGGTGATAAATTGGAGCCTGTTTTCTTGGAAATGTTTGCTAATTCTCCATACAAACGTATGTTTTAGAGAACAGTTAATAACCATCATGATGTGCAATTTAATTTTATGTGAGAGCCTTTTAAAAAGGAATATTTCTTAAAGATTTGTGTTTAACGGACTTTAATTATTGATGAGTGTGTCTTAATTTTATAAAGATTTGCTTTGTATTTGTTAATAATAAAGTAGAGAGAGTTCTTAGATTTGGCCTAATGTTTTCATGAACTCTTTGTCATTTAAAACTAGAAGCATTGGACTGGGATCTAGCTCCTTATAGAATGCCTGTCTGTCTGTCTGTCTGTCACACAGACACAGACACACAGATACACACACACAGACAGTACTATATAGGGAGAGGGAGGCAGACCGTAGAAATAATGCTAACAAAAAACTGTTGTTTTTATTTCAAAACATTAATTCAGAATTAAATCCACATAGCAACCTGACGGTTACATAAATGTCAGTAGGAGTTGCTATAATTAGAACTTGTTAATTCTTCAGTCACTTTCTCTTAACAGAATCTATAGAGACTTTTCCACTCATGATTACAGAACCTAACGAAAATCTGAACTAAACCCACTCTGGCTTACAGTATATGGCTAAACAATATTTCTGACTACTTTGATTACTGCATGTAGAAATTTTGTGAAAAGAGACTAGACATTAAAATGAAAAGAGTGCTACTGCCCCAGTTTGGATCTCTCTGTCATGGTCTGGTATCCTCCAAATGTTTTGTGCTTGCTGTTCAACCGGTTTTGTCTCTGGGGTTGTTTCTGCTTGTTTCATTTTCTATCAGATATGTCTTTGTATTAAACCTCATGTTTAGTAAGATACCTTCTTTTGTCTGCAATGAGTTACTGTTGCAATGTAGTACTTGGTGTGTGTGGGTATCATTTGCCTACCATCCTCTTTCCTGCTTTAGCATCCATCAGCTGTCCCTTCAGCTGTATCAGTCCACCTTGTATTGTGTGTCCTTCTCTCTTGTAACCACTCACTCGCTTCTCTAAAATACCAATTGGAATTCTAGGTATATTATTTCCTATCAGTTATGCTATTCTTAAAGCATAGTCTTTCTTCTGCATTTGATTCACCTGTTTAATCTTATTAATAGTTCAATTTGCCCAGAATGTCATATCAAGATATATTGTCAATTCTAATTTTCCTAATTGCATGTTCTCTGTCTATCCATGGATGTGGTCCTTGAAATGTCTTCCTATTTTCCTTTGTTTCTTCTAAATGGGTTTTTTTTTCCTCTTTCTTCATGTATATACTTTAAAAAAAAATGGCACTTTTAAAGCTAGGCATGTCAACACAGTAGTACTAGGCAGTAACTTCAGCATAGGCCTTTATAGGATGGTAGTGGAAGGGTTCAGAGATAAGATTCTTGGAGCTCATTTCCCAAATCAGTCTAGCTGAACAGATGAAAAGACTGACTTCAGCCTCTGACCTCCATATGCACACCCACGCACACTCAGGAAGACAGACATACACTACATACACATATGAATAATACTTTTACACATCTATGTTTGCACACGGTAGATAACATTTTCTGAGCAGGAAGCAGCTGCTCCAGGCTCCTGCTCTGAGTTTCTTCTCTCAGTGATGGTGTGACCTAGGAGCTGTAAGACAAAATAAAAATAAACCCTCCTCTTCCGATGTCAGTGTTCATGAGTGTTTTCTTAATAGTGACAGAAAGCAAACTAGAATAGTATTAAAGTTTATGAAAGCAAATTGCTGACTGCTGAAAAGGCAAAAATCATGTATTCATTAGATGTTTTTAAACTGAAAAAAAGAGTTGTCTTTGTTTTGAGTGGCTTTGCTTATCGTTCTAACAGGAAATATTCTCATGATACAGAAAGGCAAAGAGCATGTTCTGTTAGTTATTTAATTCACAATCTGATGAGAAATGCATTGCTAACAATAGATTTTCCCATTTTTTGCTGTAGGTCCAAGCAATAAATGCAGGAGTGTTTTTCTTTAGATGTACACTATGCAATAATACAGACATCTTTCAGAAGGAGATGTTGAGAATGGGAATTCATATTCCTGAAAAGTGAGTAACATTTGGCTTTTTGACCAAAAAGCATTTAAATGTAGTATTTACTAACATTAACAATGACTGTGTGTGTCTGATTAGTGATTGTGGCTAAGTAGCCATGCTGCATTGAGTCACATGCCTCGTCCCAGGTGGCCAGCTTTTGGAGAATGTGCACTATAATGACAGTACCCAGTTAGATGCTGTGTCTCCGTCCAGTCCAGTTCTGGGTGATTTGTATAGCATCTTTAAGTGATCTGAGCCAGGCTAAATGGGTTTAAAATGGAAAAGGAGAATTTTAGTAATGCCCCACGGAGAGAAATCCTGAGTAGTGATAGCAACCTTGAGAGTAAAGCTTTGGATGCCCATCCTTGAGAGGCTGAGGCCCCCATGGGCTGGGAACTGAGTTCCAGGGTTGCCCAGGCTCCAGTCTTGGGGCAGAGAGTGAGAGAAAGAAATAGCAAACAAACATGTATAGTCCTAGCACTTGAGAAGCTGGAGAAAAGCTTGAATTTGAAGCTAGCTTAGAGTGTAACAACAAAAATTGAAATACTAGAAAAATGTAGGTTTTAGAAAGTTTGTTCAGCTTCTCACATAGTATTTGAAAGTTCACTGTGAAATTGACTATAAGGGGGCTGGAGAGATGGCTCAGCGGTTAAGAGCACTGACTGCTCTTCCAGAGATCCTGAGGTCAATTCCTAGCAACCACATGGTGGCTTACAACCATCTGTAATGGGATCTGATGCCCTCTTCTGATGTGTCTGAAGAAAGCTACAGAGTGCTCTTATACATTAAATAAATAATAATTATAATTAAAAAAAAAAGACATTGTGCCGGGTGGTGGTGGCGCACGCCTTTAATCCCAGCACTCGGGAGGCAGAGGCAGGCGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAAAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTCGAAAGACATTGTAAGGTAAATTAACATAATGAGTTTCTGTGATGAAGAGATCAGCCTAAAAATGCTAACTTTAATCCTTGTCTGTAAATGACCTGTTAAACCAAAGCACACTTTATACCTCCTCTCATTATAGAGATGCATCCTGGGAATTAGAAGAAAACGCGTATCAAGAGCTGCTGCAGAGCCACGACCGCTGTGATATTCGAAGATGTCACTGCAAAAAAGGCCGAGACTACAACGAACCTAACAGGTGATTCTGCAAGCTTATGTTGAGTTGTCCCTTCCTGAGATTTAGCTAAGAAGGTTGCTTTTCTGGTGACTTAGAGGATGCTTGAGGCTTTAACGTAAGATTGAACATGTTTATTTAGTGTGTAAGCAGAAATACTTTGTAGTCACTATTGAAACTTGTATTGTAAATTCTTATGAGGCTATTCCAAGCT
U5_15 52261990 52277038 15049 CCCTGCATGCTGGATGTTTCTGCAAAATAAACACTCTTTATTTTTGCATACTATTTGAGTCACGAGTCTTCCTTCAGCAATTTTTGAGTCCTTACACCTGTGTTTCTGGAATGCTGGGATTAAAGGCATCCACCATCTCACAGCTGGCTTCAAGGATTGAATTTTTTAATACTTGAATTTACCTTCCCAATTTGTCAATTCCCACAGTTACTGAAGCCTCTCCAATTGTTGAAGCCTCTCGTGGAAGCTCAGAGACTATTCTAAACTCATGGGGTTAACTATATTACACACTTAAGGGGATTAATGCATTTGATTACCCTAATTTATCAGGTGTGAGAGGCAATGGATTTAATGACTGTATAAAAATCTATTGACAATTCATGGAAAAATAAGAATAGCGATTATACTGGTCAGTTACTCTTAACATCTCTGGATAAACTGACAAAGGATAAGAATGAGTGCTGTGATAAAACTAATCAACTTTTAGCATCTTAGGGTACAGTGAAGGATAACAATGAACTTAGTGATAAAACAGGTGTTCGAGAATAGTCTAAGAGTTTCTAAGTATGCCCTGGAAGAGAATCTTCCCTCCACAGAGCTCAAGTTGTAGAAAATTAAACTGAAGCCCTCGGTTATAAAGTTGGCTAAGTTACAGTGAAAATTCAACCCCTAGCCTTGGAGGGTGTCAGCAGTTAAAGTAAGGGCATAAATGGTAAAGAATGGGATCCTGTAACATGGGATGCATCTATAGCCTCATGCGTTGTGCGCTACAACGGACTGAGGAAGAGAAGTCTAGAACCTGTTTTACTGATTGTTCTGCGTGTTATACAGGCACCACTCAGATGTGGACAGCTGCCCCATCACAACCCCTATCTGGGACAACTCTGAAAGACACTGGTAAAGGAAAAATTTCATAGTGGACAGACCTTCAGGCAATACACATAATCATACATTTTATTTTGAAGGAGAAATAGCCAGATGTGATTGTTCATTGACTCATGGATTGTAGCCAATGGATTGGCTGATGGCCATGAACTTGGAAAGGACATGATTGGAAAATGGATGAGAAAGGCATCTGGGGTAGATCTCTTCAAATGGGTAAAGGATGTGAGGATTCTTGTTTCCCATATAAATAAATGTTCATCAAAAGGAAACTTCAGCTGAGAAGTTCAGTAATCAAGTAGATAGAATGATCTGGTGGAAGCACAGTCAACCTCTTTCCCCAGCCATTCCTATCATTGCCCAGTGCACCCAGGAACAAAGAGGCCATGGTGACAGAAATGAGGGTTATTCATTGGCTGGACAATACTCCACTCATGGAGGCTGACCTGGCTATCAGTGCTGCTGAGTGCCAGATCTGCCAACAAGCCAAGACCAACAATGAGCCCCAGATATGGCACCGTTCCCCATAGTAAGCAGCCTGTGGCCCGGTGGCAGGTTGACTGCCTTGGACCACTTCCTCCATGGAAAGGACACTGTGTTGTCCTTACCTTTCCTGGATGTGATGTTTCTGCCAAAACTTGGATGTTTCACGGACTTACAGAATGTTTTATCCACCGTCATGGTATTCCACACAGTTTTGCTTCTAACCGAGGAACTCACTTCACTGTCAGAGAAGTGAAACATTGGGCTCACAACCATGGGGTCTGGTTTTACCATGTTCTCCAGCATCCTGGGGCAGCCAACATGATAGAAAGATGGAATGGTCTTTTGAAGATACAGTTACAGTGTCATTTAGGTGGCGGCAGCAGGGAAGGTTGGGGCAAAGTTCTCTAGAAGACAGTATAAGCTTTGAATCAACATCTGATACATGATATGGTTTCTTCAATAGTCCAGGAAACAAGGGGTGGAAAAGGGAACAGTTCCCTCACTGTCACCCCTCATTAGCCACTAGGAAACCTTTTTTGCTTTCTGTTCTGCTAGCCTAGATGTTTTGGTTCCAGAGCTGGGAATCCTCCTTCCTGGAGCCATAGCAAACATTCCATTGAACTAGAAGCTCAGACTTTTCCCTGGCTACTTTGGACTTCTGATGCCCTTAAGCCAATAGGCTAAGAAAGGAATAATAGTATTAGGAGGGGTGGTTGATCCAGATTACCACAGGGAGAATTGGATTGCTTCTCCACAGTGGAGGTAAGGAGGATTATGTCAGATCCGTTAGGTTAGGGCATCTCTTGAAGATACCACATCCTAGGATTAAAGCCTATGGGAAATTAATCCAGGCAGGATGATAAAAGGCACACAGACCCTTCAGAAATGCGTCACTCCTCTAGAAAGAGATCCAATGCCTGCTGAGGTGCTTGCTGAGGGTAGAGGAAATACAGAATGGGTAGGAGAGGAAGGTAGTTGTAAATACCAGCTAAGATTATGTGACCAGTTGCAGAAAAGGAGGATTATAATTGATTTGAGTGTTTCTGTTGTATTTTGTTAAAAATGAGTTTGTACGATACTTGTGTTTTCATTTCTCAATTACTTTATCATATGATGTATCCTCAATTAGGCATAGTTATGACCTGGTGTGTTGGTTAGTTTTGTGTCAACTTGATACAAGCTGGAGTTATCACAGAGAAAGGAGCTTCAGTTGAAATGCCTCCATGAGATCCAACTGTAAGGCATTTTCTCAATTAGTGATCAAGCGGGAGGGCCTAGCCCATTGTGGGTGGTGCCATCTCTGGGCTGGTAGTCTTGGGTTCTATAAGAGAGCAGGCTGAGCAAGCCAGGGGAAGCAAGCCAGTAAGGAACATCCCTCCATGGCCTCTGCATCAGCTCCTGCTTCCTGATCTGCTTGAATTCCAGTCCTGACATCCTTTGGTGATTAACAGCAATGTGGAAAGTGTAAGCTGAATAAACCCTTTCCTCCCCAACTTCCTTCTTGGTCATGATGTTTGTGCAGGAATAGAAACCCTGACTAAGACAAATTGGTACCAGGAGTGGGGTATTGCTATGATAGGCCTGACCATGCTTTTATTTGAAAGAATGTGGATTTTGGGACTTTGGATTTGGAAAGCAGTGGAATGCTTTAAATGGGGCTTAATGGGTCATCCTAGTAGAAATATGAAAGACTTTGTTGCTGGGAGTGATTTGAACTGTGTTGACCTGGCCCAAGAGATTTAAAGGAGAAGAATTTCAGAATGTGCCATAAAGATTGTTTTTGTGGTATTTTGGTGAAGAATGTGGCTACTTTTTGCCCTTGTCTGAAAAGTCTGCCTGAGACTAAGGCGAAGAGACTCAGATTAATTGCATTGACAAAGGAAGTTTCAAAAAAGCCCAGCAGAGACTTTGTTCTCTGGTTAAGTCTTATGGAGAGAAGCTTGAACAAACATAGCAAGCTTAGAAAGGAAAAATATAAAATATATGGTTTGAGTATTAAAGGGTACCAGGAAGTGAAATGGAGCAAAATCCTGTGTTCTAGGAGATAACAGATTAAGGGAGTGGGACCTTGGGGCAAATCCTACCCAGCTAAGTTTAGATCCAGGCATGGTGGTACACACCTTGAATCTCAGAAGAAGGGCATGGTGATCTCTACATTCAAGGTCAATCTACAGAGCAAGATCTAGAATAGCCAATATTAGGTAGTGAAGGAGTTGGAGAACAGAAAGCTGGTGTTAATGTAATAGAACAAGAGGGCCATGATCCAGCTCCTGCAAGCAGCAGAACTCTGCAGTTTCAGCCATGTGGCTCTGGCTTTAGAGTGAATAATAGAAGGGACTACTTGGACAATGATGCTGGTTAGCTGGAGCTAAGAAATTAGCGGTGATTAAGAAGAGACCAGCATTGCTGAGGTCAAATCTTCTGGGAAGTGTTTTCTGCGAGCTGTGTTTCAGAGATAGCCAAGGTTGTACCTCCCACTGCAGCTGTACTTGGTAATGGGAAAGAGTCACTAAGGTGGTACTGGTTTTGAAAGCATGAAGGGGTTATGAAGAGCAGCCGAGGCTTGGCACTGTGAGAAGCCGTGGAAGGCCATTGGTGAAGGTGCAGCCTCAGTTGCAGTTGATGGCCCAGGACTGAAGGGGTCATGCGGAGGATTTGAGGCTTGGCACCATGAAGAGAGCCTATGAGAGGCTATTAGTGAAGCCTAGTTGGAGTGGAACACCCCAGTGTATTGGAGATGTCAGTACCATGGGATGATCACCAAGAACAGCAGCCGTAGTGGACTGGATCAACCTGAGCTTAGAGTGCTACAGAGGGCAGAGCTGGAGAAGTGATGCAAGCCCTTAGGAGGAGTCCAAAAGATCAAGTGGAATCCAAGACACTGAAACAAGAAGCTGTAACACTGAAATTGCCTTGGAGACTCAATGATGTTAAAGATGCCAGAGTCATGGAATACATGCTGAGGAAAGCTGCTAACAGGGAGTGGAACCAGCCCAGGAGAAAGCAGTTTGTTGCAGATGAAAAAGGAGTGGATATCTGAAGATTGCTTTGACATCAGCCATGGAGATGCAGTGTTTGGAATTTGCCCAGCTGGTTTCCTGTCTTTCTTTGAGGATTACAGTTAAGAGATTGGATGAATCTCAGAAGAGACCTTGAACTTTAAACTTTTAACATTTTGAGACTGCTATATACTATGAGGACTTTGAAAGTTGGACTAAATGCATTTTGCATTATGCTATGTTTAAGTATGCCCCCCCCCCCATGGACTCAAATGTTTGAACAATCTTTGGGGGCCAGGGAGTGGAATGTGATGGTTTGTATATGCTTGGACCAGGGAGTGGCACCATTTGGAGGTGTGGCCTTGTTGGAATAGGTGTGACCTGTTTGGAGTAGGTGTGTCACTGTGGGTGTGGGCATAAGATCCTCACCCTAGTTGCCTGGACATCAGTCTTCCACTAGCAGCCTTTGGATGAAGATGTAGAACTCTCAGCTCCTCCTGCACCATGCCTGCCTGGATGCTGCCATGCTCCCACCTTGATGGTAATGGACTGAACCTCTGAATCTGTAAGCCAGCCCCAATTAAATGTTGTCTTTTTATAAGACTTGCCTTGGTCATGGTGTCTGTTCACAGCAGTAAAACCCTAACTAAGACACCTGGTTAAATACATAATGTGTTTGCAATTGTACATGAAATAGTTATTTTATGTTTAGGTGTTATGATGTCCTGGTTATTGTTTTCATTTGGAAATTAGTTAGCAAGGAGTGAATTTATGATGACTATTCTTGGTTGTCAACTACATCTGGAATAACTTAAAGCTCAAAGACGGAGGGCACCCCTGTGAGGGATTGCTGCTTAATTTGAAGTGGGAAGATCTACTTCTAATTCAGGTCTTTGAGATAGGAAGGCACACCTGCCATTTAGATCTTTAACAACGAACTAATCTGGTCCACACTTTCTGCTGGAGCCTAAGGACACAGAAGAAGGAAGCTTTTTCTCTTTTCCTGCTTGCTAGCAAGTCTATTCCTTTCCTGGCATTGGAGCCAGGATTCCAGTGTACGCTGAAAACCAGCAGAGACATCCAGCCTTATGGTCGGAGCAACTTAAGGATTCTTGACTTCTCCGTTCCTAGGCAGCCGCTGTTGGATTAGCTGGACTTCAGCCTGAAAGTCAATCTAATAAATCACCTTTTTATATAGATTCATTCTATAAATTCTGTAAGTCTAGAGAACCCTGACTAATACAAGGAGTATTCTCAAAGAAATGTGAATACACTGTACATTTTGGATTTCTGTGGGTGGGGTGGATTTTTGTTTTTGTTTGTTTGTTTTTTGATGGTGCCACAGATTAAGCACTAGAAAAATGCTCTATCACGATGAGAAACTAGGAGTTAGACACCCTGGTTGGCAGACAGGTAAGGAGCAGGCCAAGGGAAGGGAATATAAAGGTGGGAAATTTCAAAACAGCGGGCTTCTTCCTCGCCATCTTGATTTGAGGAAAGAACCCAGCAATTTAAAACAAAGGCCCTGTAGGCTTCCTGCCTCCTCTCCGCAGGCCCCCTGCTGAGAGACTGGCAGAACTGGTTCAAGGCAAGATCAGGACCGGTTACACCACAGTTGTGGGCTAATTAACCCCCCCCCCCCCCATGTGTCTGCTGTAGGACTGTGTGTGTTTACTCAATCCCAGGAACTGCCTTCTGTAGCTGATGCTGCCTCTGGTATTGAGATTTTTGTGATGCTGACAGTTATACTCAGGATTTTTCCTGCCTTTCAATTCTTTAACAGGAAGAGACAATGAACCAATCAAGACCTCTTGACTATATCAACTGAACTACACTGCCTACCCCAGAATATTTAACTTTTTTTGAAGGTCAGCTTGAGACTTTCAGTTCCCGAGAAAGATAAAACTTACTGGAGAGAAAGTGCAACGGATTGTAAAATACATAGGAACATTTATTTAGTTTCTGCCTTCAATATATATTTAACAGGTACATAATATTAATGTGGAAAATTAAGTAGTAAAACAAAAGAAGGGCAAAATATGTGGCTATATCATTCTCTTTTCCTGTTTGTTTTGCTTTTTCGAGACACGGTTTCTCTGTATAGCCCTGGCTGTACTGGAACTCACTCTGTAGACCAGGCTGGCCTCGAACTCAGAAATCCGCCTGCCTCTGCCTCCCAAGCGCTGGGATTAAAGGCATGTGCCACCACTGCCCTGCGACTACATCATTCTTAATTTTTGTTTTTATTTTATTTTATGTGTTCGGGTATTTTGCCTGCGTGTATGCACATCTTGTGTGCTCAGTACCTGAGGAGACCGGATTCCCTGAAACTCAAGTTCCAGGTTGTGAACCATCATGTGGGTGCTGTAATTGAATCCAGGACCAATGGAAACGCAGCCACTGCTCTTTGCTGCTGGTCCTTGTCTCCAGACCTTCAATTACTGTTGAACGAATGTAAACAACCTAGCCAACTAAGATACATTCACACATTCATTTACCCTGCCTGTTTCTGTATTTAGAATATATTCCATTCCTAACACAAATTTGGCAGTATCAAATAGTCTTAATCTGAATATTCAGCTGTTTATAACGTTAAAAAAAATTCCTCCCCCTTTTGCCCTCCCTATTTACCAATCACACTGCCAGATTTGATTAATTAGTACAGTTTGCTCTCCCATCCTGAAACTTTGTATTGCCACAGGCACACACATACATACTTCAAGAGAAGGGCATTACATAGTCCTTCTAAAGTTGGCTTCTTAGTATTTCAAAATCTTATCTTTGAACGCTTTCAGTATCAGCATACAAAATCCAATAGCTGAGGAGTCATACTTTATTGTTAAACATCATTTCCCACTGTTAAAAAACGTTACATCGGTTAAAAATTACAATCTACCTTCGTGTTAGGTATCTAGATTCTAGAAATCCAGCAAATCTTTCAAGTTGTGTTTTGAAAGGCGCTGAGGAAGCGCCGCTAGGATAAATCAAGTGCGAATCCGTTCTATCAGGTGTTAGTTGACCCGCTATTAATCCTAGCTCTAATGCTTACAGTTCTGATCTTTCAGATATCTGCCTAAAAGATCTAAATGCTTGTGGAAGTCTCTTAAACCCCCTCAAATGTAATCCTTTCAGAAACTCCAGACATCTCTGGGATTAAAATTTTCATTCTGGCCCTCGCTGAAGAAAACCGACCTCCCAGAGCCAAGCGAGGAACTTTTAGGACAATAGGGAAGTGTGATGCAAAAGAATTCCTTGCGGGAGAGGGCCGGGAGAATTCGCCTTCGCGCGCCTTCTCATTAGCATGGGCAAGCCTCCTCCCAGCGTGTGGCCTGTTGGGGGGTGACTGGTGCGCTCCGCACGCCTCCGCGGACGTGCAGGACCGGGAGTTGTTTTCCTGGCCGGGTCCGCGCAGCCACCCCTGCGCGCACGCCCGAACTTCATTCCCACCCCCACCCCGAAAGCCAAGGCGCAGACGCAGCCTCCCTGCGTCCACTTCCCCGGGGAGGGGCCGAGCAGCCGTGGGTTCCGGGTCGCAAACGGAAGTGGACGACGAATTTGAATTGTGCGAGCCGTTGGATGGGGCTGAGCGGGTTGGGCGTACGGCAGCGCTGCGGTCGACGTGAGCGGTAACGCGGCGAGCCTGGGACTTGTGCCCCGCGCCTGGTGAAGACGTGCCCGGGGACAGACGGAGGTGTCACGGGCGGCCGGGTAGGTGTGAGCGGTAGGGGGCTTCTCCACGCGCTGGACGTCCGCGCCCTGCCGCTGTCGAGCCCCGAGCTGCTCTTTATTAATTAAAGAGGGAAGGGGGGAGGGCTTCACGGAGGGGTGCCCGTTGTGGCTCCCAGTTGCTCTTGAGACCGGTCCCTCACCGCAGAGAAATGACAGCCTTGAAATGCCTCGAGGGGATTTAAGCTGAAATCCGAGTATCCTTTGTGTTTAAAACCGGGGTATTTTTCTTTCACACCTTGACACTTCTTGTGTACCGCAAAAATCCGAGCCCTATTGCTCATTTAAACTGGCTACAGTAGCAGCGGTGGCTCACAGATGTTAAGTTTGCTAACAATGGGGATAGGGTCTAGTGTCACCCCCAACCCCCACCCGTTCCGTCCCGTCCCCGCTTTTCACCCTCTTCATTCATTTGGTGATTGTTATTATCGAGTTATTTTAGAGGGACTCAGTGCCTCAGGAATTGAGTTTTCTTCGGGCGTTTTTGCTTGTTTGTTTTTTTGTTGTTTTTGTTGTTCATCTTTTATGATGAACTGGACTCTCACAAACCCCGACAAAAAGCCACACTTTTTTGAATAGCTGAGATGTACACGGTAAACATAAACTTTCTTTTGAAACAAGTTATATACTTTGCCTTATTAAAAACTGACAGGTTGCTTGTGTGTTTTGTAGAAAAAAGGTAACATCCTTTTAAGGTTTTACCAACTGGGTGACGGTGTCGTTAAAAATGCTTAAACATTTTAAAGTGGTACTTAGTAACATCCGAAGTAAGACCATTTCTTCATCCTCTTTCATGCCTGCTAATGAATGCTGTTTTCGATATTCAAGTAGGAAAAAAATTAAAAAGGAAGATCATTGAAAGTGTTTTCAATGAGTCTGCCACAAAGCTATTGGCTGGCCTTTCTCAAACAGTGCAGTCAGATCTGCTAGCTTCCTAAATGGTACCAGCAAGTAACCTGTTGTAGATTTTCTGTATCCTAATGTGCCTTTTGTTTGTTTGTTTGGTTGGTTGTGTTTTGTTGTTGTTTACCCACATCAGTAAATGTCACACTTCATTGTATGCATACTCCTTCCTATAAGGGCTCCCAAGCTGATGGCCTGTACTCAAACATCAGAGATTTTAACTTTCTAGAGGATGGACTTGGATAATGCCTTTTAACTGAAAAGTTAGACTAGTCTACCAGAGGTTTCAAAACATGGACTTCCTAGAACAACCTGGTAATATATTAGTTAAAGACATACAACTAGAACCAGACTTCTTGCTTAGAATTCCCATCCCTAGGACCTCATAGCTGTGTGACCTTGACTAGGGAAGCTGTTTAGCCTCTCTGATTAAAGTCTCTTAGGTAATGGGGATAAAGACTTCCTTGTGTGATTATTGTGGGAATTCTAGGAACTATTACATGTATGAGAACAAGATGCCAAAAATATAGCTACTAACCATGATGTAACTATAGCATGCATTTCCTTTTTTTTCCCCCTTTTTTCTTTTTTTCTTTTCAGTTTTTCGAGACAGGGTTTCACTGTGTAGCCCTGGCTGTCCTGGAACTCACGCTGTAGACCAGGCTGGCCTCGAACTCAGAAATCCGCCTGCCTCTGCCTCCCGAGTGCTGGGATTAAAGGCGTGCGCCACCACCACCCGGCACAATGTCTTTTTTTTTTAATTATAATTATTATTTATTTAATGTATACGAGCACTCTGTAGCCTCCCAAGTGCTGGGATTAAGTGTGTGCGCTACCATGCCCAGCTCTGAGTTATGTTCTTTCTTTATGCATCCCAAATGTAAATCCTTTGTCAGATACATTCAGCAAATGTTTTTTCATTGCACATCTTTCCATTTTCTTAACTTGGAAAATTCTTCCTTTGTCAGGATCAAAACTAGTTTTTCTCTTAGAGCGTTAATGTTTTTGGTGTAGTTTTTCTGTATGGAAGTCGGTGTTTATTTTTTCCTCCCAAACAAAAAGTCAGTTTTTTCTATAGTATTTATTGGATAGATTGTCACTTCTGGAGTTTAATTACCATCCTTTCTTTGCTGGGTAGCCATTAGGCGGAGTGGGAGGGAATTCAGCTTACTGTTATATTATCCATCTATTAACACTCTAAATCACCTCTGGAACTCGGTTTAAAATAAAACAAAAGTTATGGTAGTATGTCTGGATCAAGAATTAGGGACCACCTCAGGGCCTCTCTGAAGTTACATCAGACTCTGTCACCAGAAGTCTTAGATGGCAGCTTGTGCTTATATCATAAAGCTCATGTCTAAAGTACTGCATTCCATACTGAACAGACTTCTTCAAGAAACGTCTTGGAAGTTCTTGTCATCTGGCAGTAAGCTTCTAGACATGACCAGAGAATAAGAGGAGGTAGCGCACGTTTATGACATGGCAGTATATAAATTATAAGTGGTTTGAGCACTGCTGAGCAGGACAGTATGGCAAGTTCTCCAGGCACAATAGAAAGTCATAAAGTAGTGTTGTACAGGGTACTAACATGGGAGCCGAATTGCTCACAGGATGCCAGTGAACAGGTTTTCAAATTAAATAGAGTGCTTTGTTTTTCACAGGAGTTGCAGTTCTGGACAAACACAGTCCTAACATAGCCAAAGAAAGGGTCAAAGGAGAAGATGTTTAATGGGTATTGGCTTAATATTTATTCAGAAATGTAAGAGTCCAGGCAGTTATGTTGTGTAGGACTTTGTGGTGCACCATAGGGCATCTCACAATCTAGTACTTAAATGTTTTAAGAAATACTCTCTCCAGTATCTTCAAATCTGCCACTCTACTTGAACTACTACTTGTTCCCAAGTGAGGAAGTTACATACTGTATTATATAGTATGAAGTGATTATTACCTGATTATACTTATATACTGACTAAATTTAATAAAATGGTTAATGTGAGATTTTTGAAATTAAGATATCAATATGCTTTTATTTTTCCTAGTAAAATGAATGAAAATAAACCTGATAATTCACAAAGTCTTGGTAAGTAACTGAATTTAAAATATTTGTATTATAATAAAATCCATTTAGAATGCTATCCAGCCAGCACGAATGAGTATTCCGATGTATGCTTAGTTAATATGTTCTATTAAATTATTGTGATTATGTTCATTTCCACAAGCTAGATTTGCTGCTAGAAGACATCTTGTCAAATTTATTTTTCCATATTTTATAAGATCAGATATATTTTGAATCTGAGAAAACTTTAATTTTTAATGGTTTTCCCTTTGATAAATGAGGCCAATGAGTAGACAGAAGTCTAACGTGAAAAGGAAAATTTCTAAGTTTACAATTTTCCCTGTTGATACATCGCTGTTTTAGAAACAGAACCTGTTGACTTGCTACCATGAATGGTGAGGAATCTAAATGATTACTGTAGACTTGGATGCACTGCTCCTCCACTTAGGCTTGGTGGGGCTCTTACTTGTTTGGTTTTGAGACAGTCTCACTATGTTTTTTTCTGACTAGCAAATGCAATGTGCTCACTATGTAGACCAGGCTAGCCTTGAACTCGAATCCACCTCCCTCCCTTGTGCTTGGATCAAAGGTGTGTACCACCATGCCTGTGCCTAGCTTTTTTTTTTTTTTTTTTTCCGAGACAGGGTTTCTCTGTGTAGCCCTGGCTGTCCTGGAACTCACTCTGTATACCAGGCTGGACTTGAACTCAGAAATCCGGCTGCCTCTGCCTTCCGAGTGCTGGGATTAAAGGCATGCGCCACCATGCCCAGCCTCATCGACTCTTGAACTCCTCTATTTGGTTCAACTGGCAAGGAAAGCATCCAGGTTTCTGGCCCTTGGCACAGGAATTATAGACATGCACAGTTGAGTCAACCTTTTTTTTTTCCATTTTCAAGACAGGGTTTTTATATAGCCCCGGCTGTCCTGGAGCTCATTTTGTAGACCAGGCTGGCCTCAAACTCAGAAATCTGCCTGCCTCTGCCTCCCGAGTGCTGGGATTAAAGCCGTGTGCCACCACTGCCCGGCGAGTCTACCTTCTTTATCTGTTGACTCTACCTTATTTTGAATAAGGAATTTTGCTCCTACAACTCCTGCACCCCATATACCTGTTGTCTTGTTATGCCTCCTGATTATATCAGTAATGCCAGGAGTTGGGAAATGTTGATGATTTATGTAATACCGTTGAACATTGGTTGGATGTCTTCTTATCCCAACTTAATTTCCCACCAGGTTAATGCCTCTAGTCTTTACTTATATTAGTGTGCTTAATAGGAACCAGTATTTGCTGTCGTAAAAGGTAATTTTAACAGTAAATATAGTGAATTAGAACAGTTTTAATGAATTTTAACTAGTCTGATATAAAAATTAGAAAGTTTGTTATAAAGATGAATGCTTGAACCATTATTGATTCAAGGTCTTCTTAGTATTGGGTTGGATGTACCTCGAGATCCTTCAGCAGCCCAAGTTTGTCTTTCTTGTATTTTTATGAGCTTGGTCTATGTGTGCACATAAGACCCCGGTGCACTTTAATACATGTGTGAGCTTTTTAAACCCTTACTCCCAGATAGATCCATTCTTCCCAACTTCTAAACCAGGTTGGTTTTAGCCAATCAGCTGCGTGCCCCAGACTTTTACGACTATGGTTTGTTTAACCCTAAGAGAATTCTGATGCTGGTAAAAGAAGCAGGCATTTGCCTTCATCCCTTAGGGAGTTACCACATAGGTGTAAAAGCACAACCACCTTGATCTGGGAATGAGGTCTGAGTCACTTCCTTTTAGTCTAGCAGTCTGTTACCATAGACATGAATGAACCAACCAAGGACATCGAGACAAAATTGATCTGGGGATGTGCAGCAGCCGGTAAGATACTCGTCCTGCTGGTCTGAATGCTTGAGTTCCCGTCTCTAGAACTCACATAAAGTTGGGCATGATAGCACATGGCTATAATCCTAGTGTTCTGGGAGTGAGGCATCGGCTGGACACTCCCAGGAAGCCCGGGAAGCAGCTAGGAAAAGGGACATTAAAAGACATGAGGTCTCCTGACCTCCAGATGTGACCCATGGCCACTGGTCACATGTGCACACTTGTGCACATGCACATACACTTAGGAGAAGCACTAATCCTATACATTATTTTGTAATTTTAAATTTCTTTTCTTTTTTCTTTTTTTTTTTGCTGTTAGCTTGTGTTTTCTGCCGAAAAAATGATGACTGTCCCAATAAATACGGAGAAAAGAAAACATATGAAAAATGGAATTTTAGTGTCCACTACTACTGCTTGGTAAGTCAGGTGGTCTGCATTGCCTCATTGCTCATGTATACATCTGTTAATTCCTACCCGTTTTGGAGTGTATTTTCTAATTGAGAATATATTCATAGTTAATGTCAAGTGGAATTTGGCAGAGAGGTAAAGAAGAAGAAGGAGTTTATGGCTTCCTAATAGAAGACATCAGGAAGGAAGTCCAGAGAGCCTCCAAACTGGTAAGTACTTGCTATTCAGTACGCTGGGTACCACAGTGCTGCTGCTGCTGCTGCCTTGGGAGGGTTCTTCAGTCAGTCTGGATTAGAAACTTGACTACAGTATCTTATTCTGATGGATATTGTTACCACATATGATACGTTTTATTAAACATTTTTATATTTTTACAAAGAAGAGCTTAACCTACACTGAAAAACAGTTTATCAGGAGGGAACTTCTGTTCATTATTTCACTCATTCTCGGTTTGATTTAGTTTTTGAAGTTGGTCTACAAGCGTTGTTCTTTTTTTCTTCTTTTTTCTTTTTTTTGTTTTTTTGTTTTTTTGTTTTTTTTCGAGACAGGGTAACAGATGGGGAAGTATCACTAGTTACAAATGACCTAGTTTGTGATGCCCTGCAATCTCTAACATAGTCCAGTTCTGCCCAGCCCCATTCTCTCAGAAATAAGACTCAGACTCACAATAAATTTACAGTGGTCTTATTGCTAGGCTCTTCTCTTACAAGAATCATAACTTGCCAGGCAGTGGTGGCACATGCCTTTAATCCCAGCACTTGGGGGGCAGAGGCAGGCGAATTTCTGAGTTCAAGGCCAGCCTGTTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAGCCCTGTCTTGAAAAAAACAAAAATAAAAACAAACAAAAAAAGAATCATAACTTAACCCATTTATTTTAATCTCCATTCTGCTGTGTCTGGGGTTCCCTGTCTCAAGTACCATGTGTCTGTCTCCTCTCATTTCTTGGGCAACTCTCCTGCCTGGCTCTATCCCAGAATCCTTCTTCTTTCCTGGATGTCCCACATCTATTTCCTACCTAAGCCATAGGCTTTTTTATTGACAGGTGACGAATCAGGATACAACATACAATGTATCCTCTCTACAAAGTAATATATTTCTCTCCCCTGTCACTGTAGTCCATCTCAATGTGTGCCAGTTGTAAAAAGTAAGGTTGCTGGGAAAAGAAAGCCGTGTCACTCATGAGAACTTAACACAGAATACATAGAGAGGAAGCATTTATTTGCTGGAGATGGTCACTATATAAAAACGTTGGGTGAGTGGTTAGCATAAAGGGAGCCAGTGGTGAAATAGGATCTGGGGCTCTAGAGGAACATGCTCTGAATGGTTCCAGTAAACCAAAGGACTTGGTAGGGATGCAGTGTCAAGATTCCTTAACATCTTAATAGCAAACTTGGAATTAAGAGGAATCCTCCTTACAAGTTTTGGTAGCTGCTAGTTTTCTTAATATATACAAATTCTCTGCGTGCACTGTGAACCTTTGGGAATATTTGCACCTGAGCGGAGTGCTCCCACACCAGAAAAAGGTATCAGATCTCATTACAAATGGTTGTGAGCACCATGTGGTTGCTGGGAATTAAACTCAGAACCTCTGAAAGAACATGCAGTACTCTTAACCACTCATCAATCTCTCGAGCTGTGGTGTATTTTATCTCAGCAATCTCTCGAGCCGTGGTGTATTTTATCTTTAA
D3_15 52277895 52292945 15051 TACTTGTATATAATCTATTCTATCACATGATTGTCCCTGGAGTTCATTCTATCTGGTGAAACTTGAGTTGCAAGGCTATCTGAGATGGACGCCAAGATTATTACTCACATTCAGCCTTCAGCTCGAGGATGAACTTTTGATTTATATTTCTGTGAAACATTTTATCACTCAGTTCAGAAATTAAATTGCCTTATAAACTTTGTTGAGTTAAAAAAAAAAATCAAACTTACTATGGCGTACCCCCTGAGTACAGCTTCAAACAAGAAGATTTTGTGAATTTTGGCATTTGGTACCCTGAGTATTTCTTGAGTTTTTTGTATTTCTATTTATATAATGGTTAAGCAAAATGGGATATAAAGGAGCCTTAGAGAATACAAAGGAAAGAAGAAGATTAGGAACAGTTTGTCACTTGCATGTGACGTGTCACATGATAGATGTTAAGTTCTTTTAAGTTAGGTGATACTGAATACAGTAGTGTGTGCTCCCTGGGTACGAGGGTAAATAGACTATTAGTAATTAGTCCAGTAGTGTGTGCTCTGCTGGAGTACAAGGGTAAAGGTCCTCTGTTACTAACAAAATACTGATACTAGTCTTGAGGGAGTCTTACCTCCCAGAGTTTGTTTCAAAGCATTTGGCTTTCCTTGAGTACAGGATGCTAGACTATAGGGCCCACATATGTGAAACAGAAGAGATTATAAACTGAGTTGTGTTTTTCTCTTCCTTATATATTCTTTACAAATTTCTACTTTTAGGTCATTTTGCTGGAAACATCGACCCGTTCAAGCAATTACATCTAATAAATATAGTAGTTCTTTACCATGTACTATCTGTTTGGAATTTGTCGAGCCTATTCCTACTTATAACATACTACAAAGTCCCTGTTGTAAGAATGCTTGGTTTCATAGAGACTGTTTACAGGTAAGATAGCTTTTTAATCTTTGACTCCATAATATAAAATCTATTGCTTATCAATTTGAATTTTAATCTGGTGTCATGAAATATATCATAAAATACCAGTATTCCTCTCTTGGAGCCTATTACACTCTTGGGAGCTCTCGTCTCACTTCTTAATCTGTGTTTACTCTGCTCAAACGAAGAAACAGTATCCTAAAAATCAGAGGTCGGCTCCTCATCGAGTGTGTGTGAGTCCCCTTGGATTAATACTCACTGAAAACAGTCCGGTGGACTGCATTCTCAACTTGATTGAATGGCTTTATTTAGAACATTCTTATGGTATAGAAAGTGTTGTTAGTCAAAACCAGGCCAAATAAAGATTTACTTAACTTTTTAACTTGCTTTGTAAAGCTTAGATCTTGGTTTGCTTAGTAAAATAAAATGGTTTGTTATTAACTGTTCAGAGTTATCAGATATTAAGTTGCCTTCTATTTCAAAAAAGACTCAATGGAGCTTATCTGATTTCTGGTTTTGTTTTGTTTTGTTTTTAATAATCTTAAACTTTTATACTTCGGTTATTCAGTTAGAGGTGATAAATTGGAGCCTGTTTTCTTGGAAATGTTTGCTAATTCTCCATACAAACGTATGTTTTAGAGAACAGTTAATAACCATCATGATGTGCAATTTAATTTTATGTGAGAGCCTTTTAAAAAGGAATATTTCTTAAAGATTTGTGTTTAACGGACTTTAATTATTGATGAGTGTGTCTTAATTTTATAAAGATTTGCTTTGTATTTGTTAATAATAAAGTAGAGAGAGTTCTTAGATTTGGCCTAATGTTTTCATGAACTCTTTGTCATTTAAAACTAGAAGCATTGGACTGGGATCTAGCTCCTTATAGAATGCCTGTCTGTCTGTCTGTCTGTCACACAGACACAGACACACAGATACACACACACAGACAGTACTATATAGGGAGAGGGAGGCAGACCGTAGAAATAATGCTAACAAAAAACTGTTGTTTTTATTTCAAAACATTAATTCAGAATTAAATCCACATAGCAACCTGACGGTTACATAAATGTCAGTAGGAGTTGCTATAATTAGAACTTGTTAATTCTTCAGTCACTTTCTCTTAACAGAATCTATAGAGACTTTTCCACTCATGATTACAGAACCTAACGAAAATCTGAACTAAACCCACTCTGGCTTACAGTATATGGCTAAACAATATTTCTGACTACTTTGATTACTGCATGTAGAAATTTTGTGAAAAGAGACTAGACATTAAAATGAAAAGAGTGCTACTGCCCCAGTTTGGATCTCTCTGTCATGGTCTGGTATCCTCCAAATGTTTTGTGCTTGCTGTTCAACCGGTTTTGTCTCTGGGGTTGTTTCTGCTTGTTTCATTTTCTATCAGATATGTCTTTGTATTAAACCTCATGTTTAGTAAGATACCTTCTTTTGTCTGCAATGAGTTACTGTTGCAATGTAGTACTTGGTGTGTGTGGGTATCATTTGCCTACCATCCTCTTTCCTGCTTTAGCATCCATCAGCTGTCCCTTCAGCTGTATCAGTCCACCTTGTATTGTGTGTCCTTCTCTCTTGTAACCACTCACTCGCTTCTCTAAAATACCAATTGGAATTCTAGGTATATTATTTCCTATCAGTTATGCTATTCTTAAAGCATAGTCTTTCTTCTGCATTTGATTCACCTGTTTAATCTTATTAATAGTTCAATTTGCCCAGAATGTCATATCAAGATATATTGTCAATTCTAATTTTCCTAATTGCATGTTCTCTGTCTATCCATGGATGTGGTCCTTGAAATGTCTTCCTATTTTCCTTTGTTTCTTCTAAATGGGTTTTTTTTTCCTCTTTCTTCATGTATATACTTTAAAAAAAAATGGCACTTTTAAAGCTAGGCATGTCAACACAGTAGTACTAGGCAGTAACTTCAGCATAGGCCTTTATAGGATGGTAGTGGAAGGGTTCAGAGATAAGATTCTTGGAGCTCATTTCCCAAATCAGTCTAGCTGAACAGATGAAAAGACTGACTTCAGCCTCTGACCTCCATATGCACACCCACGCACACTCAGGAAGACAGACATACACTACATACACATATGAATAATACTTTTACACATCTATGTTTGCACACGGTAGATAACATTTTCTGAGCAGGAAGCAGCTGCTCCAGGCTCCTGCTCTGAGTTTCTTCTCTCAGTGATGGTGTGACCTAGGAGCTGTAAGACAAAATAAAAATAAACCCTCCTCTTCCGATGTCAGTGTTCATGAGTGTTTTCTTAATAGTGACAGAAAGCAAACTAGAATAGTATTAAAGTTTATGAAAGCAAATTGCTGACTGCTGAAAAGGCAAAAATCATGTATTCATTAGATGTTTTTAAACTGAAAAAAAGAGTTGTCTTTGTTTTGAGTGGCTTTGCTTATCGTTCTAACAGGAAATATTCTCATGATACAGAAAGGCAAAGAGCATGTTCTGTTAGTTATTTAATTCACAATCTGATGAGAAATGCATTGCTAACAATAGATTTTCCCATTTTTTGCTGTAGGTCCAAGCAATAAATGCAGGAGTGTTTTTCTTTAGATGTACACTATGCAATAATACAGACATCTTTCAGAAGGAGATGTTGAGAATGGGAATTCATATTCCTGAAAAGTGAGTAACATTTGGCTTTTTGACCAAAAAGCATTTAAATGTAGTATTTACTAACATTAACAATGACTGTGTGTGTCTGATTAGTGATTGTGGCTAAGTAGCCATGCTGCATTGAGTCACATGCCTCGTCCCAGGTGGCCAGCTTTTGGAGAATGTGCACTATAATGACAGTACCCAGTTAGATGCTGTGTCTCCGTCCAGTCCAGTTCTGGGTGATTTGTATAGCATCTTTAAGTGATCTGAGCCAGGCTAAATGGGTTTAAAATGGAAAAGGAGAATTTTAGTAATGCCCCACGGAGAGAAATCCTGAGTAGTGATAGCAACCTTGAGAGTAAAGCTTTGGATGCCCATCCTTGAGAGGCTGAGGCCCCCATGGGCTGGGAACTGAGTTCCAGGGTTGCCCAGGCTCCAGTCTTGGGGCAGAGAGTGAGAGAAAGAAATAGCAAACAAACATGTATAGTCCTAGCACTTGAGAAGCTGGAGAAAAGCTTGAATTTGAAGCTAGCTTAGAGTGTAACAACAAAAATTGAAATACTAGAAAAATGTAGGTTTTAGAAAGTTTGTTCAGCTTCTCACATAGTATTTGAAAGTTCACTGTGAAATTGACTATAAGGGGGCTGGAGAGATGGCTCAGCGGTTAAGAGCACTGACTGCTCTTCCAGAGATCCTGAGGTCAATTCCTAGCAACCACATGGTGGCTTACAACCATCTGTAATGGGATCTGATGCCCTCTTCTGATGTGTCTGAAGAAAGCTACAGAGTGCTCTTATACATTAAATAAATAATAATTATAATTAAAAAAAAAAGACATTGTGCCGGGTGGTGGTGGCGCACGCCTTTAATCCCAGCACTCGGGAGGCAGAGGCAGGCGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAAAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTCGAAAGACATTGTAAGGTAAATTAACATAATGAGTTTCTGTGATGAAGAGATCAGCCTAAAAATGCTAACTTTAATCCTTGTCTGTAAATGACCTGTTAAACCAAAGCACACTTTATACCTCCTCTCATTATAGAGATGCATCCTGGGAATTAGAAGAAAACGCGTATCAAGAGCTGCTGCAGAGCCACGACCGCTGTGATATTCGAAGATGTCACTGCAAAAAAGGCCGAGACTACAACGAACCTAACAGGTGATTCTGCAAGCTTATGTTGAGTTGTCCCTTCCTGAGATTTAGCTAAGAAGGTTGCTTTTCTGGTGACTTAGAGGATGCTTGAGGCTTTAACGTAAGATTGAACATGTTTATTTAGTGTGTAAGCAGAAATACTTTGTAGTCACTATTGAAACTTGTATTGTAAATTCTTATGAGGCTATTCCAAGCTGAGGGGATGTTGTAAGTGTAAGTTACACAGAGCTCCTCTAACAATGCACGGAAGATTGTTCAGAGGCTAGAGTCCCAGAACTAGGGCCTTGTGACTGATTTCTCAAGAGTTGTCTAGAGATGATGCAGGTGTCTGTCTCTCCACTGTGGTTTTCTCTCTTGTCTGTGGCCTATCATTCTCTCTCTAAAAACATGTTATTGTTCCTGTTCACATAATCTTATCATAAGAGGCATAGAGTGAAGGAGACTTTTTTTTTTCATAAAAAGTGGTCTCATGTATCATGTTGTGGATGTGATAATCTCTGAGTGCTGGCCAGCTTTTGAATTCTTATTTTGTATTACTATCATGGTTTAACCTTTTGTCTCAGGACACAAACAGCTGGTACCTAGATGTTTGCCTCAATTATTGTACACTTTGCATTCTAATGGTAAAAGGCAGCTTAGGATAGTAGCTGGACCATGGGTCTAAAATCAAGGTAAAAACTTTGTGGGAAACCTTACTCTAAGGCATGCAGCAATATATTAGCTTAGGGAAATTAGCCCTGTGTGATTAGGTTTCCTCCTCTTAAAGAATAGTGCTTCTTTCTTCTTTCAAAATTGGGAGAATCTTAAAGAGGGCCTTGTATGTAATAAACACTTATTTTCACTGTCTTTTTCCTCATTGTGAGTGGGCAGAACTATCTTTTAGAAGAGAGTCAGGCACTTATGCCCTATCCATCCACACTCTCAGGAGAAGATGCCCACACATACAGGTGTTGGGAGAATATCTAGCACCTAACTGCCACCAATATTTTCATATATTTAGGGAATATATTTGTCTCTGTGCAAAGATTGTGTACTCATTCCCACACAGTGTGAAAGAAGCATCCTGCCTATTACCTTTATGTGTGTTGAATAGTTTTATGTCAGCTTGACACAAGCTAGTCTTCTGAGAGGAGAGAAACTCAATTGAGACAATGCTTCCATAAGATCTAGATGTAGGCATTTTCTTAATTAGTGATTGATTTGGGAGGGGCCAGTCCATGTGGGTGGGGCTGCCCTTGGACTGGTAGTCCTGGGTTCTAAATGAAGGCAGGCTAAGCAAAATATGAAGAGCAAGCCAGTAAACATAACCCTTCCATGGCCTTAGCATCAGCTCCTGCCCTTGGGTTCCTGCCCTGAGTTTCTGACCCATGTTCTTACGGTGATGGGCCCATAAACCCTCTCCTCCCAAAGTTACTTTGGGTCATGGTGTTTTACCACAGCAACAGAAACCCTAATATGCACCTGTATGGGAATGTATATGGATTGTCCTGTTACAGGGCACAATGAGAGATGGAGGAGCAAGAGTATGAATCTGAGCCAGGAACAAACTATAGATCGTGCTATGCTGCACAGCGCCTGAAATGTCACAGCAAGGTTTTTTATTTGTTTGGTTAAGGATATATACTGTGTACCTTGATGCTGCAGATCAGATACTGCTAATACTTGATGCTTCCATATCAGACACAGTGAAAAAGTAGTCTCTCTGTAAACGCACTGTCTCAAATGTAAAGGAAAATATTTTTTTCTGCTTATCATAAGCCTCTCTGATAACTACAGTCTTTGTATATATGTGTGTGTTGGTATTAGTTGAGGTTTTTAAGGATGTTTGGAGGAAGAGATTACAAACTTAAAATGAGAAAAAATACTTTAGAGTCAGGTGTGGTGAGGCATGTCTGTAATCACAGCACTTGGGAAAATGGCCAGCCTGGGCTACATAGTGATTCCAGGCCAACCTGGACTAGAGTCCAGACCTTTCCTAAGTCAGTCAGTACTTCAGAGGGGGAAATGAAATCATATAGTCTTTCCTTCCTTTGGTAGACTGGTTGTGGTTTATAGCAGTGGGCTGAACTGTAGGCACAGCTAGTGATCTGACTGTAATCCAGCACTAACAGAACACACATCTATACTTTCCTTTATGTCCTCAGCAAATGGGAAGTAAAGCGGTGTCAGAGTTGTGGTTCTAGTGGAACACACTTAGCCTGTTCCTCACTACAGTCTTGGGAACAAAATTGGGAGTGTTTGGACTGTAGAAGAATTACCTACACTTCAGGTAATAGTTTGTAATTTTGAATAAAGATGCTTCTGTTCAAGTGCATGTTGTTGAAAATGTTTTGCCTATGTTTTTATTGAGCTAACTTCGAGATTTAAATATGTAGATTTCCAAAAGGCCCCCAAACACCCATTAGCCAACTCTACTAATGTGACAGTTACTGACTGCTTGTTGGAAGAGTCATCATCTAAGCTCCCCAGACAGTCAACTGTAGCCCAGCATAAAGAACTACTGAGGTAAGTAAACATAAAAATCACTTTGAAGAAAATTATGACTTCAGATGCCACTCGTACACAGGCTATTGGCTGATCATGCAATTATTTAGAAGAATGAATTTTCAAACTGTAGGGCCTATCATGGGATGCAAGAAGTCAGGGAAAGGTGAGGGAAAATAAAGTAGCTGAGGGTGCTCACATAGCTGTAGTTTGAATTGGAGACCAGCTTGAGGCATGAGGATCTGTGTCATAAAGGAAGTTAGGGAGGAAGAGTGAAGGGAGGGAACTGGGGTGAGGACAGCAAAATGTCAGGCTACATTAATCAATTAGAGTCTATACATTAATCTATACTGAGTCATAATATAAAATAATCTTAAAGATATAAACATCATAGAAAAATATCTTTCCAACATTACTTGATTCCAGACTAAAGCAAGAAATTCAGTTATCAACCACAGCATGTATTTTTAGAAGACAGTCCTGTTTAACACAAAGGTTGGTTTTTGATGCTAGAATCATTGCTTGCTTTCTATATATAATCAATGTCAGGAGCCTTAAATGTCAGCTCTTTCCCTTTAGAAACTCAAGGCTTATCTGTAAATATTATTGTGCTTATTTATTTCTACTTCCACAAAGTTCTAAACTAAGTAATTCTAAATTTTATGTTTTATCGGGTATATTTTTATAGTTATGATTTTTAACTTTGCATAACTAAAAAAAAGTTGGAGTCTTTGCACTGTAGAAAAATGTAACTGCATGAAGTTCTTTGTTGTAAAAAAGGCTTTAAAACACAAAAAAGGGAATTTTTTTGAAAATATTTGATAATTCTGTTTGCAGAAAAGTAGACTATTAGATACTTGCCAAAAAAGTGACTTACTAATTCAACTGAAAAGCTTCTTACAATAAATTAAGTACTTTTATTTTAAAAATGATTCATTGTTTTATATTTATATAGTTTGAAAATAATTTTGATGTTTAGCTTTCCAAAGATGTTGCACTAGATGAACTTGACAGTTTGTTTCTGTTTTAATGTCCAGTCATATGCCTGAAGAGTAGCACTGACATTTTAAGGAGCAAGAACTTAGCTGTTATAATACCATGTGTGTGCAATGTTTGGGGTAGGACAGTGTTACAGAGAGATGATCTGTGTACATTGAGTCCATTACTTCTACCTGCAGATGGAAAACCTGAGGCAGCAAAAAGCTCACTCATGTGACCCATGGATGTTAGCACACAGAGAGTGGTTCGGATTGGAGCTCAGGGATGTTTATTTGTAACTCGCTCATGTATGATGCTGTTGCTCTAGGACCACACATTTAAGAATTGTTGACCTAGAGGGTCTAGACTAAAATTTAAGTGAATGTGAGTTCTGTTGCTAATATTAGCTGTATTATCCGTTAAAGCTTCATTGTAGATAATTGTTTTAGTTATTGGCAAGGAAGGAAGCAAGAATTCAAATTTTATACCCTTAAATCTGAGTCCACATTAGGCATTCAAATAATCTTCAAGTTGCTGCAAATGATCATAAGTCGGTAGATAGTTAGAATGGGGGAATTTAAGAGTAGATAATCAGATAAATGTTTTTGGTTTGGTTCCAGTATTATAAAAAGAATATCTTTTTAAAATTAAAAACCGAACAAAACAGACAAACCTACAACTTTTAATGCTCTATACCTGCTGTTTCACATAAACTCCTTTAATGTTCTTTATTCAAATCTGTATTTTATAGGCAAGGCAGCAAATTTAGGAGAGACATTTCAACAATATTGATAGAGTTAGGATTCCAAATTAAAAAGAAAACTAAGACATTATACATCAACAAAGCCAATGTGTGGAGGAGTGCCTTAGAGCAGTTCCAGAGCCAGAAGTTTAACCCTTCATGCTCCATTGACGTAGTGTATGTTAATGGCAATGAGGTTGGAAGCCAGCATCTTGGATCAAAGCAGGAATTTCTGAGTCACTTAATGCACCATCTTGAGAATTCATCAGTGTTTGAAGGGTCCTTGGCAAAGAACTTGTCTCTAAATTCTCAAGGTAATTATTTTTATTATTATACACACTGAAGGTAGTATGTGTAGCCAAAACCAAAGTACTTGGTTTGAATATTCTTTAGGTATATCTGGAATAAATAATTTACATTTGTCGGTGAATCGGAATTTGATGGTTTTGAAAGTAAAGGCTGGAGTCCATCTGGGTTTGGAGAAATGACTTAGTGCTAGGAATGCTTGCTGTGCTTGAGACGACTCAAGTTCTATTTGCAGTGCCCACAGTAAGCAGCTCACGGCTCCAGCTTCAGGGCATCCAACAGCTGGGCCCTCCTTGGGCACCTGAACTCTTTTAGATACACACACACAAGGTTTAGTTATGCAGACTTGGAATCAAAACATAATTCTTATATCTGTACTATAGCCGTATGCTCAATGATTTCATAATTAAATGTTTATTTAGATTTGTATTTTCTTGAATTTCATTTGACTCACATCACCAGGTGAAATGAATAGTTATTTGGGCTCTTTTTGTTCATTCTTCTTAGATTTTTGAGACAGGGTTTCCCTGTATAGCCTTGGCTGACCTGAAACTTGCTCTGTAGACCAGGCTGGTCTTGAACTTAAGAGCCCAGCCTACCTCTGCCTCACAAGTGGGATTGAAGGCATGTTCACTGTAATTAAGCACTCGGTGTTTTTTTACCACATGGACCTTATGTTAAGTTTGTTTTATGATTTATGTCTGTCTTTTTTTAAATGCACTAAGTCTCAGGAATGAGAAGCTAGTGTGGGGCTACTGCTCTGGAGTTACCACTTTTACATGGACTTGGTGTACAGGGCTTTCTTTTAACAATTTCATATGTGCCTTTCTATCTTCAGGTAATGATCTATTTTGGTTGAGTAAACACTTGAGAACAATGGGTAATGTGTTTCTTCTTAGGAGTTTTTTGTTACAAGGAAGTTGAAAAAGAATAAGGAGATTTATTACATTTTAATTTCTTCCTTTGTCTTATTGCCTGAAGCATACTTTTTTTCTATTTATAAACAACTTAGTTCTACCCCAATAATGCCTTCCCAAATACTGAGTTGTTACTCAAGGTAACTCTGGCACGGTGAGTGTAAAGCACGGGAATGTAGCTATGAAACCTGAACTTAAGTCTGTCTATAGCCATCTAGTGGCTCTCACTTCCATGATGAATTACCCTCCCGCATATAGGGTTGTTTTTTTTTTTAATCAGCTAGAAAATCTAGCTGCAAATAAGATTGTTAATGAAGATATAATATTCTAAATGTTACTTATTAATTGTTTTGAAGAACTAGTATAATTATAAAATAACATTTACATAGCTTTCTTGCCCATCAGAGTTACTGATAAACATTAATAACCTTTTTTAAATATTTAAAGCTATGAGTGTAGTATGGTAGCATTTAGTATTGAGTAAACCTCCCCTTTTGTAAGATAATAATATATAGCACAACCTTAAAAATGTTCATATGCTTTGATTCACTAATACCGTGTGTATGAATGGATCTGCTCAGATCCTGTAAGTGATTGAGCCAGCATATGTAAGCTGCTGGTGGTTATAACATGTCTCACAATTAAGTAGGTTACCGAACCTGGAGAGCCAGGAGGAAAGGATGCGTTGCACGGTAGTACATTCTAGTCTAATGCATCTAAGAGCTGTGGTGTAAACCTGTTTTGAATAAATTTAGAAAATTTTACATTATTGTGCTTGGGAAAAACAGGAATCTAACTATGTGTATATTTCCTCAATAACAGACCAAAGTAAGCCAGGGGATGTACACTTAACTGAGATACAATTAATTATAATCACAGTTTCAAAGATTATTTCGTGTGAATGAGTGTTTTGTTTGCCTGTATGTTTATGCACCACTCATGTGCCTGGCGCCTGCAGAGGTCAGAAAAGTGCAGCAGATCTCCCTGGAGTTGGAGTTACAGATGATTGTGAGCTACTGTGTGGGGGCTGGGAACAGAATCCATGACTTCTGCAAGTGTCATAACTCCAGCCCCTGCTCATAGTTTCTTTTCCCAGAGATTTACATTTTGTTCTACATTAGGTTATTTCTATCCAAGTGGGATGTTTTCAAATAGATTTCTAGGGAAGGTCGATATACAGGATGGTAGCTTCCTATATATACAGGATGGTTATTTTACAAATGTTTCCATTTTTAAGTTTCTTTCTAGCTATATATGTTTTTATTTTAAATTGTCCTTTATAGTTTATTTTTATCTGTATTTACAGCTGTGAAAGAGAATCTTTACTATGAAGTTGGCAAAATGCTTGCCATTTCTTTAGTTCATGGTGGTCCTTCGCCTGGTTTCTTTTCTGAAACCTTGTTTAACTGCCTTGCTTATGGACCAGAAAATACTCTACCAACTTTGGATGATGTATCAGACATTGATGTTGCACAGATTATAATCAAGGTAAGAAATATACCCGCTCCTTAAAATATAAATTACATTCTAGTTGTATTTTAGTATAAGTGATAAATCTGTAATATGTACCTAAAGAGTTCAGAACCATTTCAGAAACCAATATAGGTGGGCATGGTTGAACATGCCTGTATAAATGTCACCAATTTAAGGCTTCAAGGGTAACCTAGACTGCATAGTGAGACCTGTTTTAACAACAATAGGGGCTGGCGAGATGGCTCAGCAGTTAAGAGCACTGACTGCTCTTCTGAAGTCCTGAGTTCAAATCTCAGCAACCACATGGTGGCTCACAACCATCCATAATGAGATCTGATGCTCTCTTCTGGTGTGTCTGAAAACAGCTACAGTATACTTACATATAATAAATAAAACTTAAAAGTAACATAAAAGTCAAGATAGTTAGAGGTAAGCATGCTAGATTTTAGAGAGTGGGGACTAGCAGATTAATAGTCTGCAGGATTTGCTGGCTGTGGTAAGTGTTCATGCCTCAGTGTGTATGTAGATGCCAGGATGCCAGAGGGGGGAACCTGTGGGAATTGGTTTTTTTTTTTCATCATGTGGTTTCTAGGATGGAAAATGGACATCTCTTATATATTTCTTGGCATAATTTTATTCTACCCTGTTTTACTAAAGAATTGAGTATAGGACTGGAGATATGGCTCCATAGTTAAGACTGCATCTAGTGAGTCACGGGGCGTGGTGCTGCATGCCTTTCATCCCAGAGCTTAGCTGGCAGAAACAGGTGGATCCTACAGGTCATGGTCAGCCTGGTCTGCAGAGAGAATGCTAGGCCTGACAAGGGACTGTGTAGTAAAGACTCTGTCTCAAAAAAGATGCTACTGCTTTTGTCAGGAGATGCAAATTAGATCCCAGCATGCATGCATGGCAGGCAGCTCCCAGTCACTTGTAGCTCCATATCCTCTACAGGCGCCTGTACTCACAAGCACGTGCCCTATACACAGAAAAAAAAAAAAAAAATTAAAGAACTTTATAAAAATTGAATAAAAAATGTGTTATCATTTGAATTGCAGCAATCGCTGAGAATAAATGGGTAACATGAGTATATTTTTCCTGTTACAGATAGATTCTGCAACTGATTTAAACATTTTAAATTCAGTAATAAGCCAACACTATAACTACTTAGAGGTCAGTGGATGTTTAAGACTTACGACATCATTAAGTGATAAATTCATGTTGGTAAAAGACATCCTTTTCTACCATGTAATTAATAGAGTCAAGGCACCTTTTGAGAGGTAAGTTGCCTATTTCTATGTTAAAGATTCTATAAAATTACTTATTTATTTGGTAATAAATATAAATGTTTAATTTCAGGGAATGTTAATGCTATTTAAAATGTTAACCTCTCCTGAATAAGCCCTGCTTTAATTCTGTCCAGATTACAGGAACGGGTTCCTCAGGGACAGCCAATCAGCAGTTCAATTAGTAGTCTTTTTTTCCTAATGAAAACTCGCTTTTGTAACCATTTGAACTACTGTGTCTACTCATTCGTGTAGTCAGTATTGCACACCTGTCATCTGTTGGGTAAATAGGAACCAAATACATTTGGCTTTTACTTTTTTTCTTTAAGGCCCAGGCTGTCTTCCAAGTGTTTACATAGCTAAGGATGACTTTGAGCTGTGTTATGCCTTTTCAACTTCCCAAGTGCAGAAATGACAGATATATGCTGTCATATCTGGTCAGTAATCCCAAGTCAGTCCAATACTTAAGGATAATGTGGAATTATGGGCCAAGGTTCTTAACCTTCCTAATGTTCCAATCCTGTAACACAGTTCCTCGTATTGTGCTGACCCACAACCTTAAACTTGGGTCATTGCTACTTCTTAATTACTTCTATTTTTTTAAATATTTATTTATTATTATAAATAAGTACACTGTAGCTGTCTTCAGATTCTCCAGAAGAGGGCATCATATCTCATTATGGATGGTTGTGAGCCACCATGTGGTTGCTGGGATTTGAATTCAGGACCTTCAGAAGAGCAATCACTGATCTTACCCACTGAGCCATCTTGCCAGCCCCCCTACTGTGGGGAATTGCAGGCTGGTCTCCAGTCGAGCTGAGGTCTGAACCCCAATGGTCATAATTCATCTTCATGACATTGTAGGCATTCCCTCGTGCTCCTGGAACTCTGGCCCCTGCCTAAGGTACCGCCTCCCACAGCCCACACAAGAGAGAAGCATGGTCAGTAGTCACATAGACAAAACTTCTGTAGCCCCAGGTGTATAGGGGAGAGGTTCCCAACACTGACCAGAGTGTGCAGCAGATCTTGATGGAGCAGAGACTCTTTATGGTTTAAGAGCTTTATTGTAGAAATGCAGGGGAAAGAGAAGGGAGAAAGAGAGGGAGAGCTAGAGAAAGAGAGAGGAGGAGGAGGAGAGAGAAGACAAAGAGAGGGAAGAGGAGAGAGAAGTAAGAGAAGTGAGAGGTAAAGGAACAAAGGAGTAAGAGAGAGTAAGAGAGCAAGGTGGGGGCTGAACAGCCGTTTTAATGGTCTTCACTGTTGCTAGGTAACTGGGAAAGAGTTTAGCTTGAAGGTCAGAAGCTTGGGCCATTGCTTACATGATTACTGGCCATGCTTCTCTTGTGGAGGCTGTGGGAGGTGGTACTTTAGGCAGGGGCCAGAGTTCCAGGAGCATGAAGGAATGCCTACCATGTGATGAAGGTGAATCATGACCTTCGGTGTTCAGACCTCAGCTCGACTGGAGACTAGCCTGCAATTCCCCACACTCTACCTGTGTTTCTTGCAATCAAAGTTCATGGTGCATGTACACAATGTAGGGTTTTAACATATAGTTTGATGGGCAACCAAGAGCACTGGCAGTCACCTCTTTTACAGACCTCTGAGCCACCTTCTTAAGGGACTTATCCTTAGGATTCCTTTTATTATTCCTCCTCCTCCTCTTTTTTTTTTTGTTTTTTGTTTTTTTTGTTTTTTTGTTTTTTTTGTTTTTTGAGACCGGGTTTCTCTGTGTAGCCCTGGCTGTCCTGGAACTCACTCTGTAGACCAGGCTGGCCTCGAACTTAGAAATCAGGCTGCCTCTGCCTCCCAAGTGCTGGGATTAAAGGTATGTGCCACCACTGCCCGGTCCTAGTATTTCATTTAGTAGCCATGTATAGGAAGTTTATCCAGTCATGCAACGTAGTACTTACTACTTTCAATAAAATACAATTTTAAATCTAGAAAGGCAAGTGATTATTTTCATAATTATTAATCCAGTTGCTTGTTGATTTGAAAGTATATCCTAGTATCTTATCTCATATCTAAAGGCATGTAATAGTTCTTGTTGGGCTGTTTTGTTTTTTGTTTTAATTGGCTATTTATAAAGTGCCAGGTAAGGGCT
GF3 -1 -1 1 CAGTGCAGTCAGATCTGCTAGCTTC
GF4 -1 -1 1 CTGGCTACAGTAGCAGCGGTGGCTC
EX52 -1 -1 1 CAATTGGATGTGTGGTACCCACGTGTAAAC
EX32 -1 -1 1 CAAGGCAAGTGATAACTTCGTTTACACGTG
GR3 -1 -1 1 GTAGTTATCAGAGAGGCTTATGATAAGCAG
GR4 -1 -1 1 CTATGCCTCTTATGATAAGATTATGTGAAC
Comments:
Target: otter_flex OTTMUSG00000031423 -- 52277501 -- 52277625 OTTMUSE00000456670 -- OTTMUSE00000456670
creating candidate regions
attempting to insert candidate regions into db
done inserting candidate regions
running aos on us and ds
running aos on gaps
finished running aos
AOS Produced 8 oligo candidates from u/d regions
AOS Produced 14 oligo candidates altogether
inserted results of aos runs
Aligned target to NCBIM37 assembly: chr: chromosome:NCBIM37:12:1:121257530:1, start 52456867: end 52456992
Found 12 RP24 black6 bacs on NCBIM36
Found enough RP24 bacs: not looking for RP23
Entered all non-repetitive oligos
Sequence count unchanged by blasting
finished aligning oligos to bac
REJECT (1) gap pair G5:chr12-03:52272001:52273000_55 G3:chr12-03:52282125:52283124_315
REJECT (1) gap pair G5:chr12-03:52272001:52273000_55 G3:chr12-03:52282125:52283124_683
REJECT (1) gap pair G5:chr12-03:52272001:52273000_55 G3:chr12-03:52282125:52283124_360
ACCEPT (0) gap pair G5:chr12-03:52272001:52273000_7 G3:chr12-03:52282125:52283124_315
ACCEPT (0) gap pair G5:chr12-03:52272001:52273000_7 G3:chr12-03:52282125:52283124_683
ACCEPT (0) gap pair G5:chr12-03:52272001:52273000_7 G3:chr12-03:52282125:52283124_360
ACCEPT (0) gap pair G5:chr12-03:52272001:52273000_200 G3:chr12-03:52282125:52283124_315
ACCEPT (0) gap pair G5:chr12-03:52272001:52273000_200 G3:chr12-03:52282125:52283124_683
REJECT (1) gap pair G5:chr12-03:52272001:52273000_200 G3:chr12-03:52282125:52283124_360
DESIGN COMPLETE
U-type: U1
D-type: D1
Creating display features: mapping to reference assembly
Created display features
Inserted short and long range genomic sequence arms

webmaster@sanger.ac.uk

Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SA, UK  Tel:+44 (0)1223 834244