High Throughput Gene Targeting: Create Design

This custom vector design tool is provided by the EUCOMM consortium as a service to the research community. When using this tool, the user agrees not to submit more than five designs per day for creation without prior discussion with the High Throughput Gene Targeting Group at the Sanger Institute.

Design Type Oligo Select Method Artificial Intron Design
 
       
Gene Build Gene
Start Exon End Exon
Target Start Target End
Primer Length Design Comment
Created by wy1
Valid After Annotation
not done
oligos on fwd strand oligos as ordered View gene and design in Ensembl UCSC BLAT recombineering primers
Design ID: 49965
Chr: 11
Strand: 1
Status: Ready to order
BACs: RP24-146N12 : RP24-278J5 : RP24-142L24 : RP24-217D8 : RP24-278B5 : RP24-447A10 :
Oligos on GRCm38:
Type Start End Length Seq
G5 35777183 35777233 51 ATTTGGAGTTTTATCAAATGTAATTCAGTATTTTGGAATGCCATTCTAGC
U5 35782161 35782211 51 GAAGGAAAGAAAAGGGAGAAATAGAAAAAGGCAGTGTTCTTGGTGTTCAG
U3 35782290 35782340 51 AAATCTAAATGAGGTAAAAACATTTTGAGGTAACTGTTGAAAAGGACACT
D5 35782497 35782547 51 TTGAGTGATATGTGCTGCTTGCCTTAAGAACAATATGGAGAGCTGGGGAA
D3 35782655 35782705 51 GGGAGACAGGAGCATTCTGGGGTTTGCTCTCAGTTGTGAATTCAAAGACT
G3 35785720 35785770 51 AATGATTTTCTATTTATTTGATGCAGCCAACATTGTAGTACTGTGTGCTC
Oligos:
Type Start End Length Seq
G5 35620607 35620656 50 ATTTGGAGTTTTATCAAATGTAATTCAGTATTTTGGAATGCCATTCTAGC
U5 35625585 35625634 50 GAAGGAAAGAAAAGGGAGAAATAGAAAAAGGCAGTGTTCTTGGTGTTCAG
U3 35625714 35625763 50 AAATCTAAATGAGGTAAAAACATTTTGAGGTAACTGTTGAAAAGGACACT
D5 35625921 35625970 50 TTGAGTGATATGTGCTGCTTGCCTTAAGAACAATATGGAGAGCTGGGGAA
D3 35626079 35626128 50 GGGAGACAGGAGCATTCTGGGGTTTGCTCTCAGTTGTGAATTCAAAGACT
G3 35629144 35629193 50 AATGATTTTCTATTTATTTGATGCAGCCAACATTGTAGTACTGTGTGCTC
G5_U5 35620607 35625634 5028 TTTGGAGTTTTATCAAATGTAATTCAGTATTTTGGAATGCCATTCTAGCCGATTAATATATACATTGAAACTGTATGAGTGTGACTTGTGTTTGTGTGCATTAGTAGTTAGAATTAACTGCTGAGCCATCTGTCCTAAAATGTTACTTTGATACCTGCCTCCTCTTCATCCATGGGAATATAAATGACGCAAGGCGGTGAGAACCAGCCAAGTGCGTGAAACCAATCCTAGAGATTTTGACCCTAAATAAAATGAAACCTGTAGCGCCTTAAATAAAAATAACACTGAGGTTTTATAAAATCTCTGAAAACTATATAGTATAATTAAACCAAATATATTTGATTTTTTTTTTTTAATTCTGATTTTTGCTTTTTTCTTTCAGATTGGAAACCTCCACCTGCACAAACTGGATGAACTTGACTGCCTTGTAAAGGGCTTGCTGTACATAGATTCCGTCAGTTTCAATGGACAAGCAGAATGCTATTATTTTGCTAATGCCTCAGAACCCGAGCGATGCCAAAAGATGCCTTTTAACCTGGATGATCCTTACCCACTGCTGGTAGTGAATATTGGCTCAGGAGTCAGTATTTTAGCAGTCCATTCCAAAGACAACTATAAAAGAGTGACTGGGACAAGGTAGTTATCTTTTTGGTTTGATTATATCATTCAACATGTTTTATGCATGAAAGTTGTGGAGTACATTTTTTGTTTGTTTGTTTTGGTGCTGGGAGAACAAAAGAGGCTCTTAAACTGTTGCCCAGCAAGAATACTTTACTGAATCCCAGCTGTTTTTGCTATATATTGCTATACAGTTGTACCAGAAAAAAAACACATTTGTAAAACAGAAAAATATATAGGGGACTGGAGAGATGACTCAGTAGTTAGGAGTTCTTGCTAATCTTGCAGAAAACCCAAGTTGAGTTTCATGGCAGCTCAGCCATATATCACAATGGAATTGATTTTAGTCTAATCAGACAACTAAATAAACCTTTCACTAAGTCATTTATTGGGACTTTAATCACAGATTTCCCTTTTTTGTGTGGTATTTTTAGCACACAGACAGTGTTGCACAGGCTGACCCAGAACTCAAGATCTTGTCTCAGCTGATGTTGTAGCACACGGTCTCATCGGTCTACTATTAGTATTTCTTTCAGTGCATACACAGGAGTATATTTTTAGCCGTTATACAGTTTGAGTTATTAGATGCCAGCTAGGATTTTTCTCCCAGCAGATTTAGCTTTTTATATGACGGGTTTGGTTCTACTAAGTAGTCTTATTTTTTATCACATTGGTGTTTAGCATTTACCATGTTTTCCCTCTGTTTATTCAATAAGTGAAAGAATATAACATGTAAATGCAACTTAACAAGTACACCTTATTTTCCTTTTTAGCCTTGGAGGGGGCACCTTTCTTGGTTTATGCAGTTTGTTGACTGGCTGTGAAAGTTTTGAAGAGGCTCTGGAAATGGCATCCAAAGGTGACAGCACCCAAGCTGATAGGTTGGTCCGAGATATTTATGGAGGAGATTATGAAAGATTTGGTCTGCCAGGTTGGGCGGTGGCATCTAGGTAAGTTATATTGTTACTCAAGTTGTCTGTTTAGTTTCTGGAAAATATTATGCCATGGGGTTTAAGGATGACTGATTAGAGTTCAAGTTTTGAACATTGAAGTTTAAAAGTAAAATATTCAAGCTGGGCCGTGGTGGTACTCACCATTAATCCCAGCGCTTGGGAGCTAGAGGCAGGCTGATCTCTTGAGTTTGAGATCAGCCTGATATACAGAGCTAGTTATGGCACAATCAGCAAACAGAAAAATTCATTAAGAAGTTTTATCCTGTTTGCACCCTGTAAAAAACTGCCTTGTGCTAAGTGATATTTCTCAGTGGAGGAGCAAGGCCAGGGTTGATTCCCTGCACTGTAGAACAAAAAGAAACTTCTCAACTGGGCATAGTATCACACAACTTTAATCTCATTCATGAAGCAGAGGCCGGTGGAGCTCTGTGATCTTTTGTTGTTGTTTTGTTTTGAAAACAACAGGGTTTTCTCTGTGTAACAAACCTGGCTGTCCTGGAATATGCTTTTCATACCAGGTTGGCCTCAAACTCAGAGATCTGCCTGCCTCTGCCTCTGAGTGCTGAGATTAAAGGCACGTGCTCAGTCAGCTCTGGTTTTTGAGGTTAACAAAATCTGCAAAAGGAGTTTCCAGCCTGTCAGGCCCACACAGTGTGACCTCTTTTAAAAAGACAAAAACAGGAAAACAGAAATTTCTTGTATTCCAGAGCATCCATCGCCTGTACAAATACAAATTGTATCCTATAATCTGCTTATCCAAAATCTTGTGTCCCTACATGACATATGTGACTCTGAGATAGTCACAGATTCTAGAAAGAAGTCTTTCCATGCTGCAGCTCTAGTCTGTCTTTGTCCTGGCTGTAGTCCTGTTGGAGGCTTAGTACAAGTGTGTTTTACAGTGTTGTTAAGCATGCCCTCCAAGTGCTGCTCAAGCATTTCCATGCAGTGCACGGGTGCTGGGGTTTTGCTGATCTGCTAAAGCAGCAGCAGCTTAGTGTGGTTTTAATTTGCTGAGAACCTTACACGTTGCTTTTAGTGATGCTGATCGGTTTGTTGTTGGCTTGTTATACAGTTGAATTTATCAGTCTTTTCCTTTATGGCTTCTGGATATTGATTCATAGTAAGTAAGTCTTCCATATTCCAAACATATAAAGGAATTTAACATGTATATTTTTTTCTGACACATTATTACTTTTTTTAAAAAAATTATTTTTTTTAGATTTATTAATTTATTTATATGAGTATACTGTAGCTGTCCTCAGACACACCAGAAGAGGACATCAGATCCCATTACAGATCAACACAGGTTGATTCCCAGAACCTACATGGGGAAGGAGAGAACTGACCCCTCCTGTAGGTTGTCTTCTGAGCTCTGAATGTGTGTGCTTACACACAGAGAGGGAATTAATAAATATTTGGGAAAAGTGATTTTTGTTTTTGTTATTTCTATTATAGAACTTATGTGCCTTTCAGCCGTTTAAAAAGTGGTCTATAAATTTGTTAATTTAAATTTGTTCCTAAACAAAAGTTTATGTTGGCATATTTTATATATATTAATAGGTTTCGTTGTGGCATTTCATTTGTGAATATAGTTTCTTTTTCTCTCATTCATCTGCACTGTCCTCTCCTATCCCCTCCCACTGTGTTGCTTCTCTTCTCACTTGCTGCTTTGTTGGGTGTTTCGTTTTGCTTTGTTTCACAACCTAATGAGTTAGTTGGTGTTGCTCATTGGTGCGTTGGCTTTGCCACTGAAGAAAATGTGTGTCATTCTCCTTCCCTGTCAACTCTTGGATCCTCAGGGAAGGGTGGAGCTCCATGAACCCCTCCCCGTGCTCCTAAATATTTTGTTTGTATATGATCTCCATGAAGTTGTGATTGGCTGTTGCTTGTTGGGATACCCAGTGCCCTCTTGTGCTGAGGACTCTGCCTGCTCAGCCCTCTATTCTGAGATCCTTTGCTCTTTACATTTGATGTCATGTTTGATCTCATACATGTTTCATTATTTTTGTGTGACATTATTAGCCTCTGTTGCTTCTGTCTAAAATATTCCTTTCTAAAAACTAGTTAAACTTCTTTTTACTGTGGAAAACCTTCCTTTTCACCTTTTTCTTCTTACCACAAAAATATAATCTTTTCTTTCTGGCTCTCTGATTTTTGTTTTGTCTTGTTACAGTTAGTCTCTGTTGTTCTCTGTGGCCTGCATTGTCCATAGGATGGCCTCTTAACAAGATGTGTGCAACAAGCACTTGGAATGAAGTTAATGTGTGCCACATGGCCAAATGGCTACACTCAAATGAGCAATTCTAGTTCATTTCGCCTTTATTTTTACCTTTTAAGAATATAGTTAATAGATAATATATTATGTAGCATGTATTTCTATTAGACAATGCTACCCTAGACAGTATACTGCTTGAGGGACCTTTGTGTCTGTAGCATAATGCTTGGTATGTTGTAGATGCTTGAGTGGTTGATATTAGAGATGACATCTTTAACAATATTTTGACTTTAAAAGCAAACTTTTAAATCAATCACTGTACTTTTTTGGCTTTCTAAAATAATTTTCATACTTTTTTGTGTGTTATAAGGTCTTAAAATGTAGATAAAATAAATCTTTGCATACTAGTAACAAAGAAGTGCGTTTTTTAAACACAGGTTTAACTTTTCTTTTAAAAATGCTGTTTATTCCTTACAGACTTGTTTTAAGCCGCCCTATGTGCTCATGCTCTTTGGCCTAACTTTATAGAGCTATTATAGTTGTATAAGTTAAGGTGAATTGTTATTTATTACCAGTAGATTTGACTTGTTTCTCCCTGTCTCTCTCTTTGCAGTTTTGGTAATATGATTTATAAGGAGAAACGAGAAACTGTTAGTAAAGAGGATCTGGCAAGAGCTACTTTAGTTACTATCACCAATAACATTGGTTCTGTGGCACGAATGTGTGCTGTTAATGAGGTAAGACATCCAAGAATCTTTTTTAATTGTGCAAAAACAAAAAGCTGGACCCAGTACTTTAATCAATGCCTTTAATCCTAGCACTCAGGAGGGAGTTCTGTGAGTTTTAAGGCTAACCTGGTCTACATACATAGGGAGTTCCAGGCCATTAAGGGTTACATAGACAGACCCTGTCTTTTGTTTTTTTAAAAATTTAAGATAATAAATAATTTCAAAAGGTGATTCCTGTGCACTGACAGAGCGCCTTTATTTTCCAGTGAGCTCTTAGATTGAGATCCATTTCATACATTCCCAAGCAGCTTACCAGTTACTCTGGTACATTTTCTTCCATGACAAATAACAGCACTCAGGAAGCAGGCAGACAGATCTCTTTGAGTTTAAGGGCAACCTGGCCTACAAAGAGTTCAGGCCACCCAGGGCTATACAGCCTTTGCTTCAAAACAACCAATAGGAAGAAGGAAAGAAAAGGGAGAAATAGAAAAAGGCAGTGTTCTTGGTGTTCAGT
U3_D5 35625714 35625970 257 AATCTAAATGAGGTAAAAACATTTTGAGGTAACTGTTGAAAAGGACACTGTGGACTCTTGTTTATAATTAATGGAGTACTCAATTAGTAAGATGCTTGGAAGTTTTCTTACTGCCCTCGGCTTCTTTACAGTGCTGCCTTGTTGCATATGGATCAAGCAGCATTGTACAGGGCTATGAAGGCATTGAGACTTGTTCTTCATGCGGTTTGAGTGATATGTGCTGCTTGCCTTAAGAACAATATGGAGAGCTGGGGAAA
D3_G3 35626079 35629193 3115 GGAGACAGGAGCATTCTGGGGTTTGCTCTCAGTTGTGAATTCAAAGACTGAGTCAGCTCTCCGGGTTAAACAATTTTTTATTTTATGTATATGGTTATTTTTCTTGCATGTTTATCTGTACACCATATATGCAGTGCCTGTGGAAGGCAGAAAAGGGCACTGGATTTGCTGGTATTAGAGTTACAGATAATTGTGACAGCCAAGGTGGTGCTAGGAATAGAACCCTGGTCCTCTGGACCATCAGCTCCTGCTCCTAGCCACTGGGTCATCTCTCCTGATCCCCAACTGTTTTAGTTGGTTTATGCTTTCTGGTCCACTGGCCTCACATCTTCCTCCTCTTTCTTAACTTTTTCATGTTACTCACCTTTCATGCTCCTTTCCCCCAGTCATTTCTACTGTCCAACTTTGTGTAGGGGCCAGGTGCATGTTTATGACATAAGTAGGTTAATGCAAAGCTTGTAGTAAAACTAGAAAGGAAAGAACAGGCAGTTGCCACGCCTTCCACACGGGGGCACAGCCTCCCTGACTTACACTCTGGCTCTTGGTATATTTGGTTGTAGTCCAGGAATGTGCAGTGACGTGACATCAACACTAAAGTCCAGTCAGTGTCCCTATTCGACATCAGAGTTCACTCCTGCTGTTGTACAGGAGTCTCGGTAAATTATCTAATTCCTGAGTAATCAGAATTGCAGAACTCCATGCAGAAATTAGTAGTAGATTGACACCCACATTCTTACATAAATATTTTAATACCCTTAAAAGCCACTTTTCTTTTCTTTCTTTTTTTCCAGAAAATAAATCGAGTTGTCTTCGTTGGGAACTTTTTACGTGTCAATACTCTCTCGATGAAACTGTTGGCATATGCTTTGGATTACTGGTCAAAGGGTCAACTGAAAGCATTGTTTTTAGAACATGAGGTATGTAAACACTTTTTGTGGGTTATTTAACAGTGTGTTTTATATGAAATTGTTCTATATTTCTTTTTGTTTGTTTGTTTGTTTGGTTTGTGTTTTGTTTTTTGTTTTTTTCGAGACACAGTTTCTCTGTAGCCCTGGCTGTCCTGGAACTAATTCTGTAAACCAGGCTGTCCTCGAAACACAGAAATCCGCCTGCCTCTGCCTCCCAAGTGCTGGGATCAAAGGTGTGCGCCACCACTGCCTGGCTCTATATTTCTATGTATCTTGTATTTATATATGTAAAAATTAAATTATTTTTATGTGTACGTAAGTGGAGACCAGAAGATAACTTCAGGTGTCATCGAAAACACTCTCCACAATCTTTGAGACAGAGTCTCTCGCTGGCATAGAATGTACTAGTGAGGCTCTACTGGCTGGTCTACAAACCCCAGAGATCTGCCTCACCCAGATCTGGGCATACAGAGATGTGCCACCACACTTGGCTTTTTTTTTTTTTTTTAACCCATTTGTTTTAGGAATCAAACCTAGTTCCTTATGTTTACAGATTGAGCTATTTTCCTAGGCCAGGGTCATAAGTCATGTGTTTTGAAAGGTCACACTACACAGCCGGTTCAGACTGAATTTCAGGCCCCCATAAATGATGAAATTACGGGTGTGTGCCACAAATTATTGACTTAAGTAAATTGATTCTTTTTGTTTCAGTTTGGCAGGCAGTTAGCTACCACATAGACAGCTCACAGATGAGAATTTCATTGCTCTTCTAACCGAGTGAACAATAGGAAGTTTCTTGTTTCTCAGATAGAAGATTCTTTTTAATCCCCCCACCCCCCGAAATAACCCTATTGTGAACCCTTGAAATCTGTGCGATTGGTTTTCCTCCTGTTAAGCTTAATGGCTGCACTTGTATCATCCTAAAGCTCAAGGAGGCAGGGCGGGCAAGATGTTTGCTAGCTCCCTGGCCAGGCTGATCCATAGAAGTGCCAGGGTTCCATGGCAAGACCCCATGGCAAACAACACAAAACAAAAACCCAAACAGCCCACCTCCTATGGTTTTTGCTATTCACAATATCCAGTTAAATTCTAATCTGTGCAGTTAATCAGTCTTTTTTTTTTTTTTCATTTGCATGAGTGCTTGCCTGTACAGATGTCTGCCGCATATGTATGCAGTACCCTAGAAGCCCAAGAGAGGGCAGCTGGAACTGGAGTTACAGACGGTTGACAGCTGGGTGGCTGGGTGCTGGGAACTGAACCCCAGCCAGGCATCTGGGAGAACAGACAATGCCTTTCCCCTTCCTCTCTCCCTCTCGCTCCAGCCCTGCTCACTCTGGCCTCCGCTTGCTCCAGGTTTTTTTTTTTTTTTTTATGTTTCTCATTATGGATGGTTGTGAGCTACCTTGTGGTTGCTGGGTTTTGAACTCATGACCTCTGGAAGAGCAGTCAGTGCTCTTAACAGCTAAGCTATCTCTCTAGCCCCCCCCCCTCTTTTTTTTGTTTGTTTGTTTGTTTGTTTGTTTTTCAAGACAGGGTTTCTCTTTAGCCTTGGCTGTCCTGGAACTCACTTTGTAGACCAGGCTGGCCTCGAACTCAGAAATCCTCCTGCCTCTAATCAGTCTTCTATGATGAATTCAAATGCTTACATTATTCTGAATTAGGAACAAGGTACTGGCCTTTTGACTCACAGAAATCCACCTTCCTCTGAGTGCTAGAATTTTAGCTGTTGTTTTTATGGGATGTACCCTTTCATATATTAATGTGAAGAAGAAGGCTATATAAATGTGCTCTTACAAATTAATTTAAAAACTACATTGCCTTAAACTGTTTAAAAATCGTGCAGGGATACTTTGGAGCTGTTGGTGCGCTTCTTGGACTGCCGAATTTCAGCTAAAACATGGGCCATCTTTACTAAGGAACGCCTGCCATTCAGGAAGAGCTGATCCAGAAACCGCAGTCATTGTCTGTCACTGGGAACCAAAGGATAAAAGCCTAATTCTACTTGTGTTCATTTTAAATGTCAGAATGGTGAGCTTTGCCGCATGGAAAGACCTATAATGGGAAGTATCCCTCACTGATTGATGTCCTCTTGTATGTATGATAGCCAGCGTTCCATCTTAAATGCAATACAGCCTCTTGATTGTTGAACTTTTCTCAATGATTTTCTATTTATTTGATGCAGCCAACATTGTAGTACTGTGTGCTCA
U5_15 35610585 35625634 15050 GCCTGGCCTTTCTGTTACTTAATCATCTCATTGGTCCTCTTGACATTTTTAAATTTTTTGTTTGCTTTTTTTCGAGACAGGGTTTCTCTGTATAGCCCTGGCTGTCCTGGAACTCACTTTGTAGACCAGGCTGGCCTTGAACTCAGAAATCCGCCTGCCTCTGCCTCTGGAGTGCTGGGATTAAAGGCGTGTACCACCATGTGGTTGCTGGGATTTGAACTCAGGACCTTTGGAAGAGCAGTCAGTGCTCTTACCCGCTGAACCATCTTCCCAGCCCAAAACAAAGCTTTTTTTTTTGCTTTTTTTTTCGAGACAGGGTTTCTCTGTATAGCCCTGGCTGTCCTGGAACTCACTTTGTAGACCAGGCTGGCCTTGAACTAAGAAATCCGCCTGCCTCTGCCTCCCAAGTGCTGGGATTAAAGGCGTGTGCCACCACCGCCCAGCAAAACAAAGGTTTTTTTAAACCAGGAATTTCCAGGGCTAAGGGTAAGCAATAGCTTTTCTGGATTTGGAGTATTCCCATCAGCTCTGGTTACCACACAAATTTGTTTCAAGAAATAATCTTGGGGTAAGAACAAAGGCAGAAAATAAGACAGGGTTTCTTTGTGTAATCTTGGTTGTCCTGGAACTCACAGAGATCTGCCTGTACCTGCCTCCCCAGAACTAGGATTAAAAGTATGGGCCACCATCGCCCTGGTCCTTTCTTATCTCCCCCTTTCCAGCCCCCAATAGGGTGTCTCTGTGTAGCCCTGGCCTTCCTGGAACTTGATCTGTAGACCAGTCTGGCCTGGAACTCAGAAATCTGCCTGTCTATGTTGGGATTAAAGGCATGAGCCACTACCACACACCTGGCTTCTCTCTCTCTCTGCCCTTGCTTTATCAACTGTTTCAGTCTGTCTTGTGTTGCCTATATCTAAATACTTGAGACTTGGTATGTTATGGGGGAGGAGGGTGTTTAGTTACCCTTTGGAGGCAGGGGTGGTCTGACAAACATTACACGGTAAAATCCAAAGAAGAATGTCAAGTGAATCTGAAAGTCGCCAGAACACCAAAGCTAACTTTCCATTATATCCACCAGTACACAGTAATTAAACCAGACCTGCCAGACCCAACTCATTCCCATAAGCTCTAACCTAGTCCCATGAGATGTAATACAGTCTCTAGAGAAAGTCATTGATCAACCGCAAGACTGGTGTCCCCATTACCCAGTCACTTCCTGAAGGCCCCACCTTCTCACACTACTTCATTGAGAAATGAAGCCTCAGTGTGAATTTTGGCTTAGAGCAACTAAATCCAAACTATAGCAATCAGCAAAGGCAGGACAGCAGAGCTCGCCAGTTAGATTGTTTCTTGGAATGCTATCTTCCAGGGCCAACTCCCCAGGGGCAAGCACATGGAGGTTCCTACCAAGCCACATATTGTCAATGACTGAATTCTTTGCCATCTAAGACATAAAAGTGGAGGAGAGGCCATGTCCTTGATACCATCTCTTCCTTTTCCGATGGATGATCTCAAATCACAAGAGGCGTAGAGAAAAGGGTATCCTGGGTTTATTCTGAGAACTGGTGCATCTAATTCTTTTCTCTGAAAGTCACTTTCCTCTTTATAATGAGGAGCTAGACTAGAGAGATCCTGTGAGGAACCTGAAAGGCATGTGCTTTCAAACGTTTTGTTTTATGAGACAGGGTTTCTCTGTAGCTCTGGGTGTCCTGGAACTCGCTCTGTAGACCAGGCTGGCCTCGAATTTCCAGAGATCTGCCTGCCTCTGCCTCCACAGAGTTCAGGGATTAAAGGCGTTGCACCACGACCATACTACAACTTTCAAGTGTTTCGACTGCCTCGTTCCTGCCGTATCTTCACAGTAAATAAAACTCGCATGTGACTCAAAAGGCTGCTAGACTACATTACATTAAATAATAATTATGTAGCAAATGTTACCATCTTTAGTGACCTTCCAACCCCAATATTCAAGGTGTTCCTTTAGCGGATGACTTATCTCATCAAACGTATTCAGTGGTCTGGACCCCTGAATTTTGACACAGCCATCACAGGGAAAAACCATCAAGAGGAAAATCTGCGACTGCGTGACAGCCACAGCGCCCTCAGAGTTCACAACCCCTCTCTTCTTTCAGCCGCTACGAGACCAGAGCCCGGGAATTGCCAGGACCGCCCACGGCTTGCTACCATTGGCGGCCTCCTTGCTGGCGTGACTAAGGCTCCGCCTCTTCCCCGCTGGGACCACTCTGAGGCGATCTCCGGAAGCGGAGGGGGGCTAGAAATAGGGGTCGAGAGGCATCCTGGGCTTTGTAGTCCGCCTGAGCATCTGCCGCAGGAGAGTGGAGCCTCACTCTACGGAGAACTACAACTCCTAGCAGCCCCGCGGAGAGCGAGGCGAGGAGGCCTGAGTCACGTGGGCGCTGGGCCTGGGCGGGCTATTTCTCAGTGCGGCGGCGGCGGCGGCGGCGGCTCGGGGGACCGGGGCCTTTTGTTCGGAGCGGCTGCGGGGGGCCACGGAGCGGCGAGGCCCGCGGCCTTCCCCGGCTCGCTCGGTCCCGGCCGCCCCTTGCGGGGTTGCTGGGCCGCCCCGTGGGCCGCCTGTGGCCTCAGGCGCCGCCGCCCCGCCCTAGGCCCGCCCCACCCGGCCTGAGGGGAGGAACCGGCCGGGCCTCGCCGCGCGGCCCAGCCAGCTCCGGAGTATTCACCTCTCCTCGCTGAGCTCTGCACCCGAGGCTACCCCTCGCGCCTTAGGCCGACGCCATGAAGATCAAGGATGCCAAAAAACCCTGTAAGATGGGACCGGGGACCCGTGGGTTGGGAAGACGGGCCTTGGAGCCTCTGGCGGAGCGGCCCGCTTTAAGCTCGCGACTGTTCTCGGACGCCAGCCAGGGAGGGAAGGGAGGGATCGCTGCAGCCCCAGGTTGCAGGCGGCGGGCTTCCCCACCCCCATGCATGAGGGCCAGGCTCCTGCGGTCCCCCTGCCCGCTGCTCTCTTGCTCCTGCAGATCTGGGAGGTGCACGGGAGAATCTTGACTCGGGTTTTACCAAAATGGGAGCACAGCTACCAGGCCCCTCTTGAAAAGAGGTAGTCATGGCTGTCAGATAGGGGTTGGTACACCACCTCCCTCCCATTTTCCCCAGTTTCTGGGTTTCCTGCGCGTGTCCTTGAAGTCCAGGTGGGTTCCTGGGAGTTGTCAGCCTTGCATTTGGAGCTGTTCAACGCTTGTGCATGTACTCTGCCTGTAGATAAATTAATGGCTTGGGCAGTTTAGAAAATCAGCTGGTTTTGTGTTTTAGGGAGCAGATAAACACCAAGGTTAAACATCGTATTTCAGCTATTTCGAACACATTAATATGGTGATAAATACCTCGAGCTTTTTTCTGTAGTTGTACATGCATATACATGCAAAGGTTCTAACCCTGTTATGAGAGACACATCAAGGTTCACAAGCTGTCTTTTAAATGCCTCTTATTCCTGCGGTTGGCTTGTTTATTGGCTCAGTCTTTGTGAATGTTGTTCTTTCATTCTCTACTAACTGGGCATGTGGGGATCTGTGTTCCTGTCATAGAGGTTTTACAGATTTTAGTGTTTTATGCCATCTACAACTGCGCCTAGAGGTCAGCTGTAAAGGGGGCATGAACATCTTCCCTGCCTGTTCCCATAAACCTCACAGACTCAGCTTCCAACGCAGTCCAGAAACATTTACTTAAAACGTGAGAGTTCTCAGTGCTTAAAGATGAGGAAAGAGAACTTTGCTTCAGTGACTTTTAGTCCCCTCCTTGTACTGGCTCAAAGTGCAGTGCTGCTTCCCTTCCACCTACAGGGCATGGTCCTTAAGAGACAGTGTTTGTTTGTTTTTAGATTATCTGCTTATAGAAAGCATTAATGATGCTTTCGTTTCGTTTCGTTTTGTTTGTTTGTAGACAAGATTTCTCTGCAGCTTTGGCTGTCCTGGAACTCACTTTGTAGACCAGGCTAGCCTCTAACTCAGAAACCTGCCTGCCTCTGCCTGTCTAATGCAGGGATTAAAGGCGTGTGCCACCACACTAACTTTTTACTTCAAATCTGAACCAGGGTGTGGTGGTACACAGCTTTTACCCCAACATTCAGGAAGCAGAGACGAGTAATCTCCCCAAATTCTGAGGCCAGTTGGAGTTATGTGGTGAGATCTTGTCTCAGAAAAACAAAAACAAAAAAAGGAAGTCTGAAACAGTGACCACGTTTACATTTTCTGGGATAAATTAATGCACCTTAGGCTAGCATGGTGGCTCACATTTGTGATCCCAACTCCAGTACCTTCCTTCAGTGAACTTTCTCTGCTTGTTGTAGAATTTACATTTGGTTGATGGGACTTGGTGACTTGTGCCTTTAATCCCATGAGAGGCAGGCAGATCTCTTGAGTTCAAGACCAGTCTGGTCAACAGAACTAGTTTCAGGACAGCTAGGGCTACATAAAAAGTTCTCTCTCCAAAAAAAAAAACAAAAAAAAAAAAAACAAAAAAAAAAACAATCACTTTTATCATCTAAGTTGAATTATGTGTTAATTCATCTCCAGGAAAGAAGTAAGCGAATCAGGCCCTTCTCTCCCTTGAGGAACTTGGCCTCTCTGAGTTTTTAAGAAATTTATACATGTCCACGTTGTATGTTGCTCAAGGCCCATCTCACCTTTTCCTACATGATTTCCCCCCCACCCCCTGCATCCCTTTGCCTCCCAAGTGCTTGGTTTAAAGATGTGTGCCACCACAATTGGCCCACATATTTCTTTCTTTTTTTATTAATTTATTTAGTGTATAGGAGTACACAGTCTCTATCTTCATGCACACCAGAAGAGGGTGTCAGATCTCATTACAGATGGTTGTGAGCCACCATGTGATTGCTGGGAATTGAACTCAGGACCTCTGGAAGTGCTTTTAACCGCTGAGCCATCTCTCCAGCCCCCACGTGTTTCTTAAACTTTAGGTTTTTAGGTTCTGCCTATATGTATGCTGTGTAACTGGATTAATGAGGTGATGATGATAAAGGGTGATGAATATATTTAATGTGATATGGGTTTGGAGTCAGTGCCAACCAAGTAGTAAGATACTTGAAAATTTATGTATCCTGTGCTTCTATGTAATTTGATATAGTGACTTATTAATGTTAAAAACTGTTACTTCTAGTAGATAGTAAAGTATATTAGGAGGTAACAGTTGCCAATGTAACTCCCATTAGAAATGAGAAATTTACTTAAAACAAAAATCCTCAAATCCTTCCCAGGGCATCTAATACTGAAGGTATGAAGATGTGCTATTTTGTCCATCTCAGAAAACCCAGTCCTTTATTTGTAGTGGTCAGTGAGGAGGGTGAAATTCTTTTATTCATGAATTCCAAACATTGGGGTTTACCAGTGTATTACCCATCTTAAGTTGCTAGAAAAGTCAGAAGCTGGTGATTTAGACCATTTGCTACATGATAAAAGTGGCTCATGATTGAGTTTGTCTTCTGTGCTCTTGTTGCCTTCCTCAAGCCCTTTGAATGTGGTTTTAAAAATATTTATGTTTAGTTTATGTGGATATGTGTAGGTGAGTGCATCTGTGGGGTCAAGCTGTCAGAGCAGCTCTTGAGCTGGGTTGTTAAGGCTTTGGGAGCCACCTGAAGTGGGTGCTGGGAATCTGAACTCGGGTCCTCTAGAAAATCAAAACCTGCTCTTAACAGCTGAGTTCTCTCTCCAGCCCCTGAGTACTGGTTATTTCCTGGATTGAGGAAATGAATCCCAGAACACTGCTGAGTTGAAAAGATCTCTGCAAAAGTTAGGTGTTGGGCTGCAAGACAGCTTAATAGCTTCATCACCAAGAATACAGTCCTTGGGACCTACATAGTGGAGAAAGAACTGACTCTTAGACCTTGTCCTCTTGATCTCCACATTCAAGCTGTGACAGGCATGCCCTGCTGCACATCTGCATAAACCAAATCAACGGAATGGGGTAGATCTCCCACCTCCCTCTTTTAATTTGAGCTATTGGCAGAGTAAATTCCTTTCAGTCAATTTTCTCCTGATTTTAAAAAGAAAATCATTGTGAACAAATGAAAGCTTTCATATGTGGAAAGAAACATGCAGCTTTGTTTAGCAATGCTATTACATAGCTCTGGCTGTCATTGAACCTGGCTATGTGTGTAGACCAGGCTGCTCTTGCCTCTGTGTGTGTGTTTAAATGTGTAAAAGTTGCCTTTTTTAGTTATGACATATTTGGTCCTTTGGAACAAGCAACTTGCCCAAGGAACTTTTAAAAGGCTATAGAAGATTAAAAAAAAAAAAAAAAAAGTTGTTTAAAAGTTAAGCCGGGCGTGGTGGCGCACGCCTTTAATCCCAGCATTTGGAAGGCAGAGGCAGGCGGATTTCTGAGTTCAAGGCCAGCCTGGTCTACAGAGAGTTCCAGGACAGCCAGGATACACAGAAAAACCCTGTCTCAAAAAACAAACAAACAAAAAAAAGTTGTTTTAAAGCCGGGCGTGGTAGCGCATGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGCGGATTTCTGAGTTCAAGGCCAGCCTGGTCTACAGAGTGAGTGCCAGGACAGCCAGAGCTACACAGAGAAACCCTGTCTCAAAAAAAAAAAAGGTGTTATAAATTATGTGTGGATGTGGATGTAACTGCTGAGCTGTCTCAAAAGCCCTGGTTTTCCTATTTTAACGGTAGTTAAAACTAATTTTTTTCTCTAAAAGATTTAATCAGTAATAATGGTTTCTTGTTCTTCCTGCTTTGACTAAATAAGACTGGTGTTACACCAGAGGAGGGACCAAGCATATGTCAACCATTTGCTACAAAGAGATTTTTGATTACCTTCCACACCTTACTACTTCATAGCTCACATTGCAGGTAGACAGAATATGCATTTTGGAATTGGCTGTTCATAACTTAGAATAAAAAACCATGAATACTCAGTCACAGCTTTAGAAAAGTTGGTGACTTACTCTCTAGTATACCCAATAAATTTCAAATATTGCTTAATCAAGCTTCCACTGAAATTTAATTTATGGTTTTAAGATTAAGAAATATTAAGTGCTAACTTGAAGTTTGCCTTCAAGAGTGTCAGTACTTTGATATTTGTAAATCTGTGAATAGAGGATTCTGGATGGAAAATTAATAAACTTTGAACTTGCAGTTTGTACTCTCAGTGACATTCATATGTGTATTTTTACACCTGTGTTTGACATGAGCCTGAGAAAGTATATAAAGGGCTGGGGGTACAGCTCAGAGGCAGAGTGTTTGCCTAGCATACACCAAGGTCCTGGGCTTTCTTACTGATCAAAACCAAATGAGACTGGAGAGAGAAGATGCAAATACTTATTATTGGCTGGATTTTGGTAAAATGATTTCTGTTCTTCCAAATTATGAAATCTAGAATCAAGAATCACTTAAATAGAACTTCTTTTGGTTAGGTTAACAGAAGAAAAAGTTATTTTATCAAGTATCACCAAAATATGTCATTAATAACATGGTATTTTAAAAATTTAAAGCAATTCAGAGGGAAATTCAAGTTCCCTTACTGAGTGTCATCTGCTCCCATTTTTAAAGTAGGATAGCCAGGTCTTGTGGCTCACACCCATAATACCAATACTGTTAAATCAGGATTGCTGCAAGTTTAAAGTCAAAGCCAACTGGGAGCATAAATGCATAATTTATAAATAAACCTATAATTCCAGGTCAGTCTGAGCTACAACATGAGATCACCCTCAAAAAACAAACAAATAAACCGGGGACAAAACATTTTTAAGCCTGAAATGCAAAAGAGGATTTGTTTAAACACTGGATATAAAAGTCTTCTGTCAGTATTGCATTAGAAACATTACTGGGGATGGGGCAAGGAAATGACCTGTAATATTACAAACGAAACCTCCCTCCTTTTAAGCCATTCATTAATCATGAATGAATTTCTGAAAAAATTCTAGATTTTATGAACTGAAAGTAGCACTTAATCATACCACATTCTTTTTACCTAACGGAGCTGCATATGAGTGCCTGCATGCACAATATCTGTGCTTGGTGCCCATGGGCGTGGGGGGGGGGACGACTCGGATCCCCTTGAGCTGGAGTTCTTGGAACTTGTGAGCCACCTGGTGTGGGTGCTAAGCTATTAAATCAAGATATCTGGAAGAGCAGCAAACACTACCTATTATTTGCTGAGCCATCTCTCCAGCCTCCCAAATCTAACTCTTCAGGTAATACAGTCTAGCACTGGAGCGAGGGCCCAGAAATCTGTAATTTTCAAATAATGCTTAAATTGTTTTGATTTTTCTGTTTGCTAGGTGCCTTTAATTTATAAATGCCTAATTTGTAATTTTGTCTATTTGTCCCATATTTTCCTAGTTGAGAAACCCTTCTGGTATTCAGCCAAACTACACTTTCTTATGCTTGAAATTATCTATAGATTCAAGACTAAGTTTCTTATTCTAGCACGCAAGATCTTTTGTGCTTGACTATTTTCTCAGATGGAATCTTTCTCCTAGTTCCCTTAAAAAAAAAAAGGAATCAAATCCTAGTGATATTCAGTTAGTTTAAATTCTTGTCAGTGGGGCAGTGGTGGTAGTTGAGGCTAGCCTGGTCTTCAGGGTCAATGAGTTTCAGGATAGCTGCCAGCTGAGTCACATGATAAGAATGTAATGATTGAATAGGGGCACCTGTTGGATAAAGAATTAAACCCAGTGTTTTGGTAATCATTTAAGTTTTTAGGAAAATATACAGATAAAACTGAAAGAAAGGGTGAGTTGCATGCAGAAGGTAAGACTTACATCAACGTAAGTGTTAACTAAGCGCATGATTCAGAGGAAATGAAGTTTGTGGCTAATTAAGCACTCATTCTAGTTTGTTTTCCTACTATATATTTTTTTTCTTCCTTTTTTCTTTTAATTTCCAGCTTTCCCATGGTTTGGCATGGACATTGGAGGAACGCTAGTAAAGCTCTCATACTTTGAACCTATTGACATCACAGCAGAGGAAGAACAAGAGGAAGTTGAGAGCTTAAAGAGTATTCGGAAATACTTGACTTCTAATGTAGCATATGGATCTACTGGCATTCGGGATGTACATCTTGAGCTGAAGGATTTAACACTTTTTGGACGAAGAGGAAACTTGCACTTTATCAGATTTCCAACCCAGGACCTGCCTACTTTTATCCAAATGGGGAGAGATAAAAATTTCTCAACCTTACAAACGGTGCTGAGTGCTACAGGAGGTGGTGCTTACAAGTTTGAGAAAGATTTTCGCACAGTAGGTGTCTATTACTTGAAAACCAAAAATTAATATTAACGTGAATATTCAATTTTAAATACAAGGCTGGGCTTCTGTCTAAGCCAATGGTTCTTAACCTTCCTAATGCTGCAACCCATGTTGTGGTGACTCCAACCAAAAAATTACTTCTGTTGCTACTTCATAACTGTAATTGTGCTACTGTTATGAGTCATAATGTAAACATCTGTATTTTCCAATGCTCTTGGGCAACCTCTGTGAAGAGGTTGTTTGACCCTGGAGAGCATTGTGACCCACAGGTTGAGAACCAGTGATTAGAATGGTCCTTTCCCGAGTTGAACTGATGGGCTGTCTACACTGCTTGGCTTTCAGTGTGTTGATGGAATGTGGTGCATGCGGTTAGAGCTGTGGTACAGAGCTGTGCTGGGAGACCCCTGTGAATCTGGCACTCTTACTGTTACTGTCTTTTTATTTTGATATTTTTGTTTTTTCAAAATGGTTTGTTTGTGTAGCCTTGGCTGTCCTGAAAGTAGCTCTGTAGGCGGGGAACTCAGACCTGCCTGCCTCTGCCTCCTAAGTGGTGGAATGAAAGGCATGTGCCACCTCAGCGCACCCCCCCCCCCCCGGGCATTTTGTGTTTGGTTTTGATTTTTGTTTTCATATTGACTCTTATTTCCTGAAATAAGTTACATTAGTATTCACCTCTTGTCCTTGAGGTTGTAATGCGTGTGACAGGAGAGCTACTGAACGGATATTGTGTTTCTGTATTTGGAGTTTTATCAAATGTAATTCAGTATTTTGGAATGCCATTCTAGCCGATTAATATATACATTGAAACTGTATGAGTGTGACTTGTGTTTGTGTGCATTAGTAGTTAGAATTAACTGCTGAGCCATCTGTCCTAAAATGTTACTTTGATACCTGCCTCCTCTTCATCCATGGGAATATAAATGACGCAAGGCGGTGAGAACCAGCCAAGTGCGTGAAACCAATCCTAGAGATTTTGACCCTAAATAAAATGAAACCTGTAGCGCCTTAAATAAAAATAACACTGAGGTTTTATAAAATCTCTGAAAACTATATAGTATAATTAAACCAAATATATTTGATTTTTTTTTTTTAATTCTGATTTTTGCTTTTTTCTTTCAGATTGGAAACCTCCACCTGCACAAACTGGATGAACTTGACTGCCTTGTAAAGGGCTTGCTGTACATAGATTCCGTCAGTTTCAATGGACAAGCAGAATGCTATTATTTTGCTAATGCCTCAGAACCCGAGCGATGCCAAAAGATGCCTTTTAACCTGGATGATCCTTACCCACTGCTGGTAGTGAATATTGGCTCAGGAGTCAGTATTTTAGCAGTCCATTCCAAAGACAACTATAAAAGAGTGACTGGGACAAGGTAGTTATCTTTTTGGTTTGATTATATCATTCAACATGTTTTATGCATGAAAGTTGTGGAGTACATTTTTTGTTTGTTTGTTTTGGTGCTGGGAGAACAAAAGAGGCTCTTAAACTGTTGCCCAGCAAGAATACTTTACTGAATCCCAGCTGTTTTTGCTATATATTGCTATACAGTTGTACCAGAAAAAAAACACATTTGTAAAACAGAAAAATATATAGGGGACTGGAGAGATGACTCAGTAGTTAGGAGTTCTTGCTAATCTTGCAGAAAACCCAAGTTGAGTTTCATGGCAGCTCAGCCATATATCACAATGGAATTGATTTTAGTCTAATCAGACAACTAAATAAACCTTTCACTAAGTCATTTATTGGGACTTTAATCACAGATTTCCCTTTTTTGTGTGGTATTTTTAGCACACAGACAGTGTTGCACAGGCTGACCCAGAACTCAAGATCTTGTCTCAGCTGATGTTGTAGCACACGGTCTCATCGGTCTACTATTAGTATTTCTTTCAGTGCATACACAGGAGTATATTTTTAGCCGTTATACAGTTTGAGTTATTAGATGCCAGCTAGGATTTTTCTCCCAGCAGATTTAGCTTTTTATATGACGGGTTTGGTTCTACTAAGTAGTCTTATTTTTTATCACATTGGTGTTTAGCATTTACCATGTTTTCCCTCTGTTTATTCAATAAGTGAAAGAATATAACATGTAAATGCAACTTAACAAGTACACCTTATTTTCCTTTTTAGCCTTGGAGGGGGCACCTTTCTTGGTTTATGCAGTTTGTTGACTGGCTGTGAAAGTTTTGAAGAGGCTCTGGAAATGGCATCCAAAGGTGACAGCACCCAAGCTGATAGGTTGGTCCGAGATATTTATGGAGGAGATTATGAAAGATTTGGTCTGCCAGGTTGGGCGGTGGCATCTAGGTAAGTTATATTGTTACTCAAGTTGTCTGTTTAGTTTCTGGAAAATATTATGCCATGGGGTTTAAGGATGACTGATTAGAGTTCAAGTTTTGAACATTGAAGTTTAAAAGTAAAATATTCAAGCTGGGCCGTGGTGGTACTCACCATTAATCCCAGCGCTTGGGAGCTAGAGGCAGGCTGATCTCTTGAGTTTGAGATCAGCCTGATATACAGAGCTAGTTATGGCACAATCAGCAAACAGAAAAATTCATTAAGAAGTTTTATCCTGTTTGCACCCTGTAAAAAACTGCCTTGTGCTAAGTGATATTTCTCAGTGGAGGAGCAAGGCCAGGGTTGATTCCCTGCACTGTAGAACAAAAAGAAACTTCTCAACTGGGCATAGTATCACACAACTTTAATCTCATTCATGAAGCAGAGGCCGGTGGAGCTCTGTGATCTTTTGTTGTTGTTTTGTTTTGAAAACAACAGGGTTTTCTCTGTGTAACAAACCTGGCTGTCCTGGAATATGCTTTTCATACCAGGTTGGCCTCAAACTCAGAGATCTGCCTGCCTCTGCCTCTGAGTGCTGAGATTAAAGGCACGTGCTCAGTCAGCTCTGGTTTTTGAGGTTAACAAAATCTGCAAAAGGAGTTTCCAGCCTGTCAGGCCCACACAGTGTGACCTCTTTTAAAAAGACAAAAACAGGAAAACAGAAATTTCTTGTATTCCAGAGCATCCATCGCCTGTACAAATACAAATTGTATCCTATAATCTGCTTATCCAAAATCTTGTGTCCCTACATGACATATGTGACTCTGAGATAGTCACAGATTCTAGAAAGAAGTCTTTCCATGCTGCAGCTCTAGTCTGTCTTTGTCCTGGCTGTAGTCCTGTTGGAGGCTTAGTACAAGTGTGTTTTACAGTGTTGTTAAGCATGCCCTCCAAGTGCTGCTCAAGCATTTCCATGCAGTGCACGGGTGCTGGGGTTTTGCTGATCTGCTAAAGCAGCAGCAGCTTAGTGTGGTTTTAATTTGCTGAGAACCTTACACGTTGCTTTTAGTGATGCTGATCGGTTTGTTGTTGGCTTGTTATACAGTTGAATTTATCAGTCTTTTCCTTTATGGCTTCTGGATATTGATTCATAGTAAGTAAGTCTTCCATATTCCAAACATATAAAGGAATTTAACATGTATATTTTTTTCTGACACATTATTACTTTTTTTAAAAAAATTATTTTTTTTAGATTTATTAATTTATTTATATGAGTATACTGTAGCTGTCCTCAGACACACCAGAAGAGGACATCAGATCCCATTACAGATCAACACAGGTTGATTCCCAGAACCTACATGGGGAAGGAGAGAACTGACCCCTCCTGTAGGTTGTCTTCTGAGCTCTGAATGTGTGTGCTTACACACAGAGAGGGAATTAATAAATATTTGGGAAAAGTGATTTTTGTTTTTGTTATTTCTATTATAGAACTTATGTGCCTTTCAGCCGTTTAAAAAGTGGTCTATAAATTTGTTAATTTAAATTTGTTCCTAAACAAAAGTTTATGTTGGCATATTTTATATATATTAATAGGTTTCGTTGTGGCATTTCATTTGTGAATATAGTTTCTTTTTCTCTCATTCATCTGCACTGTCCTCTCCTATCCCCTCCCACTGTGTTGCTTCTCTTCTCACTTGCTGCTTTGTTGGGTGTTTCGTTTTGCTTTGTTTCACAACCTAATGAGTTAGTTGGTGTTGCTCATTGGTGCGTTGGCTTTGCCACTGAAGAAAATGTGTGTCATTCTCCTTCCCTGTCAACTCTTGGATCCTCAGGGAAGGGTGGAGCTCCATGAACCCCTCCCCGTGCTCCTAAATATTTTGTTTGTATATGATCTCCATGAAGTTGTGATTGGCTGTTGCTTGTTGGGATACCCAGTGCCCTCTTGTGCTGAGGACTCTGCCTGCTCAGCCCTCTATTCTGAGATCCTTTGCTCTTTACATTTGATGTCATGTTTGATCTCATACATGTTTCATTATTTTTGTGTGACATTATTAGCCTCTGTTGCTTCTGTCTAAAATATTCCTTTCTAAAAACTAGTTAAACTTCTTTTTACTGTGGAAAACCTTCCTTTTCACCTTTTTCTTCTTACCACAAAAATATAATCTTTTCTTTCTGGCTCTCTGATTTTTGTTTTGTCTTGTTACAGTTAGTCTCTGTTGTTCTCTGTGGCCTGCATTGTCCATAGGATGGCCTCTTAACAAGATGTGTGCAACAAGCACTTGGAATGAAGTTAATGTGTGCCACATGGCCAAATGGCTACACTCAAATGAGCAATTCTAGTTCATTTCGCCTTTATTTTTACCTTTTAAGAATATAGTTAATAGATAATATATTATGTAGCATGTATTTCTATTAGACAATGCTACCCTAGACAGTATACTGCTTGAGGGACCTTTGTGTCTGTAGCATAATGCTTGGTATGTTGTAGATGCTTGAGTGGTTGATATTAGAGATGACATCTTTAACAATATTTTGACTTTAAAAGCAAACTTTTAAATCAATCACTGTACTTTTTTGGCTTTCTAAAATAATTTTCATACTTTTTTGTGTGTTATAAGGTCTTAAAATGTAGATAAAATAAATCTTTGCATACTAGTAACAAAGAAGTGCGTTTTTTAAACACAGGTTTAACTTTTCTTTTAAAAATGCTGTTTATTCCTTACAGACTTGTTTTAAGCCGCCCTATGTGCTCATGCTCTTTGGCCTAACTTTATAGAGCTATTATAGTTGTATAAGTTAAGGTGAATTGTTATTTATTACCAGTAGATTTGACTTGTTTCTCCCTGTCTCTCTCTTTGCAGTTTTGGTAATATGATTTATAAGGAGAAACGAGAAACTGTTAGTAAAGAGGATCTGGCAAGAGCTACTTTAGTTACTATCACCAATAACATTGGTTCTGTGGCACGAATGTGTGCTGTTAATGAGGTAAGACATCCAAGAATCTTTTTTAATTGTGCAAAAACAAAAAGCTGGACCCAGTACTTTAATCAATGCCTTTAATCCTAGCACTCAGGAGGGAGTTCTGTGAGTTTTAAGGCTAACCTGGTCTACATACATAGGGAGTTCCAGGCCATTAAGGGTTACATAGACAGACCCTGTCTTTTGTTTTTTTAAAAATTTAAGATAATAAATAATTTCAAAAGGTGATTCCTGTGCACTGACAGAGCGCCTTTATTTTCCAGTGAGCTCTTAGATTGAGATCCATTTCATACATTCCCAAGCAGCTTACCAGTTACTCTGGTACATTTTCTTCCATGACAAATAACAGCACTCAGGAAGCAGGCAGACAGATCTCTTTGAGTTTAAGGGCAACCTGGCCTACAAAGAGTTCAGGCCACCCAGGGCTATACAGCCTTTGCTTCAAAACAACCAATAGGAAGAAGGAAAGAAAAGGGAGAAATAGAAAAAGGCAGTGTTCTTGGTGTTCAGT
D3_15 35626079 35641128 15050 GGAGACAGGAGCATTCTGGGGTTTGCTCTCAGTTGTGAATTCAAAGACTGAGTCAGCTCTCCGGGTTAAACAATTTTTTATTTTATGTATATGGTTATTTTTCTTGCATGTTTATCTGTACACCATATATGCAGTGCCTGTGGAAGGCAGAAAAGGGCACTGGATTTGCTGGTATTAGAGTTACAGATAATTGTGACAGCCAAGGTGGTGCTAGGAATAGAACCCTGGTCCTCTGGACCATCAGCTCCTGCTCCTAGCCACTGGGTCATCTCTCCTGATCCCCAACTGTTTTAGTTGGTTTATGCTTTCTGGTCCACTGGCCTCACATCTTCCTCCTCTTTCTTAACTTTTTCATGTTACTCACCTTTCATGCTCCTTTCCCCCAGTCATTTCTACTGTCCAACTTTGTGTAGGGGCCAGGTGCATGTTTATGACATAAGTAGGTTAATGCAAAGCTTGTAGTAAAACTAGAAAGGAAAGAACAGGCAGTTGCCACGCCTTCCACACGGGGGCACAGCCTCCCTGACTTACACTCTGGCTCTTGGTATATTTGGTTGTAGTCCAGGAATGTGCAGTGACGTGACATCAACACTAAAGTCCAGTCAGTGTCCCTATTCGACATCAGAGTTCACTCCTGCTGTTGTACAGGAGTCTCGGTAAATTATCTAATTCCTGAGTAATCAGAATTGCAGAACTCCATGCAGAAATTAGTAGTAGATTGACACCCACATTCTTACATAAATATTTTAATACCCTTAAAAGCCACTTTTCTTTTCTTTCTTTTTTTCCAGAAAATAAATCGAGTTGTCTTCGTTGGGAACTTTTTACGTGTCAATACTCTCTCGATGAAACTGTTGGCATATGCTTTGGATTACTGGTCAAAGGGTCAACTGAAAGCATTGTTTTTAGAACATGAGGTATGTAAACACTTTTTGTGGGTTATTTAACAGTGTGTTTTATATGAAATTGTTCTATATTTCTTTTTGTTTGTTTGTTTGTTTGGTTTGTGTTTTGTTTTTTGTTTTTTTCGAGACACAGTTTCTCTGTAGCCCTGGCTGTCCTGGAACTAATTCTGTAAACCAGGCTGTCCTCGAAACACAGAAATCCGCCTGCCTCTGCCTCCCAAGTGCTGGGATCAAAGGTGTGCGCCACCACTGCCTGGCTCTATATTTCTATGTATCTTGTATTTATATATGTAAAAATTAAATTATTTTTATGTGTACGTAAGTGGAGACCAGAAGATAACTTCAGGTGTCATCGAAAACACTCTCCACAATCTTTGAGACAGAGTCTCTCGCTGGCATAGAATGTACTAGTGAGGCTCTACTGGCTGGTCTACAAACCCCAGAGATCTGCCTCACCCAGATCTGGGCATACAGAGATGTGCCACCACACTTGGCTTTTTTTTTTTTTTTTAACCCATTTGTTTTAGGAATCAAACCTAGTTCCTTATGTTTACAGATTGAGCTATTTTCCTAGGCCAGGGTCATAAGTCATGTGTTTTGAAAGGTCACACTACACAGCCGGTTCAGACTGAATTTCAGGCCCCCATAAATGATGAAATTACGGGTGTGTGCCACAAATTATTGACTTAAGTAAATTGATTCTTTTTGTTTCAGTTTGGCAGGCAGTTAGCTACCACATAGACAGCTCACAGATGAGAATTTCATTGCTCTTCTAACCGAGTGAACAATAGGAAGTTTCTTGTTTCTCAGATAGAAGATTCTTTTTAATCCCCCCACCCCCCGAAATAACCCTATTGTGAACCCTTGAAATCTGTGCGATTGGTTTTCCTCCTGTTAAGCTTAATGGCTGCACTTGTATCATCCTAAAGCTCAAGGAGGCAGGGCGGGCAAGATGTTTGCTAGCTCCCTGGCCAGGCTGATCCATAGAAGTGCCAGGGTTCCATGGCAAGACCCCATGGCAAACAACACAAAACAAAAACCCAAACAGCCCACCTCCTATGGTTTTTGCTATTCACAATATCCAGTTAAATTCTAATCTGTGCAGTTAATCAGTCTTTTTTTTTTTTTTCATTTGCATGAGTGCTTGCCTGTACAGATGTCTGCCGCATATGTATGCAGTACCCTAGAAGCCCAAGAGAGGGCAGCTGGAACTGGAGTTACAGACGGTTGACAGCTGGGTGGCTGGGTGCTGGGAACTGAACCCCAGCCAGGCATCTGGGAGAACAGACAATGCCTTTCCCCTTCCTCTCTCCCTCTCGCTCCAGCCCTGCTCACTCTGGCCTCCGCTTGCTCCAGGTTTTTTTTTTTTTTTTTATGTTTCTCATTATGGATGGTTGTGAGCTACCTTGTGGTTGCTGGGTTTTGAACTCATGACCTCTGGAAGAGCAGTCAGTGCTCTTAACAGCTAAGCTATCTCTCTAGCCCCCCCCCCTCTTTTTTTTGTTTGTTTGTTTGTTTGTTTGTTTTTCAAGACAGGGTTTCTCTTTAGCCTTGGCTGTCCTGGAACTCACTTTGTAGACCAGGCTGGCCTCGAACTCAGAAATCCTCCTGCCTCTAATCAGTCTTCTATGATGAATTCAAATGCTTACATTATTCTGAATTAGGAACAAGGTACTGGCCTTTTGACTCACAGAAATCCACCTTCCTCTGAGTGCTAGAATTTTAGCTGTTGTTTTTATGGGATGTACCCTTTCATATATTAATGTGAAGAAGAAGGCTATATAAATGTGCTCTTACAAATTAATTTAAAAACTACATTGCCTTAAACTGTTTAAAAATCGTGCAGGGATACTTTGGAGCTGTTGGTGCGCTTCTTGGACTGCCGAATTTCAGCTAAAACATGGGCCATCTTTACTAAGGAACGCCTGCCATTCAGGAAGAGCTGATCCAGAAACCGCAGTCATTGTCTGTCACTGGGAACCAAAGGATAAAAGCCTAATTCTACTTGTGTTCATTTTAAATGTCAGAATGGTGAGCTTTGCCGCATGGAAAGACCTATAATGGGAAGTATCCCTCACTGATTGATGTCCTCTTGTATGTATGATAGCCAGCGTTCCATCTTAAATGCAATACAGCCTCTTGATTGTTGAACTTTTCTCAATGATTTTCTATTTATTTGATGCAGCCAACATTGTAGTACTGTGTGCTCAGACACAAATCTTAAAATCTCAGAAATGTTTGTTTATGCAAAATAATTGATTCTAAATGTTTGTTTGTTTGTTCTAAATACTTGTTTGAGTCTGTTATGTGTGTTTAGTTACTAGTGAGCAGGAAGCAACATACTCTCATAATTTATTGTACTGGCAATCAAAGATCATTTTCTGTGACTTAGAAATGTTAAGACAATATTAAGTATTAACTGTGATAGTTTTATAACATATCCTCAGAAAAGCATGTCTATATGACCTCTGCCCATAAGTATAATTTTCTCTCAGATGATGAGTTGAAATACTGTCTTTAAACATGAACCTGAATTTTTCTATTGAATCCCTGAAGTTTTTGCGCATATTTGGTGGCGCTACACTTTCTTTATCTCATGCATTAATCAGTATATGTGTTAAAATGTTTACTGTTTGTAAAATTGAGGGCATAATCACATACTTTGGAGTCTATCTAATTAAGTCCTTAGACTGTTCAAATGGAATATGGTTAGAGTGAGTGACATTCTATGCTCTTTCTCTACCATGTGTATCTCAGGCCCAAATGTGCATTTCTTATCATTAGATCTGAACTCGGGAAGCTGATGTGTACCTTCCATAAGCAGTAGTAATGGACAGAATTAGATGCTATCAAAAAGAATGTTTTAAAGTTAGGTGGCTCTGGGCAGCATTACTAAATTACAGATGGATCAATGTTTATGGTTTTTGGTCATAAAAGCATCACAGACCAAGAATTTGTCTTTCTGCTTGGAATTTATTCGTGGGTTTGAATTCCTGTTTTTTATAATGTTAAAATGTAACATTTTGGATGCCATTAATTTGGTAAGTTGAATCTGTATGGGAAATGGACCTATATTAATTTCTGATATTTCTGGAAATAACCTTAAAGAGGTTAGATTGTTTACATTAAAGAGTATTTCAGTGTAGTTTCTGAGACCCCAGTGTTCAAAGTTTCCAGCAGACTGTCAAGAGGTTCTTGATAAAGACAGGTCTCTGGAGCCAGGTGTGGTGGCCTATGCTTTTAATCTCTGCACTTGGCAGGCAGAGGCAGGCGAATCTGAGTTCAAGGGCAGCCTGGTCTACAGAGTAAGTTCCAGAACAGCCAGGGCTACACAGGGAAACCCTGTTTCTGGGGTGGTAAAAAAAAAACAAAAACAAAAAACAACACAGATTTCTGTGTAGTTTATGGAAGCATATGACGATAGTGTTTGCCCAGTGCACATTTTAAGTCTACAGTGATGTCACTCAGTGTTTGCGTCTGACAGCCTGGCTTGTTCGGGTTGCCATGCTACTGCTTACTTTGTTTTAAAGGTTGACTTGAGTGTGCAGATAAGAAAATAACTCAATGATAGAAACTGTAGATTATCTAGTGTGGAAATTCTATACATCAGCAGCTATAGATTTAGGGCTATCTTCAAAGATTAAAAAGTGCTCACATTAATTTGACCACTTTGCTTTGGTTTATATAGAACTAACATTTTGCCTGTAACTGAAATTAACTACTAAGGGCCATGTAAAGTGAACTAACTCGTTCATACATTTACCTTTTCTCAAGTGTAATCTGTCATTACTGAATTAATGAGAACACAGAATCATAACTGATAAAGGCTGCCAAGATTCTAATCTAACCTATATTGCTCTTGAGAAATTCCCTGTATGCATGCTATCACAAATAGAGGTTTGCTTCTAATATCAATCAACCTAATTAAAGATCTGTGTTCTTAAACAGTGCCATTTAATAGATAAAATGTAAACTATGAATAATTTTATATTTTCTAGTAAATGCATTAAAAGCTAACAAGAAATAGGTGAAGGTCATTTTAGTACCTTTTTAAAAAATTTACCAGTATATCTAATATGTTATTTCAGTGTGAAATTGGCACAAAAAATTAATTGGGAGATGTGTTTGCCCTTTTGTTTTTTATTTAGTTTTCAGTTAATGTATATTTTATTCTTAATGACACATTTCAGTTTTAGACTGACCACCTTTCAGATTTCACAGCCACATATATTAGTAGTGTTTTTTCTAAAGCTTCTTTGTTTTGTTTTGTTTTTGTTTGAGACAGCCTCAACTAGATAGAGCCGGTTGGCTGGGAACTGGCTATGTAGACCAAGCAAACCCCAAACTCAAATCTATCTGCCTCTGCCTCTGCCCCTGTCCCTGTCTCTGCCTCTGTCTGCCAAGATTAAAGGTTTGTTGGGAGTACTTACAAGAGAGCACTATTACATGTCCTTGAAAACTTTGTGAATATGGGCTTTTAAAAGAATGAGATGGGGAAAAAAAACGATAACTTCTTTTTTAAGTAAAGACAAGACCATTTGTTGGGGCAGTTTATTTTACATAGATAAGCTGTTACTATTTCAAAAATACTATATATTGTCATCATGTCATCTCTTGTGTAGTATATGGGATTTTTCTAATAACTGATACTGATAAAATGCTTGTAACACATCCTAATAGTTAGCAATTTCCAAACTAATGTATTTCCTTTATGGAAGCAAAATTAATTCCAGGGACTTAGTTTCTAAAGTTTCTGAGTTTTGTGCAGTCAATTTTGAAAGAGTACCAAGAGACACTTTTTATCTCATTGTTATTTTTTATACATACAAAGAGTCTTTCTAAAAATTCTGATAACTTTCAAATGCTAAGAGCATTGTCAGCCATGGTTTTGGTGGTAGTACATGCACACAAATCTAAAACACCACCTCTCCCCCAAAAGGTTGCCTTTTAACTAGACTTCTCCAGTCATCTGTATACACACACAGGCATTGCCTTCCTCGGCTCCTCTGAGGAGGTGGAGGAGGAGTGGATTTCTCCTGTGGTTAAAGTCTTTGCCAAGGCAAGGCTAGTAATATGCATGATAATTGAAAGCCAGCCCCTCAAGGGATTCTCATTATTTGCAAATACTGGACTCTTCCAAGGCTCTAAATGGATGGCACCCTTGAGTGCAGGTGATTGCTGTGTGTTAGGCATCCACTCCTAAAAATAAAGCTGTTTTGTGGGTGACATTCTCGAGGGAGGGAAGTTCATCTGGCTATAGTTTCTAAATATCCTTTATATAACTACTTTGTTAGAAACAAAGTTCTTTCTTATTTAGTTTATCATATCTTCTTTTGTTGAGCACTTTATCTTTGTTAGTGTTTTGCATTTTTGAATATAATTCAGAAATTCTAGGTTATGCAAAGAATTTATAAAGCATAATTAAAATGAGTGTATATTACTTTGCATTCAACTTCAGTTTTGTGGTGTGTGTAAACAAAATAACAGCAAAACGTTTTTAAAATACTCTGATAACTAAGGTGATTGCCTCTAAACGTCTATGTTGTCTTTTCCCACCCAAGCTCCTATGTTAGAGTGCACTTCATTGTGACAGCAATGCTGGCCAGCTAGCTTCATGTGTGTCACCAGATAATCTCTTGTTTGATTTTTGCTTTTTGAGACAGGGTCTCTGTGTAGTTCTGGCTGTCCTATAACTTTGTTATGTAGACCAGGTGCCTCAAACCCAGAGATCCTCTTGTCTCTGCTTTCCAAGTGCTAGCAACAAAAGCATGTGCCAGCACATCCGGCCTGCATCACAAAAATTTTGTTTTACAACCTATAACAGGAATTGTCTCACACTGTCAGTAATACAGTGATATAATCTCTTTTTTTCCCCTTTAAAGTATTAAGATAGCCAGTTCAATACAGCAACATGAAAAAGTGTCCCCAAGTTTTTGCTGCCTTTTATTCTACTTGCAAAATTAAAATATTCTCCCATTGGACACACTGTGCTGTCGTACATATTCAGTACATGTGACGTTCTGCTTTGAACAGTGTTTTACAGTGTTCTGGTCATTGGCCTAGCTTCTTCACGTCTCTCTTTAGTTGTTGACCAGGACTTCGGTGGCCACCGTGAGAATGACACCGTTGCCAGGAGCCAGAGCAAACAGTTGCTCCATTCCTGGCAGGGCTCAAGATGACTTACACATTGCAGACCTATCATGTGCTAGAGCTCATTTTTAGTGCTTCATAGTGTTTTAGTAATTCATTATTAGTACATGTGGATAAGTACTTACAAAACCAGGAAAAAAAGTTATTGTCATTACTGCCTGTAATAGCTACGTGTGTAACCTCAAAATCATATAGGGATTGTTATTCTTCATTTGTACAAGATGAAAATTCAGAGATGTTGAAGTATTAGCTATATTTGGAATTTTAGTAGCCCCTCTCTTTGACCTGTTTTTCTAATCATTGTGTGGTCACAGGAGAGGGTGAACACTTTAAAGCTCTTCTGAAAGGATTGTATTTGTCTGACACACGGTTCCAGCACCATTTACAAAATGAAAATGAAAATGGAATCCCCTGCACATAGGTTGGATGGATTACAGTCCTACCTAATAAGGCACAGAAGACCTTAAGATCTCTTTGTGAGCTGACTGGAGCAGACCTGGGTCTGACCCAGTGTCTTTCTGAAGTCAGCGTGGGCTGATGCTGAAATCTGCAGCTTGGGGATCTGACTGAACTCACAAACTAGTTTGTCTTCCGAACAAAGGCTTACTGCAGCTGCTGTTAATTTTATGTTTAAAAGACCTGGTAAAGAATGTAACTTCCACAGAAAGCATTTTCATTTTTACATAACATTACCATAAGTGATGTAAAATAGTTTTGAGATCTCAATTGTTTTGGTTGTATGCTTCAAAACTGTCATTGTGACTGGGTGTCATCAGGATATCACAGTGGCTCATTCAATACTTAATTAACCCTGCTTCTAAGCCATTTGAAAATTGGCCAGTTTTTTTTCTGAATAAACCCTTAGAGTTTCCAGCATTTAGAAGAAAAATAATTTTATGAAATCTAACGCTCATGCTGTAGTGTCCCATTTCTGCCTGTAATCGCTGGACCCTGCAGTGAGTGAGGTTCAAACACTTTTGTCTCTTTCACCCACTGTGTTGGAGTTAAGTGAACTCCAGGCATTTAAACTGAAATGAAAGGTATGCTTGTTAATTCTTGAGTCCTGAAGAAATCATTCCTAGGTGTTGCTGTTCCAGCTTAGGGCTTCCTTTCCTCACACACGTCGCTCAGTGCAAGCTGCCTTACTCTCTGTTGGTTGCATCATTCCTGTCAGGTTTAAGCTTTGTTTATGTTTAGATTCTTCTAATATTAAATCTTATGTAAAAATGTATGATGTACTATAAACTTTATGCATAACAAAACTAAGTTATAGCCTATTGTAACCTATAAAACACTTCTTGTAAATGATCTAATTTATTTTTCCATTTATGTACAGTTTCTTAATGTAAATTTAAAAGATATTTGTTGTGCCCTGCTCTGTAAACATTCCCTTAATGCTTATTTGCATGAAAGACTTTTGGGTTCTATTTGTTTGTACTATGTAGCTGTAAGCTGGGTTTGGGTGTCTACCTTTTCTGTAGTTTCTAACTTTTTTAATTTGTTAATATTCTAAATACGTGTTAGAATCATGCTTTTTATACCCTACTTTCCAAATAAATTATCTCTTTACTACATGTGTCTCCTGCTTGTTTCATCCAGAGCGGAGCAGCCGCATTTCCACTCGGATTCAGCATCAGGTTTGATTCTCTTTGCCATTAGCTGATAGGACATATTAAACTCCATGAGAGCGAGGACGCTCGCTGCAAAGCTCTGTTCGCTTCTGTGTCTTCAACACCTGGCACTGATAAAGTGCTCAATAAATGAACTATGTTTAATGAACTGACTATAACGTGCCCTTACATATCTATTCTGCTTGTGTAGACACACAGATATGAAAGCCTTTTATTTTTCTTAAAATGAGACCATTTTTCTGTGCTGTGGGTGTACATCTGACAGGGTGGTCCTGAGATGTCAGGATATCTATGATACTTTGGTGGCACAATTTGAGAAAATGTACTCTAAACCCAATCTTTTTTTTTTTTTTCTTTAAAGATTTTCTTCTTATTTTGTGTATATGCATGTTTGACCTACATATGCGAATGGGTACCATGTGCCTGCCTATTGGATCCTCCGAAACTGGAGTTAGGGATGATTGGAGCTGCTTTGTGAGTGTTGTGTCCTGGCCCTCAGCAAGCTGTGAGCGAGCGCTCCTAACACTGAGCTATCTCCTATTCATCTTATGTGTAGTACGCAAAGCCTGTTTGAGAAGAAAAGGAAAAGTTGAAATTGATATCATTTTCTTTACTCCGGGAATGATTGCACTATAGTATAAAGCAGAACCTCTCTGTTAGAATCCAGTGAGCAGGGAGGTAGGAGGAAGGTGAGACCTTGACCGGGAGAGGGTGGTAGGATGTTTAAATGCTGTGTTTGAGGGTTAATTCAGCTCACCACGTACAAAGGCTACCTGCATTACTAAAGAGCAAGTTTACTGTATACTATAGTATAATTGCTTTGTTCAAAATCAACAGTGCATCTGAGAAGGAAAGTTGATGTTCTGTGGTTGCTGTGAAAATTGTGGAGGCAAGCTGTTTATTGATACCTCAACTGAGGGCAATGTGTATGGTTTGGCACCTGCAATCTATTGACCAGGTCCATACTAAGCTTTGTAAATTTCACTTTTAATATTTCTTTGGGTTTTGAGTGTCCTAGCCTGTTTGAGGATTCATTTGGTAGCTGTGATTACCCACTTTCTCTGTGCACCATGGGTGTGTGCCCAGTGTCTGAGTTGGCTAGAAGAGGGTGTTCCCTGGGTGGATCCACGGGGGCTGGAGTTACAGATGATTGTGAGCTACCCCGTGGGTGCTGGGAATCAAAGACCTTGGGAGAGCAGCCAGCCAGCAGAATCAAACCTTAGCTGCTGAACCACCCCTCCCACTCCACAACTGAGCCGCTTCTAACTTCCCTGTACTACCTCTCCCTGTTTAAACTAATTTCCAGACTTCCAGAAGGAAAGCGCCTGGGAAACATTTTCAAAGTGCGGGAGGTTTGGGGGCCACTGATTTTTAGAAGTACTTGATAAAAATGGAGCAATCTGGCAGGTTATGTGCAGTTCTGCTCCTCCTTTGGCAGATCTCATCATATCTGTCATTGTAATTGGTCCTCATAGCTTCCACCAGCTTAGCCAGAGCACCCTTGTCTTCCGAGTTAACCTGTGTGAAGGCAACAGTGGTGCATGTCTTCCTGTCGACCAGGTGCCCCAGCCTGGCCTTCCGTTGATGGTGCAGTAGGGCACCCCCATCTTTCGACATAGGGCAGACAGGAAAACCACCAGCTCAATAGGATCTATGTCATGGGCAGTCACCAGCTGAGCCTTCTTCTCCACCAAGGTGGTGACTGTATTAACTCCTGCTCGGAGGACAGGTGGCCTCTTAGTTGGGACATCCCCTTTGCCTGCAGCTTTCTTCTCAGCACAGGCCAGCAGCCTTTGCTTCTTCTCTTGCTTTGTCTCTGGTCTGTACTTGTGGGCAAGCTTAAGCAGCTGAGTAGCTGTTTGCTTGTCTAGGGCCTGAACTGGTTAATGGCAGGAGGTACTTTGAGCCACTTATAGAGGATGGCTCTTTGCCGCTGCAGCCTGATGTAGTGGGACTATTTAACAAAGCGTGTTAGATCTCTTTTGGGCTGAATGTCCTTCCCAATGCCAAAGTTCTTGGGCCTTTTTTCAAAGGATTGACTACCTTTTTGGCCTTCTGTTTCTTGATGATGGCAGGGGCCGAGGCCACCTTCTTCCCCTTGGCCTTCTTTCCTTTGGGCATCTTGCTTTTTTTTTTTTTTTTTTTTTTTTGGTTTTTGGAGACAGGGTTTCTCTGTAGCCTTGGCTGTCCTGGAACTCACTTTGTAGACCAGGCTAGCCTCGAACTCAGAAATCCGCCTGCCTCTGCCTCCCAAGTGTTGGGATTAAAGGCGTGTGCCATCACTGCCTGGCGAGCATCTTGCTCAGCTGGTGGAGAGAGAAAGAAGAGGGAATTGTGGGTGATAAGCAGTTGCGGATTCTCTGTAGTCCTGGCTGTCCGGAAATCAGCCTCTACCTCCCAGGTCCTAAGATTAAAGGAGTGTGTCGCCATTACTGGCAGTGAGACTGGTGGCAGATGCTGAAAGGGTCGTGCAAACCATCACTGTGAGGGCCACGCCAAAGCATGATGTCTCTTGACCAAGTGTCAGACATAAAGCCTCGAAGTAACCGGAGTCTATGGACCTGGACTTGTTTCATGGATGTGGCTCTTGAAGTGCAACTTATTCTCTGAAACTTTGCAACTTCCATCTAGTTAAGTTTGGACCAGAAACCATGCTAAACTAAGTTCTCTTACACTCAAGGCAACTTCTGGTGCTCTCTCTCTCTCTGTCTGTCTCTCTCTCTCTGTGTCTCTCTCTCCCTCTCTCTCTGTCTCTCTCTGTGTGTCTCTCACACTCTCACTCTCTCTGTCTCTCTCTCACACTCTGTCTCTCCCTCTCTCTGTCTCTTCCTCTCTCTCTCTCCCTCTCTCTCCCCCTCTCTGTCTCTCTCTCTCTGTCTCTTTCTCACACTCTCTCTGTCTCTCTCTCCCTTCCCCCTCCCCCTCCCTTAGAACCACCCAGCTTTTTGAGCTCTGCTTCTCTTCTGTCTTATTGATCTCATCTTCTGTTGAGAGGATAAAAAGATGAAGGGCCTACGCACAGCACCATCCGTTCCCCCAGTTCCTCAATGGACCCGGTCTCCTCAGCCAATTCTCACAGTTCAGTAAGGATGTCATTTTATCATTCTATTTCTAGAATTACATAATAAAATGCATTCCCTCTAAACTGTAAGTTGAAAGCCTAGCTCCAGAAGTAACTATATAGAGAGTTTCAAGGAGGCAGTAACAGACCATCGAAGTCATGAGGCCGGGGCTTGAGTCCTGTAGGAAGAGAAGGAAGAAACACTAAAGAGCTCTCTTTCTTTGAAAACCAGTAAGGTTACCCAACTTTATCTGGGAAGAACCCTCCTCAGAAGCCAGATGCAACAAAGGCTACACCTGGACTTGTAGCCCTCAAAACTAATCAAATAGGCCATTGTTTAAGCCACCAGGTCTGTGTATTATTTCAGGCAAAACTTGTATTCACTTCTGCTGTTGCTGGGTTAGAAACACCATAACCAAAAAATGTCTATCTACATGCAGGCGTTTATTCTGTCTTACAGTTCTAGAGGGATGGGGTAGGATAGGAGGGAGAGGCCTGGCAACAGGTAGCCAGGGTAGGGAACCTACAAACAAAGTAAAGAAAGTGGGCACCATGCGGGGTTAGATCATGAACTCTCAAAGCTTGTCTGCAGTGATGTACTTCCTCTAACAAGGTTGGATCGTCTCCCCATACAGTGCTGCTGGGACCAAGCATTCACATAATATGGGGGTCATTTAACGCTCAAACCAAGTAGATAATTGCTGGGGTTTCTGGCTCTGAATAAATCTGGAACCCAGTGTCTCTTTACCTCTAGTATGCCTTAGGATTACCTCCCACTGGAGTTAGTCTCATATTTTCCCTGCCCTCCTCCAAAACCAGGCTCCAGCCTCCCTGCTATAATCCCACCATCCATGGGGAACCATGTCCATCTGAAATTTGTTGGGGTTGCTTTCTTTTTAGTCACAGTGTCTCCTCCCTGTGTTTCCCGAGCCAGCCTTGAACTCCTAGGCTCAAGTGATTCTGCCTCAGCTTTCTGAGGAAGAAGCCACCCTATCAGATCCATGGGGGTTCTTTAGATTTCCATGCCACTTCATCCTTAACAGGCTCCGTTTCTAGCATCTTCAGAAGCAGCCAGGGTAACGGTTTGCCTGGAATAAGAAAAACTGCTGAGTTCCCTGCTGTATGCTCCATGCTGGAGGAAGTGTGCAGCTGTAAGGAAGATTCCAGAGCTCATTATCGAGGCTGGGCTGGCTCAGAGGAAGGCGGAGCCCAGCAGGCCCTTTCTTTCCTACCATCTCCCCTATTCCGTGAGACTCCATTTCCAGCCTCCACATCTCACCTCAGCCACTCAGTCATTATGGTGGGATTGGAGAGACTGCTTTGTAAAGCAACTTGGGCCAGCATAGTGAAAATGACATTCAGTTTTGGAGTCTGGACTGCTGGGGCTTGATTTCTGTCTGTGAACCTTTTGGGTGATAGGAGAAGTCTTATGTGAGACCTCTCTCTTGCAGCATCAGCTCTCTCAATTGCCTATGACTTTCCCTGGGTTTTGGTGTACGGGTGAGGCATGTCATTTTATCCTTTTGCTGTTCAAGGAGGTATGCCCTGGAGCAAAGAAGACCACGCCAGATCTTTCCCTCAGCACGTATTTAGGTGTCTTCATTCCATTTAAAAGTTATTGTATATGTGTGTGCGCATCCCCATGTGCTGTGCATGCTCTGGGGGTCCGAGGACAACGTGGGGGAGCTGGTTTATACCTCTTCCCATGTGGGTCCTGGAGATTGAACTCGGGTCATCAGGGTTGGCAGCAAGCTCCTTCACCTGCTGAGCCATCTTGCCAGCCCCACCCTGAGTTCACCATGAAGAAGTCAAACCCCTCTCCAAACGCTGCATTGCTAGATTACTTGTGGATGACCTTGGCATTGGGGCTTGGGGGAGTGAATGAGCGCGTTTAAGATTCACTTGGAGCTTTGAGGCGGGGGTACTAAAGTTTTGTGGCCATTGCTTGCTCTCCTACTCATTTGTAATTTTACTTATGACGTATTTTATTATGCAGTCCAGATTAACCTAAAATTCAAACTTTCTGCTTTGGCCTTCCAGGGTTAGGATGGGTTAGTTCTGAGAGCCAGCATCCAATGTTACTGAGTCCAGAATCCCCTTCCAAGAGGGAAGTCTCTTTATTGGTTGTTCTGGAGACCATTAGTGATACCCTCTTGGGTATGTCAGACCCAGCACCCCATCTGTCTCCCTGCCTTCTGCTGCTGTTATGGAAACCTAGAAAGATCCCAAGGAGAGGAGGAGAGAGAACAGGAGGCCTCAGATTCCTACTTCTGTGTGCGTGTCAGGTGGGAAAGGGCAGAGCCAAGACAGCACGAGGGATACCAAAAGGTGGCAACAAGATTCTCCCTCCTCTGTAAGTCTGGGCAACTGGTATTCACCTCGGGAAGCCCACTGCTTCACAAAGAACATGGAAATTGTAACAAAGCCACCGTAGAGCTGGAGAGATGATTAAATGTCACAAGGACTGCAGAAAAATGAAGAAAACAAAACAAACCATTGTGGCTGATAATCTGGGTTTGAGTTGGTTTACATCTACTTCTTGCATACTCCGGAAGTAGAGGCAGGAGGATTAAGCTCGGCCAGGGCTACAAAAGAAGATGGCATTTCAGAAAACAGACACACAGGGAAGAGCCTAGCTTTGAGTCAGGTTGAATAGGTCAGCATCCAATAGTCTTCCCTGGACTCAGCCTTGACCACCCCCACCCCCGCCCCCAAAACAAAACAAAACAAAAAAACCCCAGTGCCTTCGTATTTCCCCCAAGAAATACTTTAAAGATCACTAGCGGGCTCTCCTATCCTTGTTCCTGTGATTAAAAGACACGTGTAAAAATGGGACCCTGTGGAGACCAGGCCTGGGGTGACTGGAATAGACACCACTCCCATGTTGTTCCTTGAAGGGGCCCTATACCTCTGTATTAGGCCACCAAGGCTGGAGAGCGACTGGTGCAGCTGCAAAACCCACTCTGGCCTCAACTGTACACTTGGGAATTGTTTATTTTATTAAATAGAAAAACAACGCACTAGGACAGGCACAAAGACACAGTCTTGTGGCAGCGCGGGGGCACCTTCCCTGGTTTCTGCTGCTGCTACTTGCTCTTGGGTGGGGGCCGATAGACCCCGACGACGACGGCGTGGTCCCTTTCGTAGGGCTCCAGAGTCAGCTGCTCCTGTGGCTTCAAGTTCTCCTGTTGCAGCTTCCTCACCTCAGAAGCAAACACGGCCTCGGCAGACGCTGTGGAGTCGATGCAGTTGGCCTTGATGGAAATGAGAAAGTGGCCTCCGTTGCGCAGAAAGGTGTGGGCG
GF3 -1 -1 1 GATAGCTGCCAGCTGAGTCACATGATAAG
GF4 -1 -1 1 CTGCCAGCTGAGTCACATGATAAGAATG
EX52 -1 -1 1 CAACCAACCCGGGGCTAGACATAAG
EX32 -1 -1 1 GAGTCCACAGTGTCCTTTTCAACAGTTACC
GR3 -1 -1 1 GCATAGGCCACCACACCTGGCTCCAGAGAC
GR4 -1 -1 1 CTGCCAAGTGCAGAGATTAAAAGCATAGGC
Comments:
Target: 0205Ensembl ENSMUSG00000065553 -- 35625819 -- 35625904 ENSMUSE00000522778 -- ENSMUSE00000522778
creating candidate regions
attempting to insert candidate regions into db
done inserting candidate regions
running aos on us and ds
running aos on gaps
finished running aos
AOS Produced 8 oligo candidates from u/d regions
AOS Produced 14 oligo candidates altogether
inserted results of aos runs
Aligned target to NCBIM37 assembly: chr: chromosome:NCBIM37:11:1:121843856:1, start 35595897: end 35595983
Found 6 RP24 black6 bacs on NCBIM36
Found enough RP24 bacs: not looking for RP23
Entered all non-repetitive oligos
Sequence count unchanged by blasting
finished aligning oligos to bac
REJECT (1) gap pair G5:11:35620319:35621318_288 G3:11:35628604:35629203_99
REJECT (1) gap pair G5:11:35620319:35621318_288 G3:11:35628604:35629203_91
ACCEPT (0) gap pair G5:11:35620319:35621318_288 G3:11:35628604:35629203_540
REJECT (1) gap pair G5:11:35620319:35621318_267 G3:11:35628604:35629203_99
REJECT (1) gap pair G5:11:35620319:35621318_267 G3:11:35628604:35629203_91
REJECT (1) gap pair G5:11:35620319:35621318_267 G3:11:35628604:35629203_540
REJECT (1) gap pair G5:11:35620319:35621318_293 G3:11:35628604:35629203_99
REJECT (1) gap pair G5:11:35620319:35621318_293 G3:11:35628604:35629203_91
ACCEPT (0) gap pair G5:11:35620319:35621318_293 G3:11:35628604:35629203_540
DESIGN COMPLETE
U-type: U1
D-type: D1
Creating display features: mapping to reference assembly
Created display features
Inserted short and long range genomic sequence arms

webmaster@sanger.ac.uk

Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SA, UK  Tel:+44 (0)1223 834244