High Throughput Gene Targeting: Create Design

This custom vector design tool is provided by the EUCOMM consortium as a service to the research community. When using this tool, the user agrees not to submit more than five designs per day for creation without prior discussion with the High Throughput Gene Targeting Group at the Sanger Institute.

Design Type Oligo Select Method Artificial Intron Design
5' retrieval block size U block size Min 5' spacer Critical Exon Min 3' spacer D block size 3' retrieval block size
 
       
Subtype Domain Disrupted
Gene Build Gene
Start Exon End Exon
Target Start Target End
Primer Length Design Comment
Created by
Valid After Annotation
not done
oligos on fwd strand oligos as ordered View gene and design in Ensembl UCSC BLAT recombineering primers
Design ID: 42916
Chr: 6
Strand: -1
Status: Ordered
BACs: bMQ35c02 : RP24-108P21 : RP24-108H15 : RP24-233A21 : RP24-390I3 : RP24-164K2 : RP24-84F22 : RP24-213O24 : RP24-265A9 : RP24-205H4 : RP24-368P8 :
Instance: Plate 46: Well F12: BACs RP24-390I3 RP24-108P21 RP24-108H15 RP24-233A21
Oligos on GRCm38:
Type Start End Length Seq
G5 94619025 94619074 50 AAATTCTCAAATTCTCAATTACACAGTGCCAATCATACCACTGATAGGCT
U5 94614200 94614249 50 TTGGCAAAAGTATGATGTTTTAACTTCTAAGCTGGAGCCTCGCCGGTATA
U3 94614080 94614129 50 CACTACCCACAACTCTCTCCTCATTCTGCAGAGTGCAACAGCCAAACAGA
D5 94613351 94613400 50 AATTAAATATGTGTACTCCAAGAACCACAGAATGAGGCACTGTGCAGTAA
D3 94613292 94613341 50 ATCAGAACTATCGCACTGTAACCAGTTATTTAGATTTGTAGCTAAACCTA
G3 94608146 94608195 50 TGGAGGCACAATGGTTTCATCTGCAAGGAGCCAAGACAATAAAATAACAG
Oligos:
Type Start End Length Seq
15_E_15 94563755 94594712 30958 AGTTATGTGTACTCGGCGCAGTTATGTGTAGACGTGTAGGTTACTGTCGAGTCTGGACATGTCACTGACTGCTGGGTCTTACACACAGGTGGCTTTGCAGCTGCAGTGACTACACCTCTGGACGTGGCTAAGACAAGGATCATGCTGGCAAAGGTGGGTATCAGATAATGCAGGTTCTATGCCGTGTCTGTTAGCGGAGGGTATGGGGGTGGAAGCATCGGAGAACCTGCCGGACCATTAATAACCCTGACTTTGGAAGAGCGGCTCTGTCATCGCCACCGCATGTTGGCAGCTGTCACTGTGATGGATCTGTGTGTAGCACGCTTCCATTTCTCCAGCACTCTCCCAGCTGTGCCGTGGGAGCGGCACATCTGAGGGCCCCTGCTTGCTCTTGCTGTTTTCAGATCTAAGCCTTGAGAGAGGCTGACAGGCTTCATGTTCTGAGGCAGCTGATCTGCAGAGTCAGAACTCAGGCCATGGGTCGCGGTGACCACTGAAGACAGTTGTCCATGTTGTTAAAAGGAAAACCAAACAACAAAACAAGCTCTGAGCTGAGCTTTAAGGAATTCCAGTAACATCCCTGGACCGAGTATACTCTCAGAGTACAGAGGACCAACCCTGATGACGGGGTCATTTTAAAGATAGACCCATGCAAACGTAGAAGTGCCACCCCCATCGGGCTTCCTGTTGAATAGTTACCATTAGTTTCTAGGTGAGCTATGAGAAGCTGCCCCCCCCCCGCCCCCATCCCCAAGTATTTGTCTGTATGTCTAAATGTAGGCAAGATTTCCAAGCTAACCCCAGGGCAAGCCTTGGATGAAGGTGAGGGGAGTCTGCTCAGAGAACCAGAAGGTAACGGCCCTCTCTCCCTTCCTTATCTTCCCTAGGCGGGTTCCAGCACTGCTGTGGGGAACGTGCTCTCTGCCATGCACGGGGTGTGGCGCTCACAGGGACTAGCCGGGTAAGGACAAAGCGAGCCCTCGGCTGCCTTGCCTCTTCTTCATTGGCTCTTTCTCAGGTCCCTATGCTTGCTGTGGATGAACACTTCGCCTTTGCCTTTTCTTAGGTTGCATATGTAAGATGGCACACTCGGCGACATACCATTCTAGCCACATGGTTCTCGGTCTTGTCCTTGACACTGGATGACATGCAAATGTGTGTCGTATTTTGGCTGCAGCATTGGTACAAATAAGCTCCCACCTACGCAGTGCAGACTGCCAGTGAATTAGAAGAAAGCATTTGGGGCTTGAGTAGGAACCACTGGCAGCCGTGCCTTATGATGGGCCTGCGCTCTGCACCATGGGCGTTGTTAGTGGGTAATTTTGTCACTTAAAACATCATGTGGTGGCGCACGCCTTTAATCCCAGCACTCGGGAGGCAGAGGCAGGCGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAAAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCATGTCTCAAAAACCAAAAAAAAAAAAAAAAAAAAACATCATGTGCTTACACAAATGTAGATGGTGTCACCTACAGACCTGTGGAATCGGGCTCCTGGCTGCAAGTGCAGCAGGTGATACCCAGAAGATCATGGACAGTTGGAAGAGCAGTAGATATTAGTGTGTCTGGAGATACAGAAATGGAGAGATCGTGGGTTTCAGATGCACCATCATCTTATATGCAGTCTGTTTTTCTCTAAAGCGTTACCCAGCTCATCACTGCGCTGTCTGCTCCACAGTGCTCAGCCTTGGGTGGCCATTACTGTTTGGTTGCTAAGTACCTCACATTTTTTTGCATGTGGTATGCAGATGGGTGTGTGTGCCCACTAGTGTAGCCATAGAGGATAGAGGATAGAGTTTTCAGTTGGATGTCTTCCTCAGTCACACTTGAAACAGTCTCTTACTGAACCCGGAGCTCACCATTTTGACTATAGTAGGACCCGAGGACCGACCTGTTCCCTTCCCCGTCGCTGGGTTGCAAGTGAGGACCACTGCACCTGGCTTTCTGTGGTGCTGAGGATCTGAGCTTGGGTTAAGCTTGCCCTGCAAGCATGCTAATGAAGCATCTCTCCAGCCCCACATGCCTCCAAATGTCTTGCTTTAAGTCCTAAAAAGCCGTCCCTGCACACTGGTTCACCATACGGTGGTGCTGGAGCTGTGTCTATGCTGAGTTGTTAGAAAAGCGGAAGGGTTTTCTCTACGGAACGGTCTGGACATGCTGTGTGGACGTGCCTCCACCTGGAGCTGGGATGGCTGGCATTGGGAGCAGCAGCACTGTGCCCTCCTGGCCTCTTTACCTGGCATAGCCGCCCCGCTCACCCCCATGCCAGGGTACATCACTGATCACTATTTTTGTGTAACTTTGGCATTTTAAATTTCAGCTGATGGTCCGGGAAACATGGTGATGCTTTTGCCAGAGAGCAAACTCCATGTCTGTTTGAGTTTTCCAGCTGGATGCTTCAAAGTGGTGGCTGGGTGCTTTCACTCAATGTCTGCTCTGATGGTCGGAGGTGCAGATTGGATCTAACAGACAGGACTTACTGACTCTAGATGTGTCAGACATAGGAAAGGCATGGTGCTAGCTTCCGGAGTGAGTCTGCTGTTCATGGCTGACCCCGCGTGAGGAATAAGAACATATTAGTTGTTAATTTGGGTACGAATTTGACACTGAACAAAGATGGAATGAGGAGGGACATGGGTTGTGTGCCCCATATGCATTATTTGAGAAGCCTCTTAGGAAAGCAGTGGCTGCGCTCACGAGGCAGCAGCTGGTGACAGTGACTTTTGACATCCTGAAGGCCAGCTGCCAGATTGTGTGGTGACTTAGCTGGGCCCCTGACTATACTGTTGTGGGGCTGCAGCCCATTTGCCAGTGTCGAGAAAGTGGTGACAAGAAAGGACACACTGGATGAGGCAGTGCCCCGCTGTGGCCACCGCATGCTGCTGGGTAGATGATGCAAGAGCGGCCTTCCCTGTCCAGGTCATGGCACACACTTGACTATAACTAAGCAGTGCCAGAGGAAAGACAGCAAAACAGGCCAAGGGTGTGTGTTTGTTCTGACCCAGCCTTGGTGCTGAAAGGTAGCTTGGATTTTTGGCTCGTCTTCTGAGTCTCCAGTCTTGGACTCTGGTCACCTTGTCCAGGGCAGCACTGAACAGCATGTTCCCAGCAGCAGTGGCCACCCCTGAGCATACAGCAACTCCAGCCCCTCTAGTGAGCAAGTGATTGGACCAAGAGACAAATGAAAACTACTGGTCCCTTTCTGGGCAGGTGGCTCAGCCTACTTCCTCTGTGGCAGTGCCAGATAGAGCCACCACTGTCTGTGCCCCCTGCCCTGCACACACACTAAGCCTATCAAGTCTACATAACTCCCAGCAGCCCCTCCCACCAAGGAACCTGATGCTATCTCAGAGGAGATGGTAGGGAGCCACGCTGGAGGGCAGACTGGGGTTAGCCCAGAAGCTGCAGGGCAGAGGGGAGGTCCACTTGTCCTGGATTGCCCCTGGCTGATCCCCTGAACGTTTTCCCTTGAATATGCCCTTTATGTACTCGCTGCTGCTGGGAGCTCCTGCTTATCCTGTCACCTGTTGTCCCTGGAACACAACCTGCCCTACTCACAAGTCTGCCTGTAAGCAGAGGTGGAACCCCTCCCCCCTACAAAACCTCCACTTTAAGGAGGCTGCAGTCTGTTGGTCATCTGTGACGCTGTAACTGCTCCCATCTGTCTCTGGCCTCTGCTGAGCTGGGTAGTGGCAAAGCTGAGGGAGACTGACCTCCAAGCCCAGCTCAGTGTCTCCAGGCCTGCCTTCTATATGGTAGGTGCCTTGTTTGCCACTTCCTGGGCCAGGCTAGCTGACCCAAGAGCCTCCGGGACTTCCTGTCACTACAGGAGCACTGGGGTTACTGCAGAGCTGCCACGCGCAGCCTCACGAGGTTTCTAGACATTTGAACTCAGGTCTTGCTCGCTTTACCCACTAAGCTATTCTCTCTAGCTCCCTAAGTAGCTTAGCAAGAGGGGTCCCACTATGTAAAGTCCTTGCTTTCTTCTGTGCTGCCTGCTAGAGGTGGGAGGGGCAGCGGATCTCTTCCACTGGCTGTGTAGGGCATGGGCTGTGTATCCAGCAGAGATTCCTGTCAGCTTTCTTCATTAGCTTCCACTTAGCTTAGCACAAAGGCTTTCCCACATCTTTAAAAGGCATGAGCATTGTTATAATAAAACACTTGCCCTATACCCAAAGCCTCTCCACGAGTGTGCACACATAGACATCAAACTGGTTCTTTCCTTGTCCAGGGATCGAACTTGGGTTATCCATCAGTCTTGACAGCAAGTGCCTTTTCCCACCGAGGCAGCCCAAGTTCTGGCTTCTAAGTTTGTCTTTCTGCATATAGAAGCACTTTTCTGGGTAACAGGGTTTCAGTAGAAATAAGATCAGGCTTTCTGTCTGTCACTCTCTCACTCCCACTGCCTCTGTAGAAAGCAGTAATTTACAGCCTAGGACTTGCCCTGTGTTCATCAGCCCAGCGACCATGGGGATGGTAACCTTTTAGGGTTGGGGCTTCTGTCTTGTTCTCTCCAGCTGTGCGCCACTCTGTTTTCACAATGCTGTCTCATCTGGCCAGGTAAGGTCACTAGTAGATTACTTCAGTAATGTCACGATGGATATTTGAAATTTCCTGGGCCTCTGGAGAATGGCTTCCTGACACCACTGTGGTGTTCTGACTGGATTGGGGATGGGACACCTGAGAATCTCGAACTGACACTGTGAGGCGCTCCACCTTTACCACAGTCATGTGACTCTGGCGTCCTTATTTCGATTGAACAAGAAAAAGGGAGTCCACAAAGATTCATCATCCCCTTCTTGTAGAATCGCATTTGTGGGACTCCAATGACAAATATAACCGAGCCCAGGGTAGGAGAGCAGAACTGTTTCAGAATTTGCTTTGTCTCCCTGACTGAGACCTAGAGGCCCCTCAGATGTCCCAGGGCCACACACCCTTACCAGCCTCACCTCAGATGTATCCTTGACTCCCTTCTTCGAGCACACTGCTGGGAGAGTGGTTACTGTGTTAATGTGAGTGTTCCCAGCTAGTGTGGCCGTGCTAGGCTAAGCTCCAGTTTCTCATGCATATTGGGGAATATTACTTAGTAGCCTTCTAAAAGGAAGGAAAGACACTGTAAATTTCTGTGGGATTTCACAATGGATGTGATGGAATGAGCGAACTGCGGGCAGTCAGGAACATGACCATTTCCTGTCCCTAGGTTATTCGCAGGTGTCCTCCCGAGGATGGCAGCAATCAGCATGGGCGGCTTCATCTTTCTGGGCGCCTATGACCAGGCGCGAAGCTTGCTGTTAGAGGTGGGCAGGAAGAGCCCATGAAGCAGACACTACATGTCCTTGCAGTCCTTCCTGTGCCTGGGGCTCCAGTGTGGCTCCCTGAAGATGGCTGCAGAGAGCAGCTTAATGAAGGCCAAAGCACAGGCTGCCCCAGGAAACTTTTCTTGGTGAAACTGGGGCCACCGTCTCAGTCCTCTCAATAAATACTCCCGGTAAGGCCAAGGCCAGGCCCTTCAGAATGCTTTTTATTAGCATCCTGTGCTTTCTGCTGTCTGTTGGAGTCACCAGGAAAGCAAACTGGCTACAACTGCAGTGAATGACCAGACTGGGAAAAGGAAGGGGGCAAGAACCGTGCGTGTGGCTGTTTCTCCCCTGGGCGGGTGCCTATTGTGTAAGATTATAGCTTTGTTTAAAAAGCATGAGCTACAGGTGCATAGCATGCATTCTTTCTGGTGAGGATGCTGTTTTTAATTACCTTGTATTTCTCCTATAAAAACACATGATTATATTACTTTACAGCAAAGTGCCCCAAAGTCCCTGGAGTGTGTGACAGACAGCAGACAGCTGCAGCGCCAGTGAGTGGGTGGGCCCAAGTGACTTCAGTTAGGAACATGTTGAGGGAAGCAAAGCCCATGCCCACCACTGTCCGTCCCTGGAGGCCAGCTGGAGCAGCTCCTTTGTCCTCATGGTATATGCCAGCAGGAGGTGGGAGGGTCAGCATACTTGGGGAGCATAAGGCTTGACTAACCAACTCCATGTGGAAAAAAAAAAGCTATCTGAGGAATGCAGTGCCACTGTCTTTCTGGGGCAACAGTGTGTAGTCTATGCTGCTTCGTCTAAGTATTCTCCTTTTGGAGAAACATTAATAGCAGAATAAAAGAGCAGTGACCGCCGCACACACTTAGTATTTATAAATGAACCTTTATTAAAGACACTTTATGCCATTTGTTAGACACTTCAATATTTTACATGTTTTCAATGTACACTGTACCAAAATTTCTATAAATAAATAACTCTGTACATAAAAAGTAATACTTCCTCTTTCACATTGCCTCTCAGAAGCAGCAAATTCACATATTTTGTGGAAGTAACATTAACCATCAACTATGGAGACTAGCCTTCTCAGCGTGCTTGCTCTGGCACAGTGATGGCCTATGACACTACACGGTGACACAGGCCATCACTGTGCCAACACTTCCCCTCAACTCCTGGGGTTTTAAGGACTGAGTTTGTGTTTCCATGTAGTCTTTACTGCATTATACATTGGCACTCACAAGATGGCTAGCAACAGGGCCCCAAAGTGCAAATACACCCAGGTCTAGGACTCAAGTCTTGTACAGTCCAAGCCCAGTCTCACCGGTAAGGAACAGCGTGGACAGGCCTGCTCAGCAGAACTTAGCGGGCCCTGGAGGCAGAGCTAACCCTCACTATTGGAAAATCCACAGGTACCAACACTGGCAGCCTCCGCCTCACTAAGCTTCAAAGAACCACTGAAGGAGACAAGACATTTGCTTTTACCAAGTGAGTTACAAAGAAAGACGAAAGGCAGTGCTTAATTGTTCTGAGCCATTGCATTTGGTGGATTAACAGCTCTCAATCTCGTCCTCAACTACAGACCCGTGCACCCTGCTCTACAGTGAGGCTGCCAACACCACGCCTGCATAGGTCTGGCCAGTGCACTCGAATCTGACCACTAAGTGCCACACAGCCAAGATGCCCTCCTTTCCAACCGCCAGCAACAGCTGATGTGTTTACCTGAATTCCAGCTGTGCATTAAGGCACCAGAACGATTCCTGACCCTCTCCAAAATTAGACAGCAACCTAATGTGAAAATATCACCAAAAGCGGGACCCATGCGCTAAGGATTAAAATAGTCTCTGTAAAAGATATATAATATATATGAAATCTCTGAAAACTCTTATGTACAGTGGTATCAAATACTTTTTCCTGCCTTTTGTACACAAATAGTCTCTCACGTTTCTGAGCTCCAGATGCCACTCCTCTAGCCGACTGACTGACATTCCACACGGAAGTCGGACTGTCCGGAGTGACGTCTGGACACAAGCTTTCCACGGCCTCTCCTACCTCTTTCCTGTAGCGACTGCTTTAAAAGAGCTGAGGTAGATGAAGCCTAGCTTCTCGGTGCCAATAGCAGTGGTCCCCTCCGTTTCCCAGTGATCTGCCCTTTCAGTGGCACAGATTCAGGGCTGGAGTCACAGGCCTTGGGGAGGTGGCCATTGGAAACAAGCAAGTGCTGGGCTTCAGTAGATATGGCGTCTTCCATGAGCTCTGGGCTGCCTGAAGCTAACGTAGGAGAAGGCTTTAGGTCTATGCAGTCTGCTTCATGTAACTTTGCTAAAGTCCAAGAGGAATCTCCTGTTTAAAAAAAAAAAAAAAAAAAGAGGCAGCTCAGCCTATGCACCGTAACCAAAGGGCTCCCAGCAGCCACCGAGGTTCCTCTAACACAATACACACCGTTCCCATCTGCAGACGCCGCCTTGTTCTTCAAGGATGGCAGTATTCTGTCATGGTTGCTTGGATAGAGGGACCCCCCAGAGAGGGTATGAGACCCATCCGCAGTCCCACTGTAAGGATGGTGTGGAGAATATTCCCGGTCATGCTGCCTGAGCTCTTGGCTGCTCGCTGTGCCTGGCTGCCCACTGTCTCTGGGCACAGGCTGGGGATGGTAGGCTGTGTCAGTACTGCAGTCACTACATACAGCAGAGCCACTGTGTGCTGAGGGAAGAAGAGAACCAGAGGTCAACTGAGTCTCCATTCCCTCTCAGAGGCACTATTGGAAGATGAGTCCAGCTTACCACTGCCTTCATAACCACCCTGTCTCTCCCCTCCCCACCCCCTGGAATGTGTATGTGGAGAGGAGCTAGACCAACCATGTCTTAGTCTTGTGTGCCTAAGTATACGTGTAAAATTAATTTCGAAGGCACACTCTAATCACAGGAAAATGAGGGTGGGGAGAGGAAGAGGAACGGTTTGCATTAGGCATCATACAGTAAGGAATCTTAATCAGTAGGCCTTAAAGAGTCCCGCCAGCAGGGCTGCGGAGAGGGAGGGCTCAGTAGGGAAAGCGCTTGCTGAGCATAAGGACCCGAGTTCAGGTCCCCAGTACTCCTGGAAATGCCAGGCAGGTGTGGTGGCCCAGCTAACGCAGAGGCAGGAAACCCCGGAGCAGGCTAGCGGGCTAGAAAATTGGATCAGTGAACCCTGGGTTTGAGAGAGAATCCCTGTTCATTACACAGGACAAAGAGTGACTGAGGACATGAGCTGAGTGACATGAGGAAGGCGCACTCTAAGGGACGGGCACGGTAGCCCAGCCACAGCATCTCAGGAGGCTGAGGACAGCCTGATCCACGAAGTGAAACCTTGTCGGGACAACAGTCCTGGCGCAAGGGCAGGCCTTGTCTTGTAAGTTCCTTATGTTAAGAAAACTCAGCCATGTTAAGAAAACTCAGCCTTCAGCTCACCACATCATAGACTGACTTACCTAAGCGACACAGGACTCTAGAATCACACAAAATCCTGTTTGTATTCTAAACATAACTCAGAGACAGCGTGCGGCCAGTGATCTGCCGCTACTCTAGTTTACTCAGTCAAGCCAGCTTCAGGGCCAAAAGCAACCGCGTCCCCTGACTTAAGTGTCTCCTACCTGTTGTATGTGGGGCAGCTGTCCTGTCGGCTTTCTCCGTCACCTTCCAGGGCTCTCTAGTGTATCCAACACACAGCTTGGGCTGCCTGCATGTAGTGCTATGAATGTCGACCTCTGGGAAGAGGCTCGGGTCTCTCAGACACACACCTGAAACAGAGCCCTTACCACTTAGAAGCTGCTTACATCACGCAGCCTGATGGCCACCAGACCACTGCTTTTCCCAGCACCTTGGCATCCACCCAGGGATTGGTTCCTATGCTCCTCTGAGATGCCCAAATCCAAGGATGCCAAGTTCCTTTTCTGTGAAATGCTGTTTGCACATAAACTGTACACCTTCTCTGACAGACCTTAAGTCATCTTCACTCATAGTACCTAGTAACGACGTAAAATGTCCATATAGATTCAGTTTTTCTTTGCTAAATATTTTCAGTCTGTGGTTGGTTGACTTATACTTAGCCCATGTAAAGTGCTACAGTACTGTAAAAGCTATGGGCTGATTTGGGGGCCTGGAATGTCCTTTGCATATATTCTTTCTGGCAATCCTATCATATAATCCTTCTGACCAGAAGACAGAGTGCTAAGCCCAGTGCAGGGACTTTCCGGAGGATCTAACGTTAAAAGTATAGAACTTGCACACACCAGATCCAAAGCAAACTATCTTATCAATTAAAGGCCTGGTTCACCAAATGTGACCCAGTGCCAGACTTCATCCAGGACGAGGGCAGCTGGCTCACTGTTCCGAACTTACCATTGCTTTCAATGTGCCCATTGGCCTGATGACCACCCTCAGTCCTGACCACAGTTTCCTGCCGGTCAGAAAGGGTTCCCTGAGAGGAGAGGTAGCTTGGAACATCTGGAGGCACAATGGTTTCATCTGCAAGGAGCCAAGACAATAAAATAACAGGGCTGCCACAACAATAAATACAGATAACTACGCACTATCACAAGGTCACACGACAGTGGCTCACACACAGAAAGCTGTGCAGAGGCTCGGCAGCCGCTCATTAACCTCCTTTACACCCTGGTGTAAACATCACGGCAGTCAGACGCCTGGCTCCATGAGGAACAAGGAAAGGAAGGCCTAACCAAGACTGAGAGCCTAGGAACAATCCGGTTCATAACAGGCGTGGCCCTAGGGCCTCTGAGCTGCCAAAGAGACCAGAAACTGCAGAGACCAGCGAGTCCTTGCATGTGAGAGTATTCCCATTTTCTGTTCTGTCCTTCAGAGCTAGCTTGCTGTTGGGGGGGGGGGAGGACATGGACCAAAGTCCCAACTCTACAGGCAGAGTCCATATTCCTAAATGTTCTAGAGACCTTTCAGGTTCTAGGCAAGCCCCCAGGCCTGCATCGTTTACCTCGGACTGCGGCAGTGTCACCCCATCTGCCCCCAGCCCCCCAAGTCCGCTGTGCTGCTGACCTGTGTTAGTGACGCTGTACTCCTCGCTCTTCTTCCTGGTCTGGTAGATGATGCACACCCACACCAGCGAGGTCAGGACAATACTGCACACCACAGCAATGGTGAAGATGCCTACGGTGGTCCCATCCTTCCGGCAGCCAGGGGTAGGTAAAATGCTCAGCTGGCTATGTGCTCGCTCAGTGCCCAGGGGATTAGACATCTCACAGGTATACCGCCCTGCATCGTCTATCATCACATTCTGAACAACCAGCAGCTGGTTGCCTGGAGTGAAATGGTGGCGCTCTGTGAGGCTCAATGGGCGACCTCCCTTAAGCCAGGTGATGCGTGGTGTGGGGCTCCCGGTTGCTTTGCACTGGAAGGCCACTGTTTCTCCCACAGTTACCACACGGTCTTCCAGAGGCACTGCCAAGGATGGAGTTTCTGCAGGAAGGCAGTGGAAATTGCACATTTATTCTATGGGTCTCGCTTGCTGGAGGTATACATGTTTTCCAGACAGAAGACAATCCCATGTTGTAGTGAAATGCTATCTGAGATCTTTTATTGGAGCACCAAGCTTTCCAGAAAGCCTAATGTAATTAAATCACTGCCATTCTAGGAACAGCTCAACAGAGCAAAGAACTAAAGCCCTACCCTATCCCAAACTGTCCTGTTATAGACCTTTGTCACTACTCCTAAGATCATAGCCCACCTGTGTGAGTGCACACACACACACACACAGAATTCTCACGCAGACTAACATATAGCTCATTGTCTTTTATGAGCTGAAACTACTCGCTTAAAAGCAGCCCCAAAATTCAAATTAACTAGACAGAGTCTACCACAGGGACTCCAGAAAGCAGGTTCTCTAATACTTGAGTTGAATCCCCACCCGACCCTGCCACACGTGCGCGAGAGCTGTCGTAGCGAACCTAAGACTGTGAGGGTAGCGTTGGCTGAAACCGAGCCTGCCGAGTTCTGGGCAGTGCAGCTGTAGACCCCCATGTCGTCTATTTTCACATCAGTGATGAAGAACACATCATCGTCTGGCATAACATGCATGCGTCGCTCACGAGCTGCCGGGAAATCGGTGCCTCCATCCTTCTGCCAGGCAATCTGAGGGTTAGGGTGGCCCGTGGCAGCACACTCGAGGCGGGCTGTGGTGCCAGTCCGGATGGCAATGTCATGGGGTATTTTAGTGAATGATGGCAACACTGGAAAAAAATGATAGGTAAAGCTACTTGGAATGGCTGCATACAAAAGGAAACTCATAGTAAACAGATCCCACTGTGCCCAGGCCTCAGTTCATTGTTACTCCATCCCACCCAAGGGGTGCCCAGCCTCTCCCCGTCACAGACACAATACTGCACCCATTACCCTTAACGCCTTCCTATTGCTATAGCCTGGTGCTAAGCACTCTCGGAAGGCTTCTGATGGAGCGTTTTGCCTCCCGAAGCTCCACAGTAGTTACTATGTAGGGAATCCTCCAGAAGTAAAAGTCTGGTGCTGACCTGCTTTAGTTAGCTATCTGGAGAGAGCTGGGCAACAAAACATTTGCTATTAGGGGATAGCTGGATGCTGTCACCAGGAGGAACCAGTGAGCTGGCTCACCTCTCTTGAGGAAACCCACTCTGGGTGGGGTCTATGGGGGCTACACTACCAGCCACACCCAGGCAAAAATATGTAGTTCGTTCGCTTCTGTAGCTTTAGTATCAATGCTGCCACAGTGGACAGTATCCAGACTTGATGTCTGAGCTACTGTGGTGGAGAGTCTACAGCTACTTGGTCTCCAAGAAACACTCTGGCCTCTCTTAGGCCAGCCTCGCTGTGGTAGAGTGCTTTGTGGTGTTGTACAATAGCAGAGAGCATGGAGGCAGTGCTTCAGGCCACCCACAAGCCAGCTTAGCCTAGTGTGGAAGAGTTAGCTACTGATGCTGTCCTCATCCCTCAACATACCACATCCATCAGTAGTCCAGAAGAAAGCCACCCTGATGGCCAGGGGCTGGCTCCTGAGTAAGAGACCCTTGTCACAACTTCCCTGCACACTGGACCTCGGAGCCAGGGGCTCAACCCACACCTGCTCTCCACAGCCTGAAGAGTAGCGGCTCGGAACAATGGGTCACCCTGTGGATCATGAACCCCTTTGGCAAACCTCTATGTTCAAAAATATTTACACTGTGATTCATAACAGTTGCGAAGTTACAGTTATGAAATAGCAAAGAAAGTAGTTTTATGGTTGGGGGTCAGCACAGCATGAGGGACTATATTAAGGGGTCAAGCATTAGGAAGGTTAAGAACCATTGTTCTAGAGGAAGTGGGGCTTGTACTTGTCCCAAACGGCCTTGCTCCCAGTTATAACATCTACTCTAAGGTCACAAGCTTCCTTAGAACCTAGGGATGCTTGGAATCTAGAAACCGCATCTCTTGGCTTATGGAAGACAAGGAACATAAAAATACAAAGCTTAACTCCACAATGTCACTTAACATAACTGGACTTTAAAAATCTCCCACCCCAAACAAAAAACGATGGTTCAATCTGTTAAACTTGGTCTGGGACAAACCCAAGGACTGGTACAAAGAGATGCACCCCACGGCTCGTGTCTCTTCACACCAGTGTCAGAGAGGACAATCAGCAGTGTAGTCTGTGGGACTCTGTGCTTGAGAAGCACGAGATGCCATGTCCTTACCATTCACAGTGAGCCTGGCTTTGTGGGAGTATGTGGAGCCAAAGTGGTTTGTGATGATACACTGGTAGCGGCCCTCGTGCCCAAAGGTGACGTGACGGAGGTGCAGGATAGTGGTATACTCCATCACTTCGCCGTCCTGTGCACGGACGTGGGCAAAGTTCTCCATGTCTGCATTGGCCAGGACCTCATTGTCCTTCTTCCAGGCGAAGGTCATTGGTGAGCTGCTGCTGCTGGCTGCGGAGCATGTGAAACGGATGTCCTTGCCCACCACAGCCATGGTCGTCTCAGGCTGGGTGATGATCTGTGGCTTTGGAAAGTCATCTAGGGAGAGAACCAAGTGTAAGACCCCTGTTCTGTTCGGACACCAGCAAATGTTCAGGCTGACAAGGAACTGGTCACTTGCGAGTCAGTTCCACCAGACACGGCGGTCGCTGTGTATTCACAAATAGTTGTAATCACTGGCACAATCGATATTAAATGTTTTTATCATCTCTAACAGAGAAGGCTGTCCTGTTTAGCTCTCCCTTCTGTCTCCACTGCTCACCAGTGGGACTGGTGACATACATTTCTGACCTCTATGGGGTCCTTTATTCTAGACATTTCATGAGACTTCTTTCACTTGGCAGATCATTGTCAAAATTCACCCATGCTGTGAGACAGACAGACTGACCTAATGTCCCATGGCATAGCTACCTGCCTACTGTCTATGCATGGGTGTCTGGGTTGCTCCAGCTGGGGCTGTTATGAGAAACGCTCTTTGAGCACTTGGTCAGAGCTGCTCCCATCCGCTTGGATGGATCCCAGGGTGGGCCCAGGAGCCGATACTGTGCTGTCTACATAGCGAGGCTTCCTCCACAAAAGGACCTCCCCATCTCATCTGTTCTTGTCATCACCTAGCTTCATGCTGATTTCCTAGAATGTGTATGGTGGCCATTTCTGTTTCTTAGAAACAAGTGGGAGACAGGGAGCAGAGTTTGAACCTCTGATTTCCTACCAAGGATTCTCATGAACCGTGGGTGGGTAGTTCTGAGGGGATTGCTACAATGCCCAGTGTAGCATGGTCACCAACTAGGGATCAGGTTTTAGGGAAACAGAAGACTGCCCTCCACCAGACAGAGGGGGAAGCCAAAGACAACTTAACTTGAGAAAACCTAAACAAGTTAATGAGTGTGGAGTCAATTAGCACTGGCTGTAAAGTGCTGCCTGCTCTAATGTGACTAGGGTGCTGTCTGCACAACCCTGATTCTACCCAGGTAGCCAGTGCACCGAGAGTCAGCAAGCCTGCTTTGGGAATTAATGCAGTGGGAGGTAGAGGATGCTTGTCTTACCTCTAGCAGGCATAACTCACAGGGAAAAGGTCGGACAAGTGGCCCGGGACACCCAGGCTGCTAGATGGGTCATAACTAGCATCGTTCAGGAAGTGATCCTGTAGCTCCGTGAGGCCACAGGGAACCACTGACAGGAGGATCATGCATTCCCACTGCTGCTCAGAGCAACCCAGACAGACCTCAACGAGACCTCAACGGTCTTCTCGGTCTTGGATCCCATCTCCTTAGCTAGGAGGCTATGCTAGTCCTGCCAGAGCTAGCCTGTGGGTGTGTTTCAGCTGTTCCGTGTTCTCTGTGCTCTCTGTAACTAAACTTGGGTCCTGACTACCACTGGTCAAGAAGATGGTTAAATCTATGTTCCAGCAAAGTGGAGGAAAGAGACTCTCCCAGTGCACATTTCAGCGGGTTGGACAAGCAGCAAGAGTGCAAGTCAACATGGAGGAATTATTTTTACTGCAGTGGCTGCTCTCCTGAGACCTGCTCTTCCTGTGTTTAACCTCTCATTCTTAGAGCTGGAAAGAAACACACATTGAAACCCTATCCCCATGCACTCATTCACAGCCAAACCTGGGCCCAGGACCCTTCTGAAAAGATCAGAACTATCGCACTGTAACCAGTTATTTAGATTTGTAGCTAAACCTACCCCTTTTTAATTAAATATGTGTACTCCAAGAACCACAGAATGAGGCACTGTGCAGTAAATACATGTGGTTTCCGTGGGAAATAAATTGCACCCAGCAGCTGATCTGTAACCATGGACTACACTAACTAGGGTCACAGGAATCAGTCTTATGATGAGACGTTCTTCCTGGCCTCTCTGCCCTACATCAAAAACAAAACCAAAAACCTCAAGGATAATCTTACCACACACAAAGCTGTCTGGCAGCACTGAGAAAATGCTCTGGCCCTTCAGCGACTCTGGATGGGCACAGGTGGCTGTCACAAAGGCCTGCAGCATCCTACCCATTAGCCATGGGGGCAGCCACTTGAGCTGGCAGTCACACAGGAAGCTCTCACTGCTGATGTAGCTGAAAGAGAAACAAGAGGTGAATATTTAACAGACCATAAGGAAGGGTTCTTTGCAAAACATCACAGCTAATCAGCTTAGAAGGCAGGACATGCAGTTCCAAAGGGAACGATTTTCCCCAGTGACCAGGGACAGCTCACGCACCCTCCATGCAGATTTGAATAGAATATGGCTTCTGATACAGAGCCCAAGATACAACATGCCAAACTAGCCCCAGAGCGGCATTGAGAATGCTGGTCTGAAGACCACAACTGGAACAGCAGCATCCATGTTCTCAGGGGATCAAAGCTCCTGTCACCCTGGGGGTGCCTTCTAACCTGCTGTGACCTGGGATACACACTGTATGTGAGGGGCACTACCCACAACTCTCTCCTCATTCTGCAGAGTGCAACAGCCAAACAGAAGCAGACTTTACTTAAATTCTGCAAAAAATCCCAAGAAATCTTTTCCTACATGGCTGCTATCTTTTTAATTTGGCAAAAGTATGATGTTTTAACTTCTAAGCTGGAGCCTCGCCGGTATACCTTCCTCTTGCCTGTGTTTACCTTCACACCAGTGTTACTGAGGAGGGCAGCAGAATGCTCAACTTTGGTTTTCTGAGTTTCCAACCAAAACAGAGAACATTTTCATTTTTCAGCAACTTAGGTTAAACTTCCAAACAGAACTCAAAATGGCCATCCTAGCGGACATCCCTTCTCCAAGAGTCACTTGGGTTAGTGACACACTATCCAGCTGCCTTGATTCGGAAAGGCCTGGAGCCCTGAGTTAATGAGTGACACCAGACATACCCAAGGACAAGAACAAGAAAGGAAACATGGGCTTCTTGTCCTGAACGGCCTGTGGTACGCAGGGACAAAGGGAACCCACGTGTACTTAGAAATCCTGAGCACGGCTTCTTCTCATACCAACAAATGAACTAGCTTTCTGTTTCCTCTCCTGATTTCTAATGAACAGTGAAGGTGTCACACTGGTGAAGGACAGGAGAGGTCACCACCACCCTAGGCTGACAGCACAGTCAACCCCTCCTCCTCTCTTCTCATCACCCACCTGTGGCCTCTTTAAATCACTTTAGGAAATACGTTTCCAAAGACTTGACTAATTTATCTCAAAGCATGGTAACAGGGATGCTGTGATAGCATCCTGTGATATATCCCTCTGTGACAGCAGTACCAGAGGAGGCACTGCACTTTCATTTGATGGGCAGGTAGTATTCAACTGGGAGGTATCTGAGGGCTGTCCTGCTGAGGAGTTACTGTGGTGGCAGAAGGCCATTCACACTACCCATGAGAGAGTGACCGATTCATACACCACACAAGGAGGCAAGTGTCACAGCAATGAGTGCTGTGTGGTGGCAGGCTGGCTGTCTCAGTCAAGGTCAAGGGCCAGAGGAACTTTCCATTGTCAGGTCCACTTCCTCACCTCCTCATCAAAAGGACACTTGTGTGTGGTAGAGCACAAGACAGGAGAAGGCCTAGAGAACGAAGCCAGGGCATTGCTGGGAGCCATGACAGGGGTATATTTAAATGTTAGCCACAGGAACAAGCTGGAAGAAATAAATCTCACCTCAACCTTTGACCAGATATATGTTCAAAGAATCAGGCTTTGTACCACAGTCAGTGTATACACTGGGTTTAGCGCTAAGGTCTTTAGCACCGAGAAAGAGGCCAGGCTAGATAACGCAAAACCATGGGAACCCGGAAAGGGAAGGTTTTCTTAAGTGATGAGTACAGGAGCAAGGAACACAGGGAACGAATGACTGGAGCCCTACAGAAGTGAGAACGCTAGATCCTAGACAACCATGGGACCCCGTAGTTAGAGGCAAAGGCCAGGCCGGTTGGATGGTGGGACCATGGCTGCCTAAGCTCTGTAGATCCCAGTCTCTTCTTCACACAGGCAGATAGGCAGTGTTCTCTGTGGCCCGCCTCCAACCATCCCAGTGCTTCACTGGCTTCCGTTGTGGATTTTCATGATTCCAAGTGTGTTTCTCATCACTGATTGTGGAAATTTACCCAGAAACTAAGGGCAGAGGGTAACCTGTGTGATCTGCTGTGGAAGAAAATGATGGAGCCGAGGAAGCCTCTTTGTCCCATCAGAAGACTGGGCCCAGGACCAGTCATGGTTTGAGAACACACAGCAGTTAAAGGGAGACCAGGCAAGGGACCCAGGCTGAGCGTCCGGAATCAGGCCACAGAGACCCTGCCACTGTCCAAAGAACACCTTCAGAAACCCTCTCTCAATACAAAATAAATCTAAAAGATGAAAACTGCTCTCCTTAAAAAGGTGCCGATCCATTGTTTGGAAGAGAATGGTACAGAACAGTGGACTCTGGCCTGCGGGCCACTGTCTGTCTCTGTTGGTGTGGAGTTAGCAGCACACAGCTGCACCCATTTGTCTGTGTATTATTAATGCTGTCTGCTGTAATAACACATTTAAGTATTCCTGACCCAGCCCCTGTGACCCCAAAAGTCCAAAACGTTTGCTATGTCAGCATTTCAGAAAGAATCTGCCACCCCCATCCAGAGCTAAGTCCCATCCGGCATTTTGCTTTTAAAGACAAGTCCTATCTGACCTCTAAACAATCACAGCTATTACAGAAAATGAGCACAATGCAATTACAAGTCTCCACTCATGCCAGTGAGGCCATGGGTTCCCAGGTACTCACAGCTCTTTAAGGTTCTTCATCTTTGCAAAGGCATCAAACTGGACAGACCTGATTGCATTCTCTCCAAGGTTCCTGAAACAGAACACAGTACTTTGTGCTTAGGAGCTATGGGCAGTTGTCAAATGTGTGGCCAAGTGAGGACACTTGGGGGTTTTTCAGGCCAGCCCTGGTTCACAGATGACCCACAGGTGCTAGCCATACCCCGTGTGCCAGATCCACTGGGAGAGGCTCTCGGTTCTCCTGTTGTTGCAAGCACACAGAATGACTTGGGAGCAAACCAACCTAAGAGCAGCCTTGACGTTAGGTAGAAAACTGGGGAAAAATTTACCCAGAATAAAGGCTTACTTTGATTCGAAGATAAAACTAAGAGCCAGGAACTAGAAGCATCCACTCCCAACTGCAGTATGAACATCTCAGGACTAGCGTTCCTCAATCAGTTCCAAGGTCCCATAGGCAAGCACCCCAGTAGAAAAGCTCCCAGCATGCACTAGGACAGGGAGCTGTTAAAGGGGGAGGGGTATTGCCTGGCTTTGCTAGAATAAAGTATCCTTATGAAAGTGGCGAGAGCTTAGGGACCCTTTAAGGAGTCTGATGCATGGTAATATAGCCCAACAGGTGGGAGGAAGGTGTTTGTTCAAATACCAATCACATTAATTGGGAGCACAGCAGCAGACTATATGCTCTGTGAGTGTTCCTGGCAGAGGCAAAAGAAAGGCCAGAGTTGAAGCTGACTTATAATGAGAAGGAAGCAGATGGTGTTTCCAAACAGCCTGTTTCTTGGTTTACAAAGAAGTGGTTACTCCCCCGGCAGCCACGCTTGGCAGGCAGGGCCAGGCAGGGTCTGGCAGGGTACTTACAGGTGTTCCAGGCTTTCCAGGCCCGAGAAGGCTCTCTTAGCCACAGATTTGATCTTGTTTCCAAACAGAGTCCTGTAGTTTCCAAACATCCAGGCCCAGGGTAGGTAGGTAGAAAGGGACCGAGAAGCAATCGAGAAAGAAAGCACACAATCAGGGCAGTGCTGCCTGACACCCGTCTGCAAGAGGCAGGTGCACTGCAGACCTGTAAGGGGATTACAGGGCTGGGGTGCACAGGCCATCCCCACCCTGAAATGAAATGTCTCTAGCTCTATTACATTTCACGGTGATGACAGGCTGAAATTGCATGTTCCACCCAGTCTCAAGAGAGCCCTTGTAGTGTCAAGCGGAAATCGCCATGGCCAGGCCATGCTGTCTTTCCTGGGACCACCCAAGGGGGTGGGGAGTTTGTTAAGGTAGTGCCCTTGCAGAGAAAACTAGGCTGGTTACTGTTTCAGTGAGAAGCAGCAGGGTCAGAAGGCAATAGAAACTGGGACTAAAACCTGCCATCCACTTCTGTGCACTGCACTGTGGGCATAAAGGGTCCCAACTAACCAGCAGAGAACAGGAAGAGGGCATCCATCAAGATAGCCCCGTAGCTCTTTGCGTCTGCCATGCACTATAGTGGCCAGGATGTAGCTGCCCTGATGATATTTACCCTCCTCTCAGGGTCTGCAGAAGAGGCTCTGCACTGTGGCCCAGGTAGCTGGAAGGCAAAGCTCCTTCCTTTGCTTTTGAGGTGCATCAAAGGTATGCGCTAACTCAACACAAGCATGTGTCTGCTCAGGGCACGACAGTGATGCCTAATGAGCTCTGCCCCTCGAGGGTAATGTCTTCCAGCATTTTCTATCAGGCATGTTACATACATAGGCTGGAGGCCTGGGAAATCAGAACCAGCAAGTCCAGGCAGCAGTGGACAGAGGAAGCTTCTGAACAGAGCTAGCCTGGCTCACCTCTTCCCAAAGAGAGGAGAAGCAGGGCTAAGATCTGGACTAGAGGCTATCTTCCACCTATGTCAGACTGATTCCCTCAAGGGAAGACAAATACTAGCCTGCCTGTGACCATGGCCTCGCCATCACCCACCATGTGGCCTGAGCTTCAGACTAACTGTCAAGGCTCTGAAGGGACACGGGGCAGAAACAGGCTGGCCTGCAGGAGCACGGCCCCGCATCCCAGAACAGCCTCCTACAATGCAAAGAACACAGACAGAGGTGGCGGATCCACCTGCCCCCAAGGGCCCTGCCAGAGCACACCATGAGGCCTCCTAAGTCCTGTTTCATTACAGATTCTGGCCCCAGGGGCCCCTGTGGTCAGTTCAGCCTTAGACAAAACCTACTGTTTCCTGACTTAGGGCAAACAGCCAATGGCCCTTCTATCTCCCCTCTCTCTCACAGGCAATCTGGGTGGACAAGAAAACAATCTCATCCTGAAAAGACTTCCACAACTCGCAATCTGGAATTCTAAAATAAACCAAATGCCAGAAGCCCAGTGGCCATGTTCACTTTGGCTCCTTAGCCACAAAACTAGCAGCAAATAACAGCTCACGGGGCACTGAACCCCAGTGCCTGCGAGTCTGCCAGCTCCTGCACTTACTCAGATCCCACAAGCAGGGTACCATGTGCTCCGGGGCCTAGTAAAAACAAGCTGAGCTGTTTAGTGAAATCTCCTGTAAACCAGATCTAGGAAAAGCTGTGCCTTGTTTCATCCATTAAATATTAGTCACGTTGACCTCTTACAGTGAGGGCAGGCTGTTACTTCTAATGGTGACAACAGCAATAAAACAAATTCTCAAATTCTCAATTACACAGTGCCAATCATACCACTGATAGGCTCAAACAGGCCCTGACCTCCTCTCAGCACACATCGGTGCCTCCCTGGACTGGAAGGGTGCTCCAGGGAAGAGGTGGCTAGCCTGACCTCCCTGCTAAGGACTCAGACAGGCAGTGATCTCAGATGTCACCTCTTACACATCTGGCCAGCCCAGCGTAGGCTCCCAAAAGCCATTTCAGTGCTTGCTAAAGCAAGCACAAAGGCACCATGGGTGTACAGAGTGCGGAACGTGTCATGGTCGGCTTTGTATTCACGGCCTTGGAAGGAGCCATGGCATGGACAAGCCTTCCTCACAATGTGGAGTGCCCATCCTGACAGGAAGCCAGGGTCCCACTTCTGTGTACTCTACCTATCCCCCTTTACGTGTGCCCTACACAGAACACCCTCTTCCCCTCCTGATCAATGTCAGAGGTGGACAGGGGTCGGGCGGGGGCTGCTTCTACACAGGTCGCTCGAGGTTCTCTTGAAGTTCTTCTGTGAGGTCCAGAAATGCCCCCTCCCTCACAAGCTGGCATGGACAGGCCCCCAGCAGCAGAACTGCAGAGCATTCTGCAACTTGGGCAAGAGAACAAGTATACCATATCCAGGGGTACAAATCCGAACCTGCCACCTGCCAGGTCCTGGGCTAGTTCCCTTCACTTGTCTCTGGAGCTCTAAAGGCTGCATAATGGAGCCTGCACACAGACATGTACCTACTACAGCAGTGGACGAATTCTAGGAGGGCAGGACAAAGACTCTCCAAACTGAATTCAAAGTAGCTATGACTAGTGCTCTTGGTGATGGCTGCTTCTACTTGTGATTATAATTAGCAACAAAAAGACTGACAAGAGCCTCAATACTACTGAAAGGTACTTCACACATCTCTAGAAACTAAAGAAGGCAGCAACACCCCTCTGTGCAGAGGACAGAACATATAGGTGCTTTCAGATGGGCTGTAAACAGGACCAAGCCCAGCAGCCCTAAGGACCACCACACACTGACAGTATGAAGACTGTGAGAGTGGCCTGTGAGCCACTGCGGATTCCTCACTGTAGCCCTCAGCCTCTTCTCTGCACACAGCAGAAGGCCTGCTGCTGTCCTCTGTGGTCCCAGGACACAGGAGACTCAGGGGAGCTGCATGAGTGGCACCCCTGCATCCCAGAGCTTGCGGAACCGCACACTCCCAGTCTGAAATACTCACAGCTTGCTGAGGTTGTCAAGCCCCGTAAAGGCACCACTGGTATCCTCGATTGTACCCGAGATCTCGTTATGGTCCAGGTCCCTAAGAAGGAAACAGAAGGCAAGTTCACCCACTATCTTAAGCTCTGCCTTTGTTCTCCACCATGAAGGGAGACCAGCCCCACACCCAGGCTTTCACTAGGAGCCGCAAAGCATCCAGGTGCACCCCAGGGGGCCCAGCAGCATGCATTGCCAGGAGAAGTATGGCCCTGAGAACGTCCTGTTGTTCTTTTTTGTGTACTATCAGCATGACCTTGCTTCTGCTGCTTCCAACAAAGCCAGCCCGCCCACCAACCAATCTGGCTGGCCTCAGGGAGGGAAATAGTAGAGACAGCACAAGAAGAAGCCAGGCTTGCACACACCTCTCTGAAGCAGACCTCTAACCCAAAAGATTCCTAACCATTTCTGTCTACTCTTAGCCACAGTCCTCTCTCGGGTTCAACCAGGACACTGGAAGGCACGTGGAAGGAAGAGGTGGCGGCGAAGGAGCTGGGCCCTGATGTTCCTCCAGGCCGGCCTGGAAGCCTAGGGCCTGCACCCTGCTCCTCGTGAGGCTTATGTAGCACTGGATACTGAGCCAGAGCACACATCTGGGTGCTGAGTCAATCTTGTGACCCACTTGCCAGGACAGGAAAAAGGAGGCCAACTACTCGGCCCCAGGCTGTCTGGATATGGTCAGTGCTTCAGCTTCCTCCCTGAGCTTCCAAGGGCAGGTCACGCTGCCCAGCCACACGCACCTGGCAGCCAGACCCCTACTCTCACATTCACTCTTTCCAATTTTTCACAGAGCCCTGGTCCCTGCACATCCCCTGCACGAGTCCCTGCAGATATGGCCAAGGACAGAAAGGGATGCAGCTCTTGGCTCTGGGAAGACGCTGGAAAGTCATTGCCAGCTGGGAGTGGAGCTGGGACGAAAGTACACAATGCTTGCTCTGACCTTCACTTTCCAGCATGAAGCTAAAAGAGAATGTGCTGCTGGAAGGGACCTCTGCTCTCAACGAGTCCCACCCTGTCATCTTTAGACTGAGTACAGCAGAGACTGCGGTTCTGTGTGCCTGTCTTCCTGCTCTGGGCCTTGCCTGCCAAATTAGTCCTCTCTTTCTGGCCTGCTCAGCTTGAATGTTTCTGGCCTTTCTGTCCGGGCCTCGGAAGGGCTCACAGACTGACCTGGGCTCGGATAGCTTGCTTGGCACTAGCTCCCCATCCCTGACTCAAACCTGAAGCCCACTCTGCCTGGTGCAAGTGCAGAGGCCTCCCTCCAGGCACAACGACAGGCTTGCTCCCCCAGCAGACCAGGCTGCAGAAGAAAGCTGTGGAACTGCTACCACTATCTGTGGAAGACTGTGTGCCCTTCTGGGGGGTTTTAGACTGAAGGCTGCTAGGAGACAGCCTAGCGTTTACAAGTGAAAAAAGTTCTATGAAAAGTCCCAGAAAAGCACCCTCAGCAGCTTCTAGCAGCCTCACCCATCTGACCCTTCAAAGGACATGGTATTCTCACTTTCTCTTTCTTACACCACTCCTGAATGAGGACAAGGACACAGGACCCTCACTTCTATCTTGGATACCAGGTCCACTAAAGAGCTTCAAAGAAAGAGCAGAAAAGTAGCCATGGTACTGAGTTACAGAAAACAATACATAGGATTTAAGAACGGAAGACAGGACTGGGGGTGTGGCTCAGTAGAAGAGAATTTGCCTATTACACATAAAGCTTTGGGTTTGATCCATAGAAACCTTAGGAAAAAATTCTCAAAACGTACATCCAGGCCTGGAGGCTCACATACCTGTAATCCTAGCCCTTGATGCAAGAGGATGGCCACAAGTTCAAGGCCAGCCTCAATATATGAGCTTGAGGCTAACCTGAGCCAGAGAACCCAGTCTTTAAAAGCAAATGAACAAAACCACTACCATACCCTCTCTAAAAGAGAAATAAATGAGAGGTCACAACCAAAAGAATGGAGCAGAGACATGCAGGACTGTGTGAATGTTGCTGCAGATACCCTATGTAGAAATGCTTTTCCAGACCCACCCATCCCATCCGGCCAAGTGTACTGAGAACTATTGATAACAGTGATTTTTCAAGAGTCCTCATCCTGCAATAGGCACCACTGTGGGAAAGGAAGGATTTTTCTGCTCAGTAAAGGAAGGATTTAACTGTTCAGCAGTTATTTTTGGTTCTAGTCCTTGTTCCTGTTGCAGACCAGCTTACAGCCCAATTCTGACTACAAGCCAGCAAGAGGGAATCTCAACAAAGCAAGTGCTTTGCTGTGTGCTCTCCCATCTGGGGACCCCCTTCATGCTGTCACCCTCAAAAGCACAATTCTTACAAGACCCGCAGACTCTTGAGTCCCTTGAAGGCGCCTTCAGCAATGTGACTGATGGCGTTGTGACTGAGGCGCAGGATACTGAGGCTGCTCAACTCCGCTAGACTCTCCTCATCCAGCCGCGTGAGGTTGTTGAAGGACAGAATCCTAAGGAAGAAAGAAGAAGACAAATGTCACCACTGAGCAGCTATGTGGGTGCCCTATTCTCTCTTGTCTTCAGTTGTGTCTCATGCCACAACTGGCCTGACCTCCCTGGAGACAGGAGACTGAAGCATGTCCACAGGACTCCTGCTGTCAGAAGACCATCAGGTCAACAATCACCTAGTTTGATAACTATCATGCAAGCCATGAAACCAGTACCACAGAGCTGAGAACTACCGCTTACATACACTGTAAAAACCTGTCATACAACCCAAATCCCAAGGCGCCAAACCCCTCCACTGCATGTCTTGGTGTAGGAAATGAAGGACCTATCTTGATGGAGACTGACACAACAGAACCTGGAATTCTGTACTGAGCAACTGAGCCACAGCTACACTTGCTGTATCAGCCAGCAGAGGGCACCATGAGCCACTGCCTGGGACAGCCACACCAGGGGAAGACCCTGACACTAAAGGCTCAGGCTGTGACTTGTACACCGCTCAACAGGGATTGGGCGCCAAAGCATACCTTTTGCTAGAACCAAACCCCCTTCCTAGCACTACTGCAGGTGTGCACTACACTGGGTAGGTTTATGTAACATTAGTTATCTATGGTTGGAAATGTTAAGTCTGGACTGGTACAAAAGGAACAAAAATGAATTGGTGGAAGATTAATGCAGTTTTAAAGGTGACAGTGACCATATTCTGTCCCTATTAAGAGAAATATGTCACAGTGTCTATCAGTTGCAAAGACCTAGCAGGAGACCATCGTTACATCCTCATGTGCAATTAAAGAATTTAACTAAAAGGCAGGGTAAGAACACACTGCAGAGCAACCCTATATCTGGCTCTGACATTTTCTAAAATGGAGCAGATCGCTAGGACTAGTCTAATACACTCAAGTGAACCTTCTCTTCCTCTAAATGGCACAGGAGATAGCGTAATGTTGTCCGCCATGCAGAAAGGGAAGGAAGGAACTCAGGGGTCTGCCTGCGAGTTTTCCCTTTCCATGTAGCCCTAACTCAAGGGGCCCACACCGTTCTGGTGTGTTCCATAAGACTGTCCTTACTTGGGAACTAGACTGAACACCTTCAAGGCCTCTCTTTTCCCTACAAGTCCGAGCTCCCAACAAAAGCCTCGGTCAAAGCCATGGGCAGTGGTCAGCAGGAGCACCTCTAGGTGGCAGGAAGCTAAACTCAAAGAATGCACACTAACACAGAATGGAAGAGAAATGAATACAAAGCAAGGGGCAGGACTGTGGCCTTTCACAAAGCACAGGGACTGGCTAAAGTATGAACCCTGGGTAATGACAGACACACTGAGAGCGAGATCAGAATAGAGAAGACCAGAGGACAACAGGCTGCAGGAGTCATCATTGGGTTCCAGGGTCTCTAACTATTCCTGCTGAGATAAACAAATACAAGAGAGGCTGAGTAAGGTGCAACATTTCTACCAATCATATGCTTTGGTGGGTCAATCTTTTCCTATACCCAAGCCTAGCCAAAGAAGATAAAAAGAGAAACCCTGAATTTCTCAAAAGTAAACCTACTGGACTATACAGTGTCTATTAAACTAAAAGAACTCCCAGATGAGGGACAGGGACAAAGGGGCAAAAGATGCTTGATGAGTCCATGGCTCTGGCAGTGTTAGTGTGTTTGCTGTGAGGGCATGGCCAGGCCACCCAGGCCACGCCCTCCCCATCATGGAAGTCTGTCACTACCATTCTCAGAAGCAAGGGCACAACCTAGGAACCCTGTCTAAAGGACCCTGCATCTCCACTTCTGCAGTGGGATGCAAACAGGCAGCAAGGATCCCAGTGTCCTGAGGAACTGTCTCTTGCTGGAGTTCCCAAGGCCAGACCCATCTTTCCACCATCAGCATAGCTTCAAAGTCCTACTCAGATGTGACCTTTTCAGTCAAGAGATGCGTGTGGACTACTGCCACCCATGAGTGTTGTGTTGACGACATCAGGCTTCTGTTTCCTGCACACCCTGTCCTCTATTTCCAGCTCCAAGTCTAAGACCTGGCGGGCAGCGAGTCCACGTGGGTCTTCCTTCCTGCACACACTGCCAGCCTTCCCACCTTTGGGCTGCCTCCTTATTTGGACCCCATGGGGTGAGCTGGGCTCTAGAGGCTTCACTTCCCAAGGTACTTCACTGCCCACTGCCCCAGACTTACAACTCATGCAGCTTTTGGCAGAAGCTCCAGCCATCACGCTGAATTCGAGAGATGGAGTTGTTGCTGAGGTGCAGCTGGTGCAGGGCTGTGAGGCCATAGAGGGAGCCACTGTTCACTTCCACCAGACTGTTGTACTCCAGGTGCCTACAGAGACACACATGCAGGGGATGAGACTGCCAGTCTCCCATTACACAGACAGCAACCAGGAGGCCATCTGTGCCACATTCAGTATTAGAGAGGAAATTTAAGCAAGCAGATCTTGCTTTGGTCCATCTGACTTTCTCCTACCGCTCAAAGCATGAGAACTTAGTGGATTTTTAAAGTCCTGAGAAACATACTAACCCCTCATTTGTACTGATGTACGCAACATTAAAAACCAAGTGGCAGATAACAAATTTTGTTCTGAGAACTCTGATCTGGACCTCAGATTCCTAAATGAACACAGGAAACCGATATTCAGCTAATCAGAAGTGGGAAGTGTGAACAGCAAGAAGCCAAGCAGCAGGCTCCTCCTGTGCATGCCATACAAAGTGGGCATACGTGGGGAGGGAGAGTCACTGGGAGATGCTTCTGCTGATGAGGCTGGGGAACACACTGGTGGCTGTGAACCTAGGCTTCCGACTTTGATTTCAGCTACAAAAATAACAGCATATGTACAGGTTGTAATGTAATTTGCATAGGAAACCAGGCGTAAAAGAGGTGAGCAGCTGAGCCGCTGATGGACACAGGCAAAGGCAGAGGTACAGTTGTGTCCACCTGAAAGGAGACACTGGCAAACATGAAAACCAGAACACCAAAACACCAAAGATATGGATGGTTGAAATGACTGCCTCTTGGAAAACAAGCTGGGGGCAACGGGGGTGGGGGGGGTCACAACACCACCTTCTCTTTACTTCCTGACTATGCAGATTCGTTACTTTTGATTTAAACAATTGTAGAGGTTTAAAATCAGAAGATCAGTAATTGCCCCTCTGCTGTTCTTTTTCATTATTCTGGCAGCAGGCAGCTCTGCTGCTGCACACATCTGGCTGGAAACTCCCTTGATAAAAGCTGCACATCTGCACTCCGTGTCTTGATTAGCTCACAAGGCGGGAATAAATCTCCCAAGATGAACTATACATTTTGGCCCACCTGCACATCAAGAAAGCCTATCGGGCCCAGCGTGAGGAAAGAAGGGACTTCCGATAAGGTGTGGGAGTGGAGAGGATGTGGGGAGGGAATCACTCTGCAGTCTTGGGTTTGTGGAGGAAGTGGGGGTGGAGAGCAGGCCCAGCAGACTAGTGCAATCCATCTCTTCCCACTTCCTTAGCTGACCATGTGTCCATTAAAACCTCCTTCTACCTTGCAAGGAAAACAACCTTGGTTTTGGTTCATTTTGCAGAAAAAGGCAGCATCCAGGTGGCCACCATCCCCGTGCCCAGGAGGGAGGCCGCACTCACAGCACGTGCATCTTAGACAGCCCCCAGAAGGCCCCGTCCGTCAGCCTGCTGATGTTGTTCCTCTGAAGCCTCAGCACCTCTAAGCTGTCGAGCCCCTGGAACGTGAGGCCTTCAATCAGCCGAATCCGATTCCGATTCAGGTCTCTATGGAGAGAGAGGAAGCCATCGGGTCAGAGCATCCCTTGTGCACATCTAGGCTGCACCGTTCCGAGTCGGTGGTGAAACCATGGAGGAGGGGACACCTCAGCTGGCACACTGGCACTGTCAACAGCAAGGGTGACAGCCTAGGAGAGGGACAGTGAATGCTGCATGGCTAGCTCTGTACTGCCCCAGTACTGTGGGGACATAAGCACCCCACAGTTCTTCCCTCAGGACAGCCACCATTCAGGAGTCTAGAGCAGGCCCTGGGCATGACTCAGAGGTACATTCATTCCTTCGCTGAGGTGTCTCTGAGCTCAGCAACAGAAATCCATACCAGATGCTTCAACCCAAGAAAATCCTAACCATTGGGTACCAAATATCAGCAAAACTTCCACTCGGGGCATCTGACAGACCTCTGTGCAATGGGAAGAAGTGACAGCTTGTGGAGAAGTGGGGGGTGGAGCAGATACACACTTGGCACCTCGTCCTAGCAGAACAGCCTTAGTTGACCAATAGCTATCTGGAATCTGGGTCAGCTGGATCCCATTAGCAACTCTGGGGAAGGTGGGAAGACACTGCACTAATTAGAAAGCCCTTGGTTTTTCCCCAAATATTTCTGCAGTGTCTCATGACCCTGCTTCACACACAGCCTCTTCAGCTTCTTAGACTGGAAAGAGCAGAGTCAAGCTCCTGCACTCAGGAGAAATGAGGACAGGGCACTCTCTGCCCTGTGCCAGCCTGGTCTGCAACTGTTTCATCCTGATCGAACCAAATTGTGAATTCTAGCTTATTTCCCTGAAATATACTCTTCTGCTAAAACGAAGACACAGGGAAACAAAGAGTTGAAGAACCTTTTACTGACTGGGGAGTTTTGGTTAATATATGGTTTCTAGCACCCTGTGCCATTTTAGGCTCCATGAAAAGAGACATAAATAAATCCTTTTATACAAAACCAAACTGGCTAACCTTCTAAAATTTAGGAAATGAAGAGGCAGCTGCCTCTGGTCAGGTTAACTTCCCCAGAAGGACCAGATACCTTCCCTTCCAAGCTACAGACGGCCTCAGCACCTTAAACATTGCTAATACTCAAGATGAGAGCTCAACGAAGTGAGGATGGTAGTGGTGAGTGCACTTGGGAGGCTGAGGCAGAAGGATCAAGGGGGGGTGGGGATGGGGGGGGTGGGGCCTGCACTTCAGAAGTATAGCATCAGGGAGGCTAATCATCCAAGCACGAGGGTCTTTTCCTTGGCCATCTGAGGCAGCCTGCCAGCACCAGACCCAGCTCCTAATTTGCTTTTATTAGGTGTTGCGGTAGGGTCATAAATGATAGTTTATGCAGAGCTTTACCAGGGGGGTGAGGAAGGGGTGGCGATTGGTACAGGGTCCTTGGGGAAATCTGGCCCCATAAAGTTTGGCTAACCTTAATTAAAGTGCAGGTTTCTGTACTCACAGTTGTGTCAGCCTGGGTAGCTTGAACGCTTTCACAGGAAGCTGGGTGATCCTGTTTTTGCTCAGACGGAGAGTCAGCAGTGACCGCGACAGACCATCAAATGCTCCAGACTCCAGGATGCTGATGCGGTTGCTCGCCAAGTTGCTGGAATGATTCAGGAGAGAAAATGTAGTGGCAGTGGGAGGCCTTCCTCACTCCTTGTGCCTCCAGATCCAGCTGGGTCCGCTAGGAAAAGTGCTAAGGCAGACCCAGAGGGGCAGATCTCCACTGAGTTAGCTGTTCATCATCTCAAGGCTTCCCAGCCTGCCCTGACTTGAAGACAGGGAACCTGGGAATGCCGGTAGCAGGAATGTCTCATGAAGAGAAGACACTGGCACAGGCCTTACTGCAGCACAAAGCAATGTGCTCGTGCCGGTGGGCATGACTAACCTTTCCCCACACAGCTGCACAGAACAATGCCTGCCTCGGGAGAACTTGCAGATTCCTGCCTTACCGCCCACTAATTCAGGCTGGCCAGGAAAGCCCTAATAGCAAAAAAGTCAATTGGCAGACAAGGTCAATGGGTTTTATACTTTAAAGAAACATCCTTTATTTAATCCTGAAGAGGGCTAACTGTATGACTTATGAAGATGCACAAACCGTTCGTTTAAATAATTCTAACAACTTCAAGAAGCACTTAGAGACCTCTGTGAGTCCTTTAGAAAACAAGAGATACATCTTCATGGGGCTGCACACTACGCATGCCAGGGGAGCCTCCTGTGACCACACGGGAAGGGACTCTTTCTCAAAGTTACATGGCAGCATACAGCATAGATGTTCTCTCAGGTAGTAAAAAAGACAAGACATGGAAGGACCACCCCACACCTCTTCCTGCCTTCCCCAGACAAAAGCTTAAGTGCAAATGAGACAGACTAGAGAGAAGCTTCAACCACAGTGGGTTGTGTGCCAAGAGGGAATGAGGTACTTCTATTCCCGCCATCAGGCAGCAGCCGAGGGCAGGGCACATGAGGACTCTGCAAACGGGGCTGGACTGTTTGTTCTTAACACTCCAATTAAAGAGTCATCAGTGTGATGGAGACACAGCAGCCAACAGCTGCCAAGGAGAAAGTGCCCTCTGCATCTCTGCAGAGAGAGGACAATACAATCCAGCGTCGTGGTTGGCGGCTCTCTACACAAGAAGTACCAGGTAGTAGCTGGGCCTTTAGAAAGCCCCCTCCCAGGGCTTCATAGAAGCCAGAGCCTCTTGTCTCCAATTCTTGTACCTTGATGAACTTTCAGAAAGTATCATTT
D5_D3 94578805 94578813 9 CCCCTTTTT
G5 94584488 94584537 50 AAATTCTCAAATTCTCAATTACACAGTGCCAATCATACCACTGATAGGCT
U5 94579663 94579712 50 TTGGCAAAAGTATGATGTTTTAACTTCTAAGCTGGAGCCTCGCCGGTATA
U3 94579543 94579592 50 CACTACCCACAACTCTCTCCTCATTCTGCAGAGTGCAACAGCCAAACAGA
D5 94578814 94578863 50 AATTAAATATGTGTACTCCAAGAACCACAGAATGAGGCACTGTGCAGTAA
D3 94578755 94578804 50 ATCAGAACTATCGCACTGTAACCAGTTATTTAGATTTGTAGCTAAACCTA
G3 94573609 94573658 50 TGGAGGCACAATGGTTTCATCTGCAAGGAGCCAAGACAATAAAATAACAG
G5_U5 94579663 94584537 4875 TTGGCAAAAGTATGATGTTTTAACTTCTAAGCTGGAGCCTCGCCGGTATACCTTCCTCTTGCCTGTGTTTACCTTCACACCAGTGTTACTGAGGAGGGCAGCAGAATGCTCAACTTTGGTTTTCTGAGTTTCCAACCAAAACAGAGAACATTTTCATTTTTCAGCAACTTAGGTTAAACTTCCAAACAGAACTCAAAATGGCCATCCTAGCGGACATCCCTTCTCCAAGAGTCACTTGGGTTAGTGACACACTATCCAGCTGCCTTGATTCGGAAAGGCCTGGAGCCCTGAGTTAATGAGTGACACCAGACATACCCAAGGACAAGAACAAGAAAGGAAACATGGGCTTCTTGTCCTGAACGGCCTGTGGTACGCAGGGACAAAGGGAACCCACGTGTACTTAGAAATCCTGAGCACGGCTTCTTCTCATACCAACAAATGAACTAGCTTTCTGTTTCCTCTCCTGATTTCTAATGAACAGTGAAGGTGTCACACTGGTGAAGGACAGGAGAGGTCACCACCACCCTAGGCTGACAGCACAGTCAACCCCTCCTCCTCTCTTCTCATCACCCACCTGTGGCCTCTTTAAATCACTTTAGGAAATACGTTTCCAAAGACTTGACTAATTTATCTCAAAGCATGGTAACAGGGATGCTGTGATAGCATCCTGTGATATATCCCTCTGTGACAGCAGTACCAGAGGAGGCACTGCACTTTCATTTGATGGGCAGGTAGTATTCAACTGGGAGGTATCTGAGGGCTGTCCTGCTGAGGAGTTACTGTGGTGGCAGAAGGCCATTCACACTACCCATGAGAGAGTGACCGATTCATACACCACACAAGGAGGCAAGTGTCACAGCAATGAGTGCTGTGTGGTGGCAGGCTGGCTGTCTCAGTCAAGGTCAAGGGCCAGAGGAACTTTCCATTGTCAGGTCCACTTCCTCACCTCCTCATCAAAAGGACACTTGTGTGTGGTAGAGCACAAGACAGGAGAAGGCCTAGAGAACGAAGCCAGGGCATTGCTGGGAGCCATGACAGGGGTATATTTAAATGTTAGCCACAGGAACAAGCTGGAAGAAATAAATCTCACCTCAACCTTTGACCAGATATATGTTCAAAGAATCAGGCTTTGTACCACAGTCAGTGTATACACTGGGTTTAGCGCTAAGGTCTTTAGCACCGAGAAAGAGGCCAGGCTAGATAACGCAAAACCATGGGAACCCGGAAAGGGAAGGTTTTCTTAAGTGATGAGTACAGGAGCAAGGAACACAGGGAACGAATGACTGGAGCCCTACAGAAGTGAGAACGCTAGATCCTAGACAACCATGGGACCCCGTAGTTAGAGGCAAAGGCCAGGCCGGTTGGATGGTGGGACCATGGCTGCCTAAGCTCTGTAGATCCCAGTCTCTTCTTCACACAGGCAGATAGGCAGTGTTCTCTGTGGCCCGCCTCCAACCATCCCAGTGCTTCACTGGCTTCCGTTGTGGATTTTCATGATTCCAAGTGTGTTTCTCATCACTGATTGTGGAAATTTACCCAGAAACTAAGGGCAGAGGGTAACCTGTGTGATCTGCTGTGGAAGAAAATGATGGAGCCGAGGAAGCCTCTTTGTCCCATCAGAAGACTGGGCCCAGGACCAGTCATGGTTTGAGAACACACAGCAGTTAAAGGGAGACCAGGCAAGGGACCCAGGCTGAGCGTCCGGAATCAGGCCACAGAGACCCTGCCACTGTCCAAAGAACACCTTCAGAAACCCTCTCTCAATACAAAATAAATCTAAAAGATGAAAACTGCTCTCCTTAAAAAGGTGCCGATCCATTGTTTGGAAGAGAATGGTACAGAACAGTGGACTCTGGCCTGCGGGCCACTGTCTGTCTCTGTTGGTGTGGAGTTAGCAGCACACAGCTGCACCCATTTGTCTGTGTATTATTAATGCTGTCTGCTGTAATAACACATTTAAGTATTCCTGACCCAGCCCCTGTGACCCCAAAAGTCCAAAACGTTTGCTATGTCAGCATTTCAGAAAGAATCTGCCACCCCCATCCAGAGCTAAGTCCCATCCGGCATTTTGCTTTTAAAGACAAGTCCTATCTGACCTCTAAACAATCACAGCTATTACAGAAAATGAGCACAATGCAATTACAAGTCTCCACTCATGCCAGTGAGGCCATGGGTTCCCAGGTACTCACAGCTCTTTAAGGTTCTTCATCTTTGCAAAGGCATCAAACTGGACAGACCTGATTGCATTCTCTCCAAGGTTCCTGAAACAGAACACAGTACTTTGTGCTTAGGAGCTATGGGCAGTTGTCAAATGTGTGGCCAAGTGAGGACACTTGGGGGTTTTTCAGGCCAGCCCTGGTTCACAGATGACCCACAGGTGCTAGCCATACCCCGTGTGCCAGATCCACTGGGAGAGGCTCTCGGTTCTCCTGTTGTTGCAAGCACACAGAATGACTTGGGAGCAAACCAACCTAAGAGCAGCCTTGACGTTAGGTAGAAAACTGGGGAAAAATTTACCCAGAATAAAGGCTTACTTTGATTCGAAGATAAAACTAAGAGCCAGGAACTAGAAGCATCCACTCCCAACTGCAGTATGAACATCTCAGGACTAGCGTTCCTCAATCAGTTCCAAGGTCCCATAGGCAAGCACCCCAGTAGAAAAGCTCCCAGCATGCACTAGGACAGGGAGCTGTTAAAGGGGGAGGGGTATTGCCTGGCTTTGCTAGAATAAAGTATCCTTATGAAAGTGGCGAGAGCTTAGGGACCCTTTAAGGAGTCTGATGCATGGTAATATAGCCCAACAGGTGGGAGGAAGGTGTTTGTTCAAATACCAATCACATTAATTGGGAGCACAGCAGCAGACTATATGCTCTGTGAGTGTTCCTGGCAGAGGCAAAAGAAAGGCCAGAGTTGAAGCTGACTTATAATGAGAAGGAAGCAGATGGTGTTTCCAAACAGCCTGTTTCTTGGTTTACAAAGAAGTGGTTACTCCCCCGGCAGCCACGCTTGGCAGGCAGGGCCAGGCAGGGTCTGGCAGGGTACTTACAGGTGTTCCAGGCTTTCCAGGCCCGAGAAGGCTCTCTTAGCCACAGATTTGATCTTGTTTCCAAACAGAGTCCTGTAGTTTCCAAACATCCAGGCCCAGGGTAGGTAGGTAGAAAGGGACCGAGAAGCAATCGAGAAAGAAAGCACACAATCAGGGCAGTGCTGCCTGACACCCGTCTGCAAGAGGCAGGTGCACTGCAGACCTGTAAGGGGATTACAGGGCTGGGGTGCACAGGCCATCCCCACCCTGAAATGAAATGTCTCTAGCTCTATTACATTTCACGGTGATGACAGGCTGAAATTGCATGTTCCACCCAGTCTCAAGAGAGCCCTTGTAGTGTCAAGCGGAAATCGCCATGGCCAGGCCATGCTGTCTTTCCTGGGACCACCCAAGGGGGTGGGGAGTTTGTTAAGGTAGTGCCCTTGCAGAGAAAACTAGGCTGGTTACTGTTTCAGTGAGAAGCAGCAGGGTCAGAAGGCAATAGAAACTGGGACTAAAACCTGCCATCCACTTCTGTGCACTGCACTGTGGGCATAAAGGGTCCCAACTAACCAGCAGAGAACAGGAAGAGGGCATCCATCAAGATAGCCCCGTAGCTCTTTGCGTCTGCCATGCACTATAGTGGCCAGGATGTAGCTGCCCTGATGATATTTACCCTCCTCTCAGGGTCTGCAGAAGAGGCTCTGCACTGTGGCCCAGGTAGCTGGAAGGCAAAGCTCCTTCCTTTGCTTTTGAGGTGCATCAAAGGTATGCGCTAACTCAACACAAGCATGTGTCTGCTCAGGGCACGACAGTGATGCCTAATGAGCTCTGCCCCTCGAGGGTAATGTCTTCCAGCATTTTCTATCAGGCATGTTACATACATAGGCTGGAGGCCTGGGAAATCAGAACCAGCAAGTCCAGGCAGCAGTGGACAGAGGAAGCTTCTGAACAGAGCTAGCCTGGCTCACCTCTTCCCAAAGAGAGGAGAAGCAGGGCTAAGATCTGGACTAGAGGCTATCTTCCACCTATGTCAGACTGATTCCCTCAAGGGAAGACAAATACTAGCCTGCCTGTGACCATGGCCTCGCCATCACCCACCATGTGGCCTGAGCTTCAGACTAACTGTCAAGGCTCTGAAGGGACACGGGGCAGAAACAGGCTGGCCTGCAGGAGCACGGCCCCGCATCCCAGAACAGCCTCCTACAATGCAAAGAACACAGACAGAGGTGGCGGATCCACCTGCCCCCAAGGGCCCTGCCAGAGCACACCATGAGGCCTCCTAAGTCCTGTTTCATTACAGATTCTGGCCCCAGGGGCCCCTGTGGTCAGTTCAGCCTTAGACAAAACCTACTGTTTCCTGACTTAGGGCAAACAGCCAATGGCCCTTCTATCTCCCCTCTCTCTCACAGGCAATCTGGGTGGACAAGAAAACAATCTCATCCTGAAAAGACTTCCACAACTCGCAATCTGGAATTCTAAAATAAACCAAATGCCAGAAGCCCAGTGGCCATGTTCACTTTGGCTCCTTAGCCACAAAACTAGCAGCAAATAACAGCTCACGGGGCACTGAACCCCAGTGCCTGCGAGTCTGCCAGCTCCTGCACTTACTCAGATCCCACAAGCAGGGTACCATGTGCTCCGGGGCCTAGTAAAAACAAGCTGAGCTGTTTAGTGAAATCTCCTGTAAACCAGATCTAGGAAAAGCTGTGCCTTGTTTCATCCATTAAATATTAGTCACGTTGACCTCTTACAGTGAGGGCAGGCTGTTACTTCTAATGGTGACAACAGCAATAAAACAAATTCTCAAATTCTCAATTACACAGTGCCAATCATACCACTGATAGGCT
U3_D5 94578814 94579592 779 AATTAAATATGTGTACTCCAAGAACCACAGAATGAGGCACTGTGCAGTAAATACATGTGGTTTCCGTGGGAAATAAATTGCACCCAGCAGCTGATCTGTAACCATGGACTACACTAACTAGGGTCACAGGAATCAGTCTTATGATGAGACGTTCTTCCTGGCCTCTCTGCCCTACATCAAAAACAAAACCAAAAACCTCAAGGATAATCTTACCACACACAAAGCTGTCTGGCAGCACTGAGAAAATGCTCTGGCCCTTCAGCGACTCTGGATGGGCACAGGTGGCTGTCACAAAGGCCTGCAGCATCCTACCCATTAGCCATGGGGGCAGCCACTTGAGCTGGCAGTCACACAGGAAGCTCTCACTGCTGATGTAGCTGAAAGAGAAACAAGAGGTGAATATTTAACAGACCATAAGGAAGGGTTCTTTGCAAAACATCACAGCTAATCAGCTTAGAAGGCAGGACATGCAGTTCCAAAGGGAACGATTTTCCCCAGTGACCAGGGACAGCTCACGCACCCTCCATGCAGATTTGAATAGAATATGGCTTCTGATACAGAGCCCAAGATACAACATGCCAAACTAGCCCCAGAGCGGCATTGAGAATGCTGGTCTGAAGACCACAACTGGAACAGCAGCATCCATGTTCTCAGGGGATCAAAGCTCCTGTCACCCTGGGGGTGCCTTCTAACCTGCTGTGACCTGGGATACACACTGTATGTGAGGGGCACTACCCACAACTCTCTCCTCATTCTGCAGAGTGCAACAGCCAAACAGA
D3_G3 94573609 94578804 5196 TGGAGGCACAATGGTTTCATCTGCAAGGAGCCAAGACAATAAAATAACAGGGCTGCCACAACAATAAATACAGATAACTACGCACTATCACAAGGTCACACGACAGTGGCTCACACACAGAAAGCTGTGCAGAGGCTCGGCAGCCGCTCATTAACCTCCTTTACACCCTGGTGTAAACATCACGGCAGTCAGACGCCTGGCTCCATGAGGAACAAGGAAAGGAAGGCCTAACCAAGACTGAGAGCCTAGGAACAATCCGGTTCATAACAGGCGTGGCCCTAGGGCCTCTGAGCTGCCAAAGAGACCAGAAACTGCAGAGACCAGCGAGTCCTTGCATGTGAGAGTATTCCCATTTTCTGTTCTGTCCTTCAGAGCTAGCTTGCTGTTGGGGGGGGGGGAGGACATGGACCAAAGTCCCAACTCTACAGGCAGAGTCCATATTCCTAAATGTTCTAGAGACCTTTCAGGTTCTAGGCAAGCCCCCAGGCCTGCATCGTTTACCTCGGACTGCGGCAGTGTCACCCCATCTGCCCCCAGCCCCCCAAGTCCGCTGTGCTGCTGACCTGTGTTAGTGACGCTGTACTCCTCGCTCTTCTTCCTGGTCTGGTAGATGATGCACACCCACACCAGCGAGGTCAGGACAATACTGCACACCACAGCAATGGTGAAGATGCCTACGGTGGTCCCATCCTTCCGGCAGCCAGGGGTAGGTAAAATGCTCAGCTGGCTATGTGCTCGCTCAGTGCCCAGGGGATTAGACATCTCACAGGTATACCGCCCTGCATCGTCTATCATCACATTCTGAACAACCAGCAGCTGGTTGCCTGGAGTGAAATGGTGGCGCTCTGTGAGGCTCAATGGGCGACCTCCCTTAAGCCAGGTGATGCGTGGTGTGGGGCTCCCGGTTGCTTTGCACTGGAAGGCCACTGTTTCTCCCACAGTTACCACACGGTCTTCCAGAGGCACTGCCAAGGATGGAGTTTCTGCAGGAAGGCAGTGGAAATTGCACATTTATTCTATGGGTCTCGCTTGCTGGAGGTATACATGTTTTCCAGACAGAAGACAATCCCATGTTGTAGTGAAATGCTATCTGAGATCTTTTATTGGAGCACCAAGCTTTCCAGAAAGCCTAATGTAATTAAATCACTGCCATTCTAGGAACAGCTCAACAGAGCAAAGAACTAAAGCCCTACCCTATCCCAAACTGTCCTGTTATAGACCTTTGTCACTACTCCTAAGATCATAGCCCACCTGTGTGAGTGCACACACACACACACACAGAATTCTCACGCAGACTAACATATAGCTCATTGTCTTTTATGAGCTGAAACTACTCGCTTAAAAGCAGCCCCAAAATTCAAATTAACTAGACAGAGTCTACCACAGGGACTCCAGAAAGCAGGTTCTCTAATACTTGAGTTGAATCCCCACCCGACCCTGCCACACGTGCGCGAGAGCTGTCGTAGCGAACCTAAGACTGTGAGGGTAGCGTTGGCTGAAACCGAGCCTGCCGAGTTCTGGGCAGTGCAGCTGTAGACCCCCATGTCGTCTATTTTCACATCAGTGATGAAGAACACATCATCGTCTGGCATAACATGCATGCGTCGCTCACGAGCTGCCGGGAAATCGGTGCCTCCATCCTTCTGCCAGGCAATCTGAGGGTTAGGGTGGCCCGTGGCAGCACACTCGAGGCGGGCTGTGGTGCCAGTCCGGATGGCAATGTCATGGGGTATTTTAGTGAATGATGGCAACACTGGAAAAAAATGATAGGTAAAGCTACTTGGAATGGCTGCATACAAAAGGAAACTCATAGTAAACAGATCCCACTGTGCCCAGGCCTCAGTTCATTGTTACTCCATCCCACCCAAGGGGTGCCCAGCCTCTCCCCGTCACAGACACAATACTGCACCCATTACCCTTAACGCCTTCCTATTGCTATAGCCTGGTGCTAAGCACTCTCGGAAGGCTTCTGATGGAGCGTTTTGCCTCCCGAAGCTCCACAGTAGTTACTATGTAGGGAATCCTCCAGAAGTAAAAGTCTGGTGCTGACCTGCTTTAGTTAGCTATCTGGAGAGAGCTGGGCAACAAAACATTTGCTATTAGGGGATAGCTGGATGCTGTCACCAGGAGGAACCAGTGAGCTGGCTCACCTCTCTTGAGGAAACCCACTCTGGGTGGGGTCTATGGGGGCTACACTACCAGCCACACCCAGGCAAAAATATGTAGTTCGTTCGCTTCTGTAGCTTTAGTATCAATGCTGCCACAGTGGACAGTATCCAGACTTGATGTCTGAGCTACTGTGGTGGAGAGTCTACAGCTACTTGGTCTCCAAGAAACACTCTGGCCTCTCTTAGGCCAGCCTCGCTGTGGTAGAGTGCTTTGTGGTGTTGTACAATAGCAGAGAGCATGGAGGCAGTGCTTCAGGCCACCCACAAGCCAGCTTAGCCTAGTGTGGAAGAGTTAGCTACTGATGCTGTCCTCATCCCTCAACATACCACATCCATCAGTAGTCCAGAAGAAAGCCACCCTGATGGCCAGGGGCTGGCTCCTGAGTAAGAGACCCTTGTCACAACTTCCCTGCACACTGGACCTCGGAGCCAGGGGCTCAACCCACACCTGCTCTCCACAGCCTGAAGAGTAGCGGCTCGGAACAATGGGTCACCCTGTGGATCATGAACCCCTTTGGCAAACCTCTATGTTCAAAAATATTTACACTGTGATTCATAACAGTTGCGAAGTTACAGTTATGAAATAGCAAAGAAAGTAGTTTTATGGTTGGGGGTCAGCACAGCATGAGGGACTATATTAAGGGGTCAAGCATTAGGAAGGTTAAGAACCATTGTTCTAGAGGAAGTGGGGCTTGTACTTGTCCCAAACGGCCTTGCTCCCAGTTATAACATCTACTCTAAGGTCACAAGCTTCCTTAGAACCTAGGGATGCTTGGAATCTAGAAACCGCATCTCTTGGCTTATGGAAGACAAGGAACATAAAAATACAAAGCTTAACTCCACAATGTCACTTAACATAACTGGACTTTAAAAATCTCCCACCCCAAACAAAAAACGATGGTTCAATCTGTTAAACTTGGTCTGGGACAAACCCAAGGACTGGTACAAAGAGATGCACCCCACGGCTCGTGTCTCTTCACACCAGTGTCAGAGAGGACAATCAGCAGTGTAGTCTGTGGGACTCTGTGCTTGAGAAGCACGAGATGCCATGTCCTTACCATTCACAGTGAGCCTGGCTTTGTGGGAGTATGTGGAGCCAAAGTGGTTTGTGATGATACACTGGTAGCGGCCCTCGTGCCCAAAGGTGACGTGACGGAGGTGCAGGATAGTGGTATACTCCATCACTTCGCCGTCCTGTGCACGGACGTGGGCAAAGTTCTCCATGTCTGCATTGGCCAGGACCTCATTGTCCTTCTTCCAGGCGAAGGTCATTGGTGAGCTGCTGCTGCTGGCTGCGGAGCATGTGAAACGGATGTCCTTGCCCACCACAGCCATGGTCGTCTCAGGCTGGGTGATGATCTGTGGCTTTGGAAAGTCATCTAGGGAGAGAACCAAGTGTAAGACCCCTGTTCTGTTCGGACACCAGCAAATGTTCAGGCTGACAAGGAACTGGTCACTTGCGAGTCAGTTCCACCAGACACGGCGGTCGCTGTGTATTCACAAATAGTTGTAATCACTGGCACAATCGATATTAAATGTTTTTATCATCTCTAACAGAGAAGGCTGTCCTGTTTAGCTCTCCCTTCTGTCTCCACTGCTCACCAGTGGGACTGGTGACATACATTTCTGACCTCTATGGGGTCCTTTATTCTAGACATTTCATGAGACTTCTTTCACTTGGCAGATCATTGTCAAAATTCACCCATGCTGTGAGACAGACAGACTGACCTAATGTCCCATGGCATAGCTACCTGCCTACTGTCTATGCATGGGTGTCTGGGTTGCTCCAGCTGGGGCTGTTATGAGAAACGCTCTTTGAGCACTTGGTCAGAGCTGCTCCCATCCGCTTGGATGGATCCCAGGGTGGGCCCAGGAGCCGATACTGTGCTGTCTACATAGCGAGGCTTCCTCCACAAAAGGACCTCCCCATCTCATCTGTTCTTGTCATCACCTAGCTTCATGCTGATTTCCTAGAATGTGTATGGTGGCCATTTCTGTTTCTTAGAAACAAGTGGGAGACAGGGAGCAGAGTTTGAACCTCTGATTTCCTACCAAGGATTCTCATGAACCGTGGGTGGGTAGTTCTGAGGGGATTGCTACAATGCCCAGTGTAGCATGGTCACCAACTAGGGATCAGGTTTTAGGGAAACAGAAGACTGCCCTCCACCAGACAGAGGGGGAAGCCAAAGACAACTTAACTTGAGAAAACCTAAACAAGTTAATGAGTGTGGAGTCAATTAGCACTGGCTGTAAAGTGCTGCCTGCTCTAATGTGACTAGGGTGCTGTCTGCACAACCCTGATTCTACCCAGGTAGCCAGTGCACCGAGAGTCAGCAAGCCTGCTTTGGGAATTAATGCAGTGGGAGGTAGAGGATGCTTGTCTTACCTCTAGCAGGCATAACTCACAGGGAAAAGGTCGGACAAGTGGCCCGGGACACCCAGGCTGCTAGATGGGTCATAACTAGCATCGTTCAGGAAGTGATCCTGTAGCTCCGTGAGGCCACAGGGAACCACTGACAGGAGGATCATGCATTCCCACTGCTGCTCAGAGCAACCCAGACAGACCTCAACGAGACCTCAACGGTCTTCTCGGTCTTGGATCCCATCTCCTTAGCTAGGAGGCTATGCTAGTCCTGCCAGAGCTAGCCTGTGGGTGTGTTTCAGCTGTTCCGTGTTCTCTGTGCTCTCTGTAACTAAACTTGGGTCCTGACTACCACTGGTCAAGAAGATGGTTAAATCTATGTTCCAGCAAAGTGGAGGAAAGAGACTCTCCCAGTGCACATTTCAGCGGGTTGGACAAGCAGCAAGAGTGCAAGTCAACATGGAGGAATTATTTTTACTGCAGTGGCTGCTCTCCTGAGACCTGCTCTTCCTGTGTTTAACCTCTCATTCTTAGAGCTGGAAAGAAACACACATTGAAACCCTATCCCCATGCACTCATTCACAGCCAAACCTGGGCCCAGGACCCTTCTGAAAAGATCAGAACTATCGCACTGTAACCAGTTATTTAGATTTGTAGCTAAACCTA
U5_15 94579663 94594713 15051 TTGGCAAAAGTATGATGTTTTAACTTCTAAGCTGGAGCCTCGCCGGTATACCTTCCTCTTGCCTGTGTTTACCTTCACACCAGTGTTACTGAGGAGGGCAGCAGAATGCTCAACTTTGGTTTTCTGAGTTTCCAACCAAAACAGAGAACATTTTCATTTTTCAGCAACTTAGGTTAAACTTCCAAACAGAACTCAAAATGGCCATCCTAGCGGACATCCCTTCTCCAAGAGTCACTTGGGTTAGTGACACACTATCCAGCTGCCTTGATTCGGAAAGGCCTGGAGCCCTGAGTTAATGAGTGACACCAGACATACCCAAGGACAAGAACAAGAAAGGAAACATGGGCTTCTTGTCCTGAACGGCCTGTGGTACGCAGGGACAAAGGGAACCCACGTGTACTTAGAAATCCTGAGCACGGCTTCTTCTCATACCAACAAATGAACTAGCTTTCTGTTTCCTCTCCTGATTTCTAATGAACAGTGAAGGTGTCACACTGGTGAAGGACAGGAGAGGTCACCACCACCCTAGGCTGACAGCACAGTCAACCCCTCCTCCTCTCTTCTCATCACCCACCTGTGGCCTCTTTAAATCACTTTAGGAAATACGTTTCCAAAGACTTGACTAATTTATCTCAAAGCATGGTAACAGGGATGCTGTGATAGCATCCTGTGATATATCCCTCTGTGACAGCAGTACCAGAGGAGGCACTGCACTTTCATTTGATGGGCAGGTAGTATTCAACTGGGAGGTATCTGAGGGCTGTCCTGCTGAGGAGTTACTGTGGTGGCAGAAGGCCATTCACACTACCCATGAGAGAGTGACCGATTCATACACCACACAAGGAGGCAAGTGTCACAGCAATGAGTGCTGTGTGGTGGCAGGCTGGCTGTCTCAGTCAAGGTCAAGGGCCAGAGGAACTTTCCATTGTCAGGTCCACTTCCTCACCTCCTCATCAAAAGGACACTTGTGTGTGGTAGAGCACAAGACAGGAGAAGGCCTAGAGAACGAAGCCAGGGCATTGCTGGGAGCCATGACAGGGGTATATTTAAATGTTAGCCACAGGAACAAGCTGGAAGAAATAAATCTCACCTCAACCTTTGACCAGATATATGTTCAAAGAATCAGGCTTTGTACCACAGTCAGTGTATACACTGGGTTTAGCGCTAAGGTCTTTAGCACCGAGAAAGAGGCCAGGCTAGATAACGCAAAACCATGGGAACCCGGAAAGGGAAGGTTTTCTTAAGTGATGAGTACAGGAGCAAGGAACACAGGGAACGAATGACTGGAGCCCTACAGAAGTGAGAACGCTAGATCCTAGACAACCATGGGACCCCGTAGTTAGAGGCAAAGGCCAGGCCGGTTGGATGGTGGGACCATGGCTGCCTAAGCTCTGTAGATCCCAGTCTCTTCTTCACACAGGCAGATAGGCAGTGTTCTCTGTGGCCCGCCTCCAACCATCCCAGTGCTTCACTGGCTTCCGTTGTGGATTTTCATGATTCCAAGTGTGTTTCTCATCACTGATTGTGGAAATTTACCCAGAAACTAAGGGCAGAGGGTAACCTGTGTGATCTGCTGTGGAAGAAAATGATGGAGCCGAGGAAGCCTCTTTGTCCCATCAGAAGACTGGGCCCAGGACCAGTCATGGTTTGAGAACACACAGCAGTTAAAGGGAGACCAGGCAAGGGACCCAGGCTGAGCGTCCGGAATCAGGCCACAGAGACCCTGCCACTGTCCAAAGAACACCTTCAGAAACCCTCTCTCAATACAAAATAAATCTAAAAGATGAAAACTGCTCTCCTTAAAAAGGTGCCGATCCATTGTTTGGAAGAGAATGGTACAGAACAGTGGACTCTGGCCTGCGGGCCACTGTCTGTCTCTGTTGGTGTGGAGTTAGCAGCACACAGCTGCACCCATTTGTCTGTGTATTATTAATGCTGTCTGCTGTAATAACACATTTAAGTATTCCTGACCCAGCCCCTGTGACCCCAAAAGTCCAAAACGTTTGCTATGTCAGCATTTCAGAAAGAATCTGCCACCCCCATCCAGAGCTAAGTCCCATCCGGCATTTTGCTTTTAAAGACAAGTCCTATCTGACCTCTAAACAATCACAGCTATTACAGAAAATGAGCACAATGCAATTACAAGTCTCCACTCATGCCAGTGAGGCCATGGGTTCCCAGGTACTCACAGCTCTTTAAGGTTCTTCATCTTTGCAAAGGCATCAAACTGGACAGACCTGATTGCATTCTCTCCAAGGTTCCTGAAACAGAACACAGTACTTTGTGCTTAGGAGCTATGGGCAGTTGTCAAATGTGTGGCCAAGTGAGGACACTTGGGGGTTTTTCAGGCCAGCCCTGGTTCACAGATGACCCACAGGTGCTAGCCATACCCCGTGTGCCAGATCCACTGGGAGAGGCTCTCGGTTCTCCTGTTGTTGCAAGCACACAGAATGACTTGGGAGCAAACCAACCTAAGAGCAGCCTTGACGTTAGGTAGAAAACTGGGGAAAAATTTACCCAGAATAAAGGCTTACTTTGATTCGAAGATAAAACTAAGAGCCAGGAACTAGAAGCATCCACTCCCAACTGCAGTATGAACATCTCAGGACTAGCGTTCCTCAATCAGTTCCAAGGTCCCATAGGCAAGCACCCCAGTAGAAAAGCTCCCAGCATGCACTAGGACAGGGAGCTGTTAAAGGGGGAGGGGTATTGCCTGGCTTTGCTAGAATAAAGTATCCTTATGAAAGTGGCGAGAGCTTAGGGACCCTTTAAGGAGTCTGATGCATGGTAATATAGCCCAACAGGTGGGAGGAAGGTGTTTGTTCAAATACCAATCACATTAATTGGGAGCACAGCAGCAGACTATATGCTCTGTGAGTGTTCCTGGCAGAGGCAAAAGAAAGGCCAGAGTTGAAGCTGACTTATAATGAGAAGGAAGCAGATGGTGTTTCCAAACAGCCTGTTTCTTGGTTTACAAAGAAGTGGTTACTCCCCCGGCAGCCACGCTTGGCAGGCAGGGCCAGGCAGGGTCTGGCAGGGTACTTACAGGTGTTCCAGGCTTTCCAGGCCCGAGAAGGCTCTCTTAGCCACAGATTTGATCTTGTTTCCAAACAGAGTCCTGTAGTTTCCAAACATCCAGGCCCAGGGTAGGTAGGTAGAAAGGGACCGAGAAGCAATCGAGAAAGAAAGCACACAATCAGGGCAGTGCTGCCTGACACCCGTCTGCAAGAGGCAGGTGCACTGCAGACCTGTAAGGGGATTACAGGGCTGGGGTGCACAGGCCATCCCCACCCTGAAATGAAATGTCTCTAGCTCTATTACATTTCACGGTGATGACAGGCTGAAATTGCATGTTCCACCCAGTCTCAAGAGAGCCCTTGTAGTGTCAAGCGGAAATCGCCATGGCCAGGCCATGCTGTCTTTCCTGGGACCACCCAAGGGGGTGGGGAGTTTGTTAAGGTAGTGCCCTTGCAGAGAAAACTAGGCTGGTTACTGTTTCAGTGAGAAGCAGCAGGGTCAGAAGGCAATAGAAACTGGGACTAAAACCTGCCATCCACTTCTGTGCACTGCACTGTGGGCATAAAGGGTCCCAACTAACCAGCAGAGAACAGGAAGAGGGCATCCATCAAGATAGCCCCGTAGCTCTTTGCGTCTGCCATGCACTATAGTGGCCAGGATGTAGCTGCCCTGATGATATTTACCCTCCTCTCAGGGTCTGCAGAAGAGGCTCTGCACTGTGGCCCAGGTAGCTGGAAGGCAAAGCTCCTTCCTTTGCTTTTGAGGTGCATCAAAGGTATGCGCTAACTCAACACAAGCATGTGTCTGCTCAGGGCACGACAGTGATGCCTAATGAGCTCTGCCCCTCGAGGGTAATGTCTTCCAGCATTTTCTATCAGGCATGTTACATACATAGGCTGGAGGCCTGGGAAATCAGAACCAGCAAGTCCAGGCAGCAGTGGACAGAGGAAGCTTCTGAACAGAGCTAGCCTGGCTCACCTCTTCCCAAAGAGAGGAGAAGCAGGGCTAAGATCTGGACTAGAGGCTATCTTCCACCTATGTCAGACTGATTCCCTCAAGGGAAGACAAATACTAGCCTGCCTGTGACCATGGCCTCGCCATCACCCACCATGTGGCCTGAGCTTCAGACTAACTGTCAAGGCTCTGAAGGGACACGGGGCAGAAACAGGCTGGCCTGCAGGAGCACGGCCCCGCATCCCAGAACAGCCTCCTACAATGCAAAGAACACAGACAGAGGTGGCGGATCCACCTGCCCCCAAGGGCCCTGCCAGAGCACACCATGAGGCCTCCTAAGTCCTGTTTCATTACAGATTCTGGCCCCAGGGGCCCCTGTGGTCAGTTCAGCCTTAGACAAAACCTACTGTTTCCTGACTTAGGGCAAACAGCCAATGGCCCTTCTATCTCCCCTCTCTCTCACAGGCAATCTGGGTGGACAAGAAAACAATCTCATCCTGAAAAGACTTCCACAACTCGCAATCTGGAATTCTAAAATAAACCAAATGCCAGAAGCCCAGTGGCCATGTTCACTTTGGCTCCTTAGCCACAAAACTAGCAGCAAATAACAGCTCACGGGGCACTGAACCCCAGTGCCTGCGAGTCTGCCAGCTCCTGCACTTACTCAGATCCCACAAGCAGGGTACCATGTGCTCCGGGGCCTAGTAAAAACAAGCTGAGCTGTTTAGTGAAATCTCCTGTAAACCAGATCTAGGAAAAGCTGTGCCTTGTTTCATCCATTAAATATTAGTCACGTTGACCTCTTACAGTGAGGGCAGGCTGTTACTTCTAATGGTGACAACAGCAATAAAACAAATTCTCAAATTCTCAATTACACAGTGCCAATCATACCACTGATAGGCTCAAACAGGCCCTGACCTCCTCTCAGCACACATCGGTGCCTCCCTGGACTGGAAGGGTGCTCCAGGGAAGAGGTGGCTAGCCTGACCTCCCTGCTAAGGACTCAGACAGGCAGTGATCTCAGATGTCACCTCTTACACATCTGGCCAGCCCAGCGTAGGCTCCCAAAAGCCATTTCAGTGCTTGCTAAAGCAAGCACAAAGGCACCATGGGTGTACAGAGTGCGGAACGTGTCATGGTCGGCTTTGTATTCACGGCCTTGGAAGGAGCCATGGCATGGACAAGCCTTCCTCACAATGTGGAGTGCCCATCCTGACAGGAAGCCAGGGTCCCACTTCTGTGTACTCTACCTATCCCCCTTTACGTGTGCCCTACACAGAACACCCTCTTCCCCTCCTGATCAATGTCAGAGGTGGACAGGGGTCGGGCGGGGGCTGCTTCTACACAGGTCGCTCGAGGTTCTCTTGAAGTTCTTCTGTGAGGTCCAGAAATGCCCCCTCCCTCACAAGCTGGCATGGACAGGCCCCCAGCAGCAGAACTGCAGAGCATTCTGCAACTTGGGCAAGAGAACAAGTATACCATATCCAGGGGTACAAATCCGAACCTGCCACCTGCCAGGTCCTGGGCTAGTTCCCTTCACTTGTCTCTGGAGCTCTAAAGGCTGCATAATGGAGCCTGCACACAGACATGTACCTACTACAGCAGTGGACGAATTCTAGGAGGGCAGGACAAAGACTCTCCAAACTGAATTCAAAGTAGCTATGACTAGTGCTCTTGGTGATGGCTGCTTCTACTTGTGATTATAATTAGCAACAAAAAGACTGACAAGAGCCTCAATACTACTGAAAGGTACTTCACACATCTCTAGAAACTAAAGAAGGCAGCAACACCCCTCTGTGCAGAGGACAGAACATATAGGTGCTTTCAGATGGGCTGTAAACAGGACCAAGCCCAGCAGCCCTAAGGACCACCACACACTGACAGTATGAAGACTGTGAGAGTGGCCTGTGAGCCACTGCGGATTCCTCACTGTAGCCCTCAGCCTCTTCTCTGCACACAGCAGAAGGCCTGCTGCTGTCCTCTGTGGTCCCAGGACACAGGAGACTCAGGGGAGCTGCATGAGTGGCACCCCTGCATCCCAGAGCTTGCGGAACCGCACACTCCCAGTCTGAAATACTCACAGCTTGCTGAGGTTGTCAAGCCCCGTAAAGGCACCACTGGTATCCTCGATTGTACCCGAGATCTCGTTATGGTCCAGGTCCCTAAGAAGGAAACAGAAGGCAAGTTCACCCACTATCTTAAGCTCTGCCTTTGTTCTCCACCATGAAGGGAGACCAGCCCCACACCCAGGCTTTCACTAGGAGCCGCAAAGCATCCAGGTGCACCCCAGGGGGCCCAGCAGCATGCATTGCCAGGAGAAGTATGGCCCTGAGAACGTCCTGTTGTTCTTTTTTGTGTACTATCAGCATGACCTTGCTTCTGCTGCTTCCAACAAAGCCAGCCCGCCCACCAACCAATCTGGCTGGCCTCAGGGAGGGAAATAGTAGAGACAGCACAAGAAGAAGCCAGGCTTGCACACACCTCTCTGAAGCAGACCTCTAACCCAAAAGATTCCTAACCATTTCTGTCTACTCTTAGCCACAGTCCTCTCTCGGGTTCAACCAGGACACTGGAAGGCACGTGGAAGGAAGAGGTGGCGGCGAAGGAGCTGGGCCCTGATGTTCCTCCAGGCCGGCCTGGAAGCCTAGGGCCTGCACCCTGCTCCTCGTGAGGCTTATGTAGCACTGGATACTGAGCCAGAGCACACATCTGGGTGCTGAGTCAATCTTGTGACCCACTTGCCAGGACAGGAAAAAGGAGGCCAACTACTCGGCCCCAGGCTGTCTGGATATGGTCAGTGCTTCAGCTTCCTCCCTGAGCTTCCAAGGGCAGGTCACGCTGCCCAGCCACACGCACCTGGCAGCCAGACCCCTACTCTCACATTCACTCTTTCCAATTTTTCACAGAGCCCTGGTCCCTGCACATCCCCTGCACGAGTCCCTGCAGATATGGCCAAGGACAGAAAGGGATGCAGCTCTTGGCTCTGGGAAGACGCTGGAAAGTCATTGCCAGCTGGGAGTGGAGCTGGGACGAAAGTACACAATGCTTGCTCTGACCTTCACTTTCCAGCATGAAGCTAAAAGAGAATGTGCTGCTGGAAGGGACCTCTGCTCTCAACGAGTCCCACCCTGTCATCTTTAGACTGAGTACAGCAGAGACTGCGGTTCTGTGTGCCTGTCTTCCTGCTCTGGGCCTTGCCTGCCAAATTAGTCCTCTCTTTCTGGCCTGCTCAGCTTGAATGTTTCTGGCCTTTCTGTCCGGGCCTCGGAAGGGCTCACAGACTGACCTGGGCTCGGATAGCTTGCTTGGCACTAGCTCCCCATCCCTGACTCAAACCTGAAGCCCACTCTGCCTGGTGCAAGTGCAGAGGCCTCCCTCCAGGCACAACGACAGGCTTGCTCCCCCAGCAGACCAGGCTGCAGAAGAAAGCTGTGGAACTGCTACCACTATCTGTGGAAGACTGTGTGCCCTTCTGGGGGGTTTTAGACTGAAGGCTGCTAGGAGACAGCCTAGCGTTTACAAGTGAAAAAAGTTCTATGAAAAGTCCCAGAAAAGCACCCTCAGCAGCTTCTAGCAGCCTCACCCATCTGACCCTTCAAAGGACATGGTATTCTCACTTTCTCTTTCTTACACCACTCCTGAATGAGGACAAGGACACAGGACCCTCACTTCTATCTTGGATACCAGGTCCACTAAAGAGCTTCAAAGAAAGAGCAGAAAAGTAGCCATGGTACTGAGTTACAGAAAACAATACATAGGATTTAAGAACGGAAGACAGGACTGGGGGTGTGGCTCAGTAGAAGAGAATTTGCCTATTACACATAAAGCTTTGGGTTTGATCCATAGAAACCTTAGGAAAAAATTCTCAAAACGTACATCCAGGCCTGGAGGCTCACATACCTGTAATCCTAGCCCTTGATGCAAGAGGATGGCCACAAGTTCAAGGCCAGCCTCAATATATGAGCTTGAGGCTAACCTGAGCCAGAGAACCCAGTCTTTAAAAGCAAATGAACAAAACCACTACCATACCCTCTCTAAAAGAGAAATAAATGAGAGGTCACAACCAAAAGAATGGAGCAGAGACATGCAGGACTGTGTGAATGTTGCTGCAGATACCCTATGTAGAAATGCTTTTCCAGACCCACCCATCCCATCCGGCCAAGTGTACTGAGAACTATTGATAACAGTGATTTTTCAAGAGTCCTCATCCTGCAATAGGCACCACTGTGGGAAAGGAAGGATTTTTCTGCTCAGTAAAGGAAGGATTTAACTGTTCAGCAGTTATTTTTGGTTCTAGTCCTTGTTCCTGTTGCAGACCAGCTTACAGCCCAATTCTGACTACAAGCCAGCAAGAGGGAATCTCAACAAAGCAAGTGCTTTGCTGTGTGCTCTCCCATCTGGGGACCCCCTTCATGCTGTCACCCTCAAAAGCACAATTCTTACAAGACCCGCAGACTCTTGAGTCCCTTGAAGGCGCCTTCAGCAATGTGACTGATGGCGTTGTGACTGAGGCGCAGGATACTGAGGCTGCTCAACTCCGCTAGACTCTCCTCATCCAGCCGCGTGAGGTTGTTGAAGGACAGAATCCTAAGGAAGAAAGAAGAAGACAAATGTCACCACTGAGCAGCTATGTGGGTGCCCTATTCTCTCTTGTCTTCAGTTGTGTCTCATGCCACAACTGGCCTGACCTCCCTGGAGACAGGAGACTGAAGCATGTCCACAGGACTCCTGCTGTCAGAAGACCATCAGGTCAACAATCACCTAGTTTGATAACTATCATGCAAGCCATGAAACCAGTACCACAGAGCTGAGAACTACCGCTTACATACACTGTAAAAACCTGTCATACAACCCAAATCCCAAGGCGCCAAACCCCTCCACTGCATGTCTTGGTGTAGGAAATGAAGGACCTATCTTGATGGAGACTGACACAACAGAACCTGGAATTCTGTACTGAGCAACTGAGCCACAGCTACACTTGCTGTATCAGCCAGCAGAGGGCACCATGAGCCACTGCCTGGGACAGCCACACCAGGGGAAGACCCTGACACTAAAGGCTCAGGCTGTGACTTGTACACCGCTCAACAGGGATTGGGCGCCAAAGCATACCTTTTGCTAGAACCAAACCCCCTTCCTAGCACTACTGCAGGTGTGCACTACACTGGGTAGGTTTATGTAACATTAGTTATCTATGGTTGGAAATGTTAAGTCTGGACTGGTACAAAAGGAACAAAAATGAATTGGTGGAAGATTAATGCAGTTTTAAAGGTGACAGTGACCATATTCTGTCCCTATTAAGAGAAATATGTCACAGTGTCTATCAGTTGCAAAGACCTAGCAGGAGACCATCGTTACATCCTCATGTGCAATTAAAGAATTTAACTAAAAGGCAGGGTAAGAACACACTGCAGAGCAACCCTATATCTGGCTCTGACATTTTCTAAAATGGAGCAGATCGCTAGGACTAGTCTAATACACTCAAGTGAACCTTCTCTTCCTCTAAATGGCACAGGAGATAGCGTAATGTTGTCCGCCATGCAGAAAGGGAAGGAAGGAACTCAGGGGTCTGCCTGCGAGTTTTCCCTTTCCATGTAGCCCTAACTCAAGGGGCCCACACCGTTCTGGTGTGTTCCATAAGACTGTCCTTACTTGGGAACTAGACTGAACACCTTCAAGGCCTCTCTTTTCCCTACAAGTCCGAGCTCCCAACAAAAGCCTCGGTCAAAGCCATGGGCAGTGGTCAGCAGGAGCACCTCTAGGTGGCAGGAAGCTAAACTCAAAGAATGCACACTAACACAGAATGGAAGAGAAATGAATACAAAGCAAGGGGCAGGACTGTGGCCTTTCACAAAGCACAGGGACTGGCTAAAGTATGAACCCTGGGTAATGACAGACACACTGAGAGCGAGATCAGAATAGAGAAGACCAGAGGACAACAGGCTGCAGGAGTCATCATTGGGTTCCAGGGTCTCTAACTATTCCTGCTGAGATAAACAAATACAAGAGAGGCTGAGTAAGGTGCAACATTTCTACCAATCATATGCTTTGGTGGGTCAATCTTTTCCTATACCCAAGCCTAGCCAAAGAAGATAAAAAGAGAAACCCTGAATTTCTCAAAAGTAAACCTACTGGACTATACAGTGTCTATTAAACTAAAAGAACTCCCAGATGAGGGACAGGGACAAAGGGGCAAAAGATGCTTGATGAGTCCATGGCTCTGGCAGTGTTAGTGTGTTTGCTGTGAGGGCATGGCCAGGCCACCCAGGCCACGCCCTCCCCATCATGGAAGTCTGTCACTACCATTCTCAGAAGCAAGGGCACAACCTAGGAACCCTGTCTAAAGGACCCTGCATCTCCACTTCTGCAGTGGGATGCAAACAGGCAGCAAGGATCCCAGTGTCCTGAGGAACTGTCTCTTGCTGGAGTTCCCAAGGCCAGACCCATCTTTCCACCATCAGCATAGCTTCAAAGTCCTACTCAGATGTGACCTTTTCAGTCAAGAGATGCGTGTGGACTACTGCCACCCATGAGTGTTGTGTTGACGACATCAGGCTTCTGTTTCCTGCACACCCTGTCCTCTATTTCCAGCTCCAAGTCTAAGACCTGGCGGGCAGCGAGTCCACGTGGGTCTTCCTTCCTGCACACACTGCCAGCCTTCCCACCTTTGGGCTGCCTCCTTATTTGGACCCCATGGGGTGAGCTGGGCTCTAGAGGCTTCACTTCCCAAGGTACTTCACTGCCCACTGCCCCAGACTTACAACTCATGCAGCTTTTGGCAGAAGCTCCAGCCATCACGCTGAATTCGAGAGATGGAGTTGTTGCTGAGGTGCAGCTGGTGCAGGGCTGTGAGGCCATAGAGGGAGCCACTGTTCACTTCCACCAGACTGTTGTACTCCAGGTGCCTACAGAGACACACATGCAGGGGATGAGACTGCCAGTCTCCCATTACACAGACAGCAACCAGGAGGCCATCTGTGCCACATTCAGTATTAGAGAGGAAATTTAAGCAAGCAGATCTTGCTTTGGTCCATCTGACTTTCTCCTACCGCTCAAAGCATGAGAACTTAGTGGATTTTTAAAGTCCTGAGAAACATACTAACCCCTCATTTGTACTGATGTACGCAACATTAAAAACCAAGTGGCAGATAACAAATTTTGTTCTGAGAACTCTGATCTGGACCTCAGATTCCTAAATGAACACAGGAAACCGATATTCAGCTAATCAGAAGTGGGAAGTGTGAACAGCAAGAAGCCAAGCAGCAGGCTCCTCCTGTGCATGCCATACAAAGTGGGCATACGTGGGGAGGGAGAGTCACTGGGAGATGCTTCTGCTGATGAGGCTGGGGAACACACTGGTGGCTGTGAACCTAGGCTTCCGACTTTGATTTCAGCTACAAAAATAACAGCATATGTACAGGTTGTAATGTAATTTGCATAGGAAACCAGGCGTAAAAGAGGTGAGCAGCTGAGCCGCTGATGGACACAGGCAAAGGCAGAGGTACAGTTGTGTCCACCTGAAAGGAGACACTGGCAAACATGAAAACCAGAACACCAAAACACCAAAGATATGGATGGTTGAAATGACTGCCTCTTGGAAAACAAGCTGGGGGCAACGGGGGTGGGGGGGGTCACAACACCACCTTCTCTTTACTTCCTGACTATGCAGATTCGTTACTTTTGATTTAAACAATTGTAGAGGTTTAAAATCAGAAGATCAGTAATTGCCCCTCTGCTGTTCTTTTTCATTATTCTGGCAGCAGGCAGCTCTGCTGCTGCACACATCTGGCTGGAAACTCCCTTGATAAAAGCTGCACATCTGCACTCCGTGTCTTGATTAGCTCACAAGGCGGGAATAAATCTCCCAAGATGAACTATACATTTTGGCCCACCTGCACATCAAGAAAGCCTATCGGGCCCAGCGTGAGGAAAGAAGGGACTTCCGATAAGGTGTGGGAGTGGAGAGGATGTGGGGAGGGAATCACTCTGCAGTCTTGGGTTTGTGGAGGAAGTGGGGGTGGAGAGCAGGCCCAGCAGACTAGTGCAATCCATCTCTTCCCACTTCCTTAGCTGACCATGTGTCCATTAAAACCTCCTTCTACCTTGCAAGGAAAACAACCTTGGTTTTGGTTCATTTTGCAGAAAAAGGCAGCATCCAGGTGGCCACCATCCCCGTGCCCAGGAGGGAGGCCGCACTCACAGCACGTGCATCTTAGACAGCCCCCAGAAGGCCCCGTCCGTCAGCCTGCTGATGTTGTTCCTCTGAAGCCTCAGCACCTCTAAGCTGTCGAGCCCCTGGAACGTGAGGCCTTCAATCAGCCGAATCCGATTCCGATTCAGGTCTCTATGGAGAGAGAGGAAGCCATCGGGTCAGAGCATCCCTTGTGCACATCTAGGCTGCACCGTTCCGAGTCGGTGGTGAAACCATGGAGGAGGGGACACCTCAGCTGGCACACTGGCACTGTCAACAGCAAGGGTGACAGCCTAGGAGAGGGACAGTGAATGCTGCATGGCTAGCTCTGTACTGCCCCAGTACTGTGGGGACATAAGCACCCCACAGTTCTTCCCTCAGGACAGCCACCATTCAGGAGTCTAGAGCAGGCCCTGGGCATGACTCAGAGGTACATTCATTCCTTCGCTGAGGTGTCTCTGAGCTCAGCAACAGAAATCCATACCAGATGCTTCAACCCAAGAAAATCCTAACCATTGGGTACCAAATATCAGCAAAACTTCCACTCGGGGCATCTGACAGACCTCTGTGCAATGGGAAGAAGTGACAGCTTGTGGAGAAGTGGGGGGTGGAGCAGATACACACTTGGCACCTCGTCCTAGCAGAACAGCCTTAGTTGACCAATAGCTATCTGGAATCTGGGTCAGCTGGATCCCATTAGCAACTCTGGGGAAGGTGGGAAGACACTGCACTAATTAGAAAGCCCTTGGTTTTTCCCCAAATATTTCTGCAGTGTCTCATGACCCTGCTTCACACACAGCCTCTTCAGCTTCTTAGACTGGAAAGAGCAGAGTCAAGCTCCTGCACTCAGGAGAAATGAGGACAGGGCACTCTCTGCCCTGTGCCAGCCTGGTCTGCAACTGTTTCATCCTGATCGAACCAAATTGTGAATTCTAGCTTATTTCCCTGAAATATACTCTTCTGCTAAAACGAAGACACAGGGAAACAAAGAGTTGAAGAACCTTTTACTGACTGGGGAGTTTTGGTTAATATATGGTTTCTAGCACCCTGTGCCATTTTAGGCTCCATGAAAAGAGACATAAATAAATCCTTTTATACAAAACCAAACTGGCTAACCTTCTAAAATTTAGGAAATGAAGAGGCAGCTGCCTCTGGTCAGGTTAACTTCCCCAGAAGGACCAGATACCTTCCCTTCCAAGCTACAGACGGCCTCAGCACCTTAAACATTGCTAATACTCAAGATGAGAGCTCAACGAAGTGAGGATGGTAGTGGTGAGTGCACTTGGGAGGCTGAGGCAGAAGGATCAAGGGGGGGTGGGGATGGGGGGGGTGGGGCCTGCACTTCAGAAGTATAGCATCAGGGAGGCTAATCATCCAAGCACGAGGGTCTTTTCCTTGGCCATCTGAGGCAGCCTGCCAGCACCAGACCCAGCTCCTAATTTGCTTTTATTAGGTGTTGCGGTAGGGTCATAAATGATAGTTTATGCAGAGCTTTACCAGGGGGGTGAGGAAGGGGTGGCGATTGGTACAGGGTCCTTGGGGAAATCTGGCCCCATAAAGTTTGGCTAACCTTAATTAAAGTGCAGGTTTCTGTACTCACAGTTGTGTCAGCCTGGGTAGCTTGAACGCTTTCACAGGAAGCTGGGTGATCCTGTTTTTGCTCAGACGGAGAGTCAGCAGTGACCGCGACAGACCATCAAATGCTCCAGACTCCAGGATGCTGATGCGGTTGCTCGCCAAGTTGCTGGAATGATTCAGGAGAGAAAATGTAGTGGCAGTGGGAGGCCTTCCTCACTCCTTGTGCCTCCAGATCCAGCTGGGTCCGCTAGGAAAAGTGCTAAGGCAGACCCAGAGGGGCAGATCTCCACTGAGTTAGCTGTTCATCATCTCAAGGCTTCCCAGCCTGCCCTGACTTGAAGACAGGGAACCTGGGAATGCCGGTAGCAGGAATGTCTCATGAAGAGAAGACACTGGCACAGGCCTTACTGCAGCACAAAGCAATGTGCTCGTGCCGGTGGGCATGACTAACCTTTCCCCACACAGCTGCACAGAACAATGCCTGCCTCGGGAGAACTTGCAGATTCCTGCCTTACCGCCCACTAATTCAGGCTGGCCAGGAAAGCCCTAATAGCAAAAAAGTCAATTGGCAGACAAGGTCAATGGGTTTTATACTTTAAAGAAACATCCTTTATTTAATCCTGAAGAGGGCTAACTGTATGACTTATGAAGATGCACAAACCGTTCGTTTAAATAATTCTAACAACTTCAAGAAGCACTTAGAGACCTCTGTGAGTCCTTTAGAAAACAAGAGATACATCTTCATGGGGCTGCACACTACGCATGCCAGGGGAGCCTCCTGTGACCACACGGGAAGGGACTCTTTCTCAAAGTTACATGGCAGCATACAGCATAGATGTTCTCTCAGGTAGTAAAAAAGACAAGACATGGAAGGACCACCCCACACCTCTTCCTGCCTTCCCCAGACAAAAGCTTAAGTGCAAATGAGACAGACTAGAGAGAAGCTTCAACCACAGTGGGTTGTGTGCCAAGAGGGAATGAGGTACTTCTATTCCCGCCATCAGGCAGCAGCCGAGGGCAGGGCACATGAGGACTCTGCAAACGGGGCTGGACTGTTTGTTCTTAACACTCCAATTAAAGAGTCATCAGTGTGATGGAGACACAGCAGCCAACAGCTGCCAAGGAGAAAGTGCCCTCTGCATCTCTGCAGAGAGAGGACAATACAATCCAGCGTCGTGGTTGGCGGCTCTCTACACAAGAAGTACCAGGTAGTAGCTGGGCCTTTAGAAAGCCCCCTCCCAGGGCTTCATAGAAGCCAGAGCCTCTTGTCTCCAATTCTTGTACCTTGATGAACTTTCAGAAAGTATCATTTC
D3_15 94563756 94578804 15049 GTTATGTGTACTCGGCGCAGTTATGTGTAGACGTGTAGGTTACTGTCGAGTCTGGACATGTCACTGACTGCTGGGTCTTACACACAGGTGGCTTTGCAGCTGCAGTGACTACACCTCTGGACGTGGCTAAGACAAGGATCATGCTGGCAAAGGTGGGTATCAGATAATGCAGGTTCTATGCCGTGTCTGTTAGCGGAGGGTATGGGGGTGGAAGCATCGGAGAACCTGCCGGACCATTAATAACCCTGACTTTGGAAGAGCGGCTCTGTCATCGCCACCGCATGTTGGCAGCTGTCACTGTGATGGATCTGTGTGTAGCACGCTTCCATTTCTCCAGCACTCTCCCAGCTGTGCCGTGGGAGCGGCACATCTGAGGGCCCCTGCTTGCTCTTGCTGTTTTCAGATCTAAGCCTTGAGAGAGGCTGACAGGCTTCATGTTCTGAGGCAGCTGATCTGCAGAGTCAGAACTCAGGCCATGGGTCGCGGTGACCACTGAAGACAGTTGTCCATGTTGTTAAAAGGAAAACCAAACAACAAAACAAGCTCTGAGCTGAGCTTTAAGGAATTCCAGTAACATCCCTGGACCGAGTATACTCTCAGAGTACAGAGGACCAACCCTGATGACGGGGTCATTTTAAAGATAGACCCATGCAAACGTAGAAGTGCCACCCCCATCGGGCTTCCTGTTGAATAGTTACCATTAGTTTCTAGGTGAGCTATGAGAAGCTGCCCCCCCCCCGCCCCCATCCCCAAGTATTTGTCTGTATGTCTAAATGTAGGCAAGATTTCCAAGCTAACCCCAGGGCAAGCCTTGGATGAAGGTGAGGGGAGTCTGCTCAGAGAACCAGAAGGTAACGGCCCTCTCTCCCTTCCTTATCTTCCCTAGGCGGGTTCCAGCACTGCTGTGGGGAACGTGCTCTCTGCCATGCACGGGGTGTGGCGCTCACAGGGACTAGCCGGGTAAGGACAAAGCGAGCCCTCGGCTGCCTTGCCTCTTCTTCATTGGCTCTTTCTCAGGTCCCTATGCTTGCTGTGGATGAACACTTCGCCTTTGCCTTTTCTTAGGTTGCATATGTAAGATGGCACACTCGGCGACATACCATTCTAGCCACATGGTTCTCGGTCTTGTCCTTGACACTGGATGACATGCAAATGTGTGTCGTATTTTGGCTGCAGCATTGGTACAAATAAGCTCCCACCTACGCAGTGCAGACTGCCAGTGAATTAGAAGAAAGCATTTGGGGCTTGAGTAGGAACCACTGGCAGCCGTGCCTTATGATGGGCCTGCGCTCTGCACCATGGGCGTTGTTAGTGGGTAATTTTGTCACTTAAAACATCATGTGGTGGCGCACGCCTTTAATCCCAGCACTCGGGAGGCAGAGGCAGGCGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAAAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCATGTCTCAAAAACCAAAAAAAAAAAAAAAAAAAAACATCATGTGCTTACACAAATGTAGATGGTGTCACCTACAGACCTGTGGAATCGGGCTCCTGGCTGCAAGTGCAGCAGGTGATACCCAGAAGATCATGGACAGTTGGAAGAGCAGTAGATATTAGTGTGTCTGGAGATACAGAAATGGAGAGATCGTGGGTTTCAGATGCACCATCATCTTATATGCAGTCTGTTTTTCTCTAAAGCGTTACCCAGCTCATCACTGCGCTGTCTGCTCCACAGTGCTCAGCCTTGGGTGGCCATTACTGTTTGGTTGCTAAGTACCTCACATTTTTTTGCATGTGGTATGCAGATGGGTGTGTGTGCCCACTAGTGTAGCCATAGAGGATAGAGGATAGAGTTTTCAGTTGGATGTCTTCCTCAGTCACACTTGAAACAGTCTCTTACTGAACCCGGAGCTCACCATTTTGACTATAGTAGGACCCGAGGACCGACCTGTTCCCTTCCCCGTCGCTGGGTTGCAAGTGAGGACCACTGCACCTGGCTTTCTGTGGTGCTGAGGATCTGAGCTTGGGTTAAGCTTGCCCTGCAAGCATGCTAATGAAGCATCTCTCCAGCCCCACATGCCTCCAAATGTCTTGCTTTAAGTCCTAAAAAGCCGTCCCTGCACACTGGTTCACCATACGGTGGTGCTGGAGCTGTGTCTATGCTGAGTTGTTAGAAAAGCGGAAGGGTTTTCTCTACGGAACGGTCTGGACATGCTGTGTGGACGTGCCTCCACCTGGAGCTGGGATGGCTGGCATTGGGAGCAGCAGCACTGTGCCCTCCTGGCCTCTTTACCTGGCATAGCCGCCCCGCTCACCCCCATGCCAGGGTACATCACTGATCACTATTTTTGTGTAACTTTGGCATTTTAAATTTCAGCTGATGGTCCGGGAAACATGGTGATGCTTTTGCCAGAGAGCAAACTCCATGTCTGTTTGAGTTTTCCAGCTGGATGCTTCAAAGTGGTGGCTGGGTGCTTTCACTCAATGTCTGCTCTGATGGTCGGAGGTGCAGATTGGATCTAACAGACAGGACTTACTGACTCTAGATGTGTCAGACATAGGAAAGGCATGGTGCTAGCTTCCGGAGTGAGTCTGCTGTTCATGGCTGACCCCGCGTGAGGAATAAGAACATATTAGTTGTTAATTTGGGTACGAATTTGACACTGAACAAAGATGGAATGAGGAGGGACATGGGTTGTGTGCCCCATATGCATTATTTGAGAAGCCTCTTAGGAAAGCAGTGGCTGCGCTCACGAGGCAGCAGCTGGTGACAGTGACTTTTGACATCCTGAAGGCCAGCTGCCAGATTGTGTGGTGACTTAGCTGGGCCCCTGACTATACTGTTGTGGGGCTGCAGCCCATTTGCCAGTGTCGAGAAAGTGGTGACAAGAAAGGACACACTGGATGAGGCAGTGCCCCGCTGTGGCCACCGCATGCTGCTGGGTAGATGATGCAAGAGCGGCCTTCCCTGTCCAGGTCATGGCACACACTTGACTATAACTAAGCAGTGCCAGAGGAAAGACAGCAAAACAGGCCAAGGGTGTGTGTTTGTTCTGACCCAGCCTTGGTGCTGAAAGGTAGCTTGGATTTTTGGCTCGTCTTCTGAGTCTCCAGTCTTGGACTCTGGTCACCTTGTCCAGGGCAGCACTGAACAGCATGTTCCCAGCAGCAGTGGCCACCCCTGAGCATACAGCAACTCCAGCCCCTCTAGTGAGCAAGTGATTGGACCAAGAGACAAATGAAAACTACTGGTCCCTTTCTGGGCAGGTGGCTCAGCCTACTTCCTCTGTGGCAGTGCCAGATAGAGCCACCACTGTCTGTGCCCCCTGCCCTGCACACACACTAAGCCTATCAAGTCTACATAACTCCCAGCAGCCCCTCCCACCAAGGAACCTGATGCTATCTCAGAGGAGATGGTAGGGAGCCACGCTGGAGGGCAGACTGGGGTTAGCCCAGAAGCTGCAGGGCAGAGGGGAGGTCCACTTGTCCTGGATTGCCCCTGGCTGATCCCCTGAACGTTTTCCCTTGAATATGCCCTTTATGTACTCGCTGCTGCTGGGAGCTCCTGCTTATCCTGTCACCTGTTGTCCCTGGAACACAACCTGCCCTACTCACAAGTCTGCCTGTAAGCAGAGGTGGAACCCCTCCCCCCTACAAAACCTCCACTTTAAGGAGGCTGCAGTCTGTTGGTCATCTGTGACGCTGTAACTGCTCCCATCTGTCTCTGGCCTCTGCTGAGCTGGGTAGTGGCAAAGCTGAGGGAGACTGACCTCCAAGCCCAGCTCAGTGTCTCCAGGCCTGCCTTCTATATGGTAGGTGCCTTGTTTGCCACTTCCTGGGCCAGGCTAGCTGACCCAAGAGCCTCCGGGACTTCCTGTCACTACAGGAGCACTGGGGTTACTGCAGAGCTGCCACGCGCAGCCTCACGAGGTTTCTAGACATTTGAACTCAGGTCTTGCTCGCTTTACCCACTAAGCTATTCTCTCTAGCTCCCTAAGTAGCTTAGCAAGAGGGGTCCCACTATGTAAAGTCCTTGCTTTCTTCTGTGCTGCCTGCTAGAGGTGGGAGGGGCAGCGGATCTCTTCCACTGGCTGTGTAGGGCATGGGCTGTGTATCCAGCAGAGATTCCTGTCAGCTTTCTTCATTAGCTTCCACTTAGCTTAGCACAAAGGCTTTCCCACATCTTTAAAAGGCATGAGCATTGTTATAATAAAACACTTGCCCTATACCCAAAGCCTCTCCACGAGTGTGCACACATAGACATCAAACTGGTTCTTTCCTTGTCCAGGGATCGAACTTGGGTTATCCATCAGTCTTGACAGCAAGTGCCTTTTCCCACCGAGGCAGCCCAAGTTCTGGCTTCTAAGTTTGTCTTTCTGCATATAGAAGCACTTTTCTGGGTAACAGGGTTTCAGTAGAAATAAGATCAGGCTTTCTGTCTGTCACTCTCTCACTCCCACTGCCTCTGTAGAAAGCAGTAATTTACAGCCTAGGACTTGCCCTGTGTTCATCAGCCCAGCGACCATGGGGATGGTAACCTTTTAGGGTTGGGGCTTCTGTCTTGTTCTCTCCAGCTGTGCGCCACTCTGTTTTCACAATGCTGTCTCATCTGGCCAGGTAAGGTCACTAGTAGATTACTTCAGTAATGTCACGATGGATATTTGAAATTTCCTGGGCCTCTGGAGAATGGCTTCCTGACACCACTGTGGTGTTCTGACTGGATTGGGGATGGGACACCTGAGAATCTCGAACTGACACTGTGAGGCGCTCCACCTTTACCACAGTCATGTGACTCTGGCGTCCTTATTTCGATTGAACAAGAAAAAGGGAGTCCACAAAGATTCATCATCCCCTTCTTGTAGAATCGCATTTGTGGGACTCCAATGACAAATATAACCGAGCCCAGGGTAGGAGAGCAGAACTGTTTCAGAATTTGCTTTGTCTCCCTGACTGAGACCTAGAGGCCCCTCAGATGTCCCAGGGCCACACACCCTTACCAGCCTCACCTCAGATGTATCCTTGACTCCCTTCTTCGAGCACACTGCTGGGAGAGTGGTTACTGTGTTAATGTGAGTGTTCCCAGCTAGTGTGGCCGTGCTAGGCTAAGCTCCAGTTTCTCATGCATATTGGGGAATATTACTTAGTAGCCTTCTAAAAGGAAGGAAAGACACTGTAAATTTCTGTGGGATTTCACAATGGATGTGATGGAATGAGCGAACTGCGGGCAGTCAGGAACATGACCATTTCCTGTCCCTAGGTTATTCGCAGGTGTCCTCCCGAGGATGGCAGCAATCAGCATGGGCGGCTTCATCTTTCTGGGCGCCTATGACCAGGCGCGAAGCTTGCTGTTAGAGGTGGGCAGGAAGAGCCCATGAAGCAGACACTACATGTCCTTGCAGTCCTTCCTGTGCCTGGGGCTCCAGTGTGGCTCCCTGAAGATGGCTGCAGAGAGCAGCTTAATGAAGGCCAAAGCACAGGCTGCCCCAGGAAACTTTTCTTGGTGAAACTGGGGCCACCGTCTCAGTCCTCTCAATAAATACTCCCGGTAAGGCCAAGGCCAGGCCCTTCAGAATGCTTTTTATTAGCATCCTGTGCTTTCTGCTGTCTGTTGGAGTCACCAGGAAAGCAAACTGGCTACAACTGCAGTGAATGACCAGACTGGGAAAAGGAAGGGGGCAAGAACCGTGCGTGTGGCTGTTTCTCCCCTGGGCGGGTGCCTATTGTGTAAGATTATAGCTTTGTTTAAAAAGCATGAGCTACAGGTGCATAGCATGCATTCTTTCTGGTGAGGATGCTGTTTTTAATTACCTTGTATTTCTCCTATAAAAACACATGATTATATTACTTTACAGCAAAGTGCCCCAAAGTCCCTGGAGTGTGTGACAGACAGCAGACAGCTGCAGCGCCAGTGAGTGGGTGGGCCCAAGTGACTTCAGTTAGGAACATGTTGAGGGAAGCAAAGCCCATGCCCACCACTGTCCGTCCCTGGAGGCCAGCTGGAGCAGCTCCTTTGTCCTCATGGTATATGCCAGCAGGAGGTGGGAGGGTCAGCATACTTGGGGAGCATAAGGCTTGACTAACCAACTCCATGTGGAAAAAAAAAAGCTATCTGAGGAATGCAGTGCCACTGTCTTTCTGGGGCAACAGTGTGTAGTCTATGCTGCTTCGTCTAAGTATTCTCCTTTTGGAGAAACATTAATAGCAGAATAAAAGAGCAGTGACCGCCGCACACACTTAGTATTTATAAATGAACCTTTATTAAAGACACTTTATGCCATTTGTTAGACACTTCAATATTTTACATGTTTTCAATGTACACTGTACCAAAATTTCTATAAATAAATAACTCTGTACATAAAAAGTAATACTTCCTCTTTCACATTGCCTCTCAGAAGCAGCAAATTCACATATTTTGTGGAAGTAACATTAACCATCAACTATGGAGACTAGCCTTCTCAGCGTGCTTGCTCTGGCACAGTGATGGCCTATGACACTACACGGTGACACAGGCCATCACTGTGCCAACACTTCCCCTCAACTCCTGGGGTTTTAAGGACTGAGTTTGTGTTTCCATGTAGTCTTTACTGCATTATACATTGGCACTCACAAGATGGCTAGCAACAGGGCCCCAAAGTGCAAATACACCCAGGTCTAGGACTCAAGTCTTGTACAGTCCAAGCCCAGTCTCACCGGTAAGGAACAGCGTGGACAGGCCTGCTCAGCAGAACTTAGCGGGCCCTGGAGGCAGAGCTAACCCTCACTATTGGAAAATCCACAGGTACCAACACTGGCAGCCTCCGCCTCACTAAGCTTCAAAGAACCACTGAAGGAGACAAGACATTTGCTTTTACCAAGTGAGTTACAAAGAAAGACGAAAGGCAGTGCTTAATTGTTCTGAGCCATTGCATTTGGTGGATTAACAGCTCTCAATCTCGTCCTCAACTACAGACCCGTGCACCCTGCTCTACAGTGAGGCTGCCAACACCACGCCTGCATAGGTCTGGCCAGTGCACTCGAATCTGACCACTAAGTGCCACACAGCCAAGATGCCCTCCTTTCCAACCGCCAGCAACAGCTGATGTGTTTACCTGAATTCCAGCTGTGCATTAAGGCACCAGAACGATTCCTGACCCTCTCCAAAATTAGACAGCAACCTAATGTGAAAATATCACCAAAAGCGGGACCCATGCGCTAAGGATTAAAATAGTCTCTGTAAAAGATATATAATATATATGAAATCTCTGAAAACTCTTATGTACAGTGGTATCAAATACTTTTTCCTGCCTTTTGTACACAAATAGTCTCTCACGTTTCTGAGCTCCAGATGCCACTCCTCTAGCCGACTGACTGACATTCCACACGGAAGTCGGACTGTCCGGAGTGACGTCTGGACACAAGCTTTCCACGGCCTCTCCTACCTCTTTCCTGTAGCGACTGCTTTAAAAGAGCTGAGGTAGATGAAGCCTAGCTTCTCGGTGCCAATAGCAGTGGTCCCCTCCGTTTCCCAGTGATCTGCCCTTTCAGTGGCACAGATTCAGGGCTGGAGTCACAGGCCTTGGGGAGGTGGCCATTGGAAACAAGCAAGTGCTGGGCTTCAGTAGATATGGCGTCTTCCATGAGCTCTGGGCTGCCTGAAGCTAACGTAGGAGAAGGCTTTAGGTCTATGCAGTCTGCTTCATGTAACTTTGCTAAAGTCCAAGAGGAATCTCCTGTTTAAAAAAAAAAAAAAAAAAAGAGGCAGCTCAGCCTATGCACCGTAACCAAAGGGCTCCCAGCAGCCACCGAGGTTCCTCTAACACAATACACACCGTTCCCATCTGCAGACGCCGCCTTGTTCTTCAAGGATGGCAGTATTCTGTCATGGTTGCTTGGATAGAGGGACCCCCCAGAGAGGGTATGAGACCCATCCGCAGTCCCACTGTAAGGATGGTGTGGAGAATATTCCCGGTCATGCTGCCTGAGCTCTTGGCTGCTCGCTGTGCCTGGCTGCCCACTGTCTCTGGGCACAGGCTGGGGATGGTAGGCTGTGTCAGTACTGCAGTCACTACATACAGCAGAGCCACTGTGTGCTGAGGGAAGAAGAGAACCAGAGGTCAACTGAGTCTCCATTCCCTCTCAGAGGCACTATTGGAAGATGAGTCCAGCTTACCACTGCCTTCATAACCACCCTGTCTCTCCCCTCCCCACCCCCTGGAATGTGTATGTGGAGAGGAGCTAGACCAACCATGTCTTAGTCTTGTGTGCCTAAGTATACGTGTAAAATTAATTTCGAAGGCACACTCTAATCACAGGAAAATGAGGGTGGGGAGAGGAAGAGGAACGGTTTGCATTAGGCATCATACAGTAAGGAATCTTAATCAGTAGGCCTTAAAGAGTCCCGCCAGCAGGGCTGCGGAGAGGGAGGGCTCAGTAGGGAAAGCGCTTGCTGAGCATAAGGACCCGAGTTCAGGTCCCCAGTACTCCTGGAAATGCCAGGCAGGTGTGGTGGCCCAGCTAACGCAGAGGCAGGAAACCCCGGAGCAGGCTAGCGGGCTAGAAAATTGGATCAGTGAACCCTGGGTTTGAGAGAGAATCCCTGTTCATTACACAGGACAAAGAGTGACTGAGGACATGAGCTGAGTGACATGAGGAAGGCGCACTCTAAGGGACGGGCACGGTAGCCCAGCCACAGCATCTCAGGAGGCTGAGGACAGCCTGATCCACGAAGTGAAACCTTGTCGGGACAACAGTCCTGGCGCAAGGGCAGGCCTTGTCTTGTAAGTTCCTTATGTTAAGAAAACTCAGCCATGTTAAGAAAACTCAGCCTTCAGCTCACCACATCATAGACTGACTTACCTAAGCGACACAGGACTCTAGAATCACACAAAATCCTGTTTGTATTCTAAACATAACTCAGAGACAGCGTGCGGCCAGTGATCTGCCGCTACTCTAGTTTACTCAGTCAAGCCAGCTTCAGGGCCAAAAGCAACCGCGTCCCCTGACTTAAGTGTCTCCTACCTGTTGTATGTGGGGCAGCTGTCCTGTCGGCTTTCTCCGTCACCTTCCAGGGCTCTCTAGTGTATCCAACACACAGCTTGGGCTGCCTGCATGTAGTGCTATGAATGTCGACCTCTGGGAAGAGGCTCGGGTCTCTCAGACACACACCTGAAACAGAGCCCTTACCACTTAGAAGCTGCTTACATCACGCAGCCTGATGGCCACCAGACCACTGCTTTTCCCAGCACCTTGGCATCCACCCAGGGATTGGTTCCTATGCTCCTCTGAGATGCCCAAATCCAAGGATGCCAAGTTCCTTTTCTGTGAAATGCTGTTTGCACATAAACTGTACACCTTCTCTGACAGACCTTAAGTCATCTTCACTCATAGTACCTAGTAACGACGTAAAATGTCCATATAGATTCAGTTTTTCTTTGCTAAATATTTTCAGTCTGTGGTTGGTTGACTTATACTTAGCCCATGTAAAGTGCTACAGTACTGTAAAAGCTATGGGCTGATTTGGGGGCCTGGAATGTCCTTTGCATATATTCTTTCTGGCAATCCTATCATATAATCCTTCTGACCAGAAGACAGAGTGCTAAGCCCAGTGCAGGGACTTTCCGGAGGATCTAACGTTAAAAGTATAGAACTTGCACACACCAGATCCAAAGCAAACTATCTTATCAATTAAAGGCCTGGTTCACCAAATGTGACCCAGTGCCAGACTTCATCCAGGACGAGGGCAGCTGGCTCACTGTTCCGAACTTACCATTGCTTTCAATGTGCCCATTGGCCTGATGACCACCCTCAGTCCTGACCACAGTTTCCTGCCGGTCAGAAAGGGTTCCCTGAGAGGAGAGGTAGCTTGGAACATCTGGAGGCACAATGGTTTCATCTGCAAGGAGCCAAGACAATAAAATAACAGGGCTGCCACAACAATAAATACAGATAACTACGCACTATCACAAGGTCACACGACAGTGGCTCACACACAGAAAGCTGTGCAGAGGCTCGGCAGCCGCTCATTAACCTCCTTTACACCCTGGTGTAAACATCACGGCAGTCAGACGCCTGGCTCCATGAGGAACAAGGAAAGGAAGGCCTAACCAAGACTGAGAGCCTAGGAACAATCCGGTTCATAACAGGCGTGGCCCTAGGGCCTCTGAGCTGCCAAAGAGACCAGAAACTGCAGAGACCAGCGAGTCCTTGCATGTGAGAGTATTCCCATTTTCTGTTCTGTCCTTCAGAGCTAGCTTGCTGTTGGGGGGGGGGGAGGACATGGACCAAAGTCCCAACTCTACAGGCAGAGTCCATATTCCTAAATGTTCTAGAGACCTTTCAGGTTCTAGGCAAGCCCCCAGGCCTGCATCGTTTACCTCGGACTGCGGCAGTGTCACCCCATCTGCCCCCAGCCCCCCAAGTCCGCTGTGCTGCTGACCTGTGTTAGTGACGCTGTACTCCTCGCTCTTCTTCCTGGTCTGGTAGATGATGCACACCCACACCAGCGAGGTCAGGACAATACTGCACACCACAGCAATGGTGAAGATGCCTACGGTGGTCCCATCCTTCCGGCAGCCAGGGGTAGGTAAAATGCTCAGCTGGCTATGTGCTCGCTCAGTGCCCAGGGGATTAGACATCTCACAGGTATACCGCCCTGCATCGTCTATCATCACATTCTGAACAACCAGCAGCTGGTTGCCTGGAGTGAAATGGTGGCGCTCTGTGAGGCTCAATGGGCGACCTCCCTTAAGCCAGGTGATGCGTGGTGTGGGGCTCCCGGTTGCTTTGCACTGGAAGGCCACTGTTTCTCCCACAGTTACCACACGGTCTTCCAGAGGCACTGCCAAGGATGGAGTTTCTGCAGGAAGGCAGTGGAAATTGCACATTTATTCTATGGGTCTCGCTTGCTGGAGGTATACATGTTTTCCAGACAGAAGACAATCCCATGTTGTAGTGAAATGCTATCTGAGATCTTTTATTGGAGCACCAAGCTTTCCAGAAAGCCTAATGTAATTAAATCACTGCCATTCTAGGAACAGCTCAACAGAGCAAAGAACTAAAGCCCTACCCTATCCCAAACTGTCCTGTTATAGACCTTTGTCACTACTCCTAAGATCATAGCCCACCTGTGTGAGTGCACACACACACACACACAGAATTCTCACGCAGACTAACATATAGCTCATTGTCTTTTATGAGCTGAAACTACTCGCTTAAAAGCAGCCCCAAAATTCAAATTAACTAGACAGAGTCTACCACAGGGACTCCAGAAAGCAGGTTCTCTAATACTTGAGTTGAATCCCCACCCGACCCTGCCACACGTGCGCGAGAGCTGTCGTAGCGAACCTAAGACTGTGAGGGTAGCGTTGGCTGAAACCGAGCCTGCCGAGTTCTGGGCAGTGCAGCTGTAGACCCCCATGTCGTCTATTTTCACATCAGTGATGAAGAACACATCATCGTCTGGCATAACATGCATGCGTCGCTCACGAGCTGCCGGGAAATCGGTGCCTCCATCCTTCTGCCAGGCAATCTGAGGGTTAGGGTGGCCCGTGGCAGCACACTCGAGGCGGGCTGTGGTGCCAGTCCGGATGGCAATGTCATGGGGTATTTTAGTGAATGATGGCAACACTGGAAAAAAATGATAGGTAAAGCTACTTGGAATGGCTGCATACAAAAGGAAACTCATAGTAAACAGATCCCACTGTGCCCAGGCCTCAGTTCATTGTTACTCCATCCCACCCAAGGGGTGCCCAGCCTCTCCCCGTCACAGACACAATACTGCACCCATTACCCTTAACGCCTTCCTATTGCTATAGCCTGGTGCTAAGCACTCTCGGAAGGCTTCTGATGGAGCGTTTTGCCTCCCGAAGCTCCACAGTAGTTACTATGTAGGGAATCCTCCAGAAGTAAAAGTCTGGTGCTGACCTGCTTTAGTTAGCTATCTGGAGAGAGCTGGGCAACAAAACATTTGCTATTAGGGGATAGCTGGATGCTGTCACCAGGAGGAACCAGTGAGCTGGCTCACCTCTCTTGAGGAAACCCACTCTGGGTGGGGTCTATGGGGGCTACACTACCAGCCACACCCAGGCAAAAATATGTAGTTCGTTCGCTTCTGTAGCTTTAGTATCAATGCTGCCACAGTGGACAGTATCCAGACTTGATGTCTGAGCTACTGTGGTGGAGAGTCTACAGCTACTTGGTCTCCAAGAAACACTCTGGCCTCTCTTAGGCCAGCCTCGCTGTGGTAGAGTGCTTTGTGGTGTTGTACAATAGCAGAGAGCATGGAGGCAGTGCTTCAGGCCACCCACAAGCCAGCTTAGCCTAGTGTGGAAGAGTTAGCTACTGATGCTGTCCTCATCCCTCAACATACCACATCCATCAGTAGTCCAGAAGAAAGCCACCCTGATGGCCAGGGGCTGGCTCCTGAGTAAGAGACCCTTGTCACAACTTCCCTGCACACTGGACCTCGGAGCCAGGGGCTCAACCCACACCTGCTCTCCACAGCCTGAAGAGTAGCGGCTCGGAACAATGGGTCACCCTGTGGATCATGAACCCCTTTGGCAAACCTCTATGTTCAAAAATATTTACACTGTGATTCATAACAGTTGCGAAGTTACAGTTATGAAATAGCAAAGAAAGTAGTTTTATGGTTGGGGGTCAGCACAGCATGAGGGACTATATTAAGGGGTCAAGCATTAGGAAGGTTAAGAACCATTGTTCTAGAGGAAGTGGGGCTTGTACTTGTCCCAAACGGCCTTGCTCCCAGTTATAACATCTACTCTAAGGTCACAAGCTTCCTTAGAACCTAGGGATGCTTGGAATCTAGAAACCGCATCTCTTGGCTTATGGAAGACAAGGAACATAAAAATACAAAGCTTAACTCCACAATGTCACTTAACATAACTGGACTTTAAAAATCTCCCACCCCAAACAAAAAACGATGGTTCAATCTGTTAAACTTGGTCTGGGACAAACCCAAGGACTGGTACAAAGAGATGCACCCCACGGCTCGTGTCTCTTCACACCAGTGTCAGAGAGGACAATCAGCAGTGTAGTCTGTGGGACTCTGTGCTTGAGAAGCACGAGATGCCATGTCCTTACCATTCACAGTGAGCCTGGCTTTGTGGGAGTATGTGGAGCCAAAGTGGTTTGTGATGATACACTGGTAGCGGCCCTCGTGCCCAAAGGTGACGTGACGGAGGTGCAGGATAGTGGTATACTCCATCACTTCGCCGTCCTGTGCACGGACGTGGGCAAAGTTCTCCATGTCTGCATTGGCCAGGACCTCATTGTCCTTCTTCCAGGCGAAGGTCATTGGTGAGCTGCTGCTGCTGGCTGCGGAGCATGTGAAACGGATGTCCTTGCCCACCACAGCCATGGTCGTCTCAGGCTGGGTGATGATCTGTGGCTTTGGAAAGTCATCTAGGGAGAGAACCAAGTGTAAGACCCCTGTTCTGTTCGGACACCAGCAAATGTTCAGGCTGACAAGGAACTGGTCACTTGCGAGTCAGTTCCACCAGACACGGCGGTCGCTGTGTATTCACAAATAGTTGTAATCACTGGCACAATCGATATTAAATGTTTTTATCATCTCTAACAGAGAAGGCTGTCCTGTTTAGCTCTCCCTTCTGTCTCCACTGCTCACCAGTGGGACTGGTGACATACATTTCTGACCTCTATGGGGTCCTTTATTCTAGACATTTCATGAGACTTCTTTCACTTGGCAGATCATTGTCAAAATTCACCCATGCTGTGAGACAGACAGACTGACCTAATGTCCCATGGCATAGCTACCTGCCTACTGTCTATGCATGGGTGTCTGGGTTGCTCCAGCTGGGGCTGTTATGAGAAACGCTCTTTGAGCACTTGGTCAGAGCTGCTCCCATCCGCTTGGATGGATCCCAGGGTGGGCCCAGGAGCCGATACTGTGCTGTCTACATAGCGAGGCTTCCTCCACAAAAGGACCTCCCCATCTCATCTGTTCTTGTCATCACCTAGCTTCATGCTGATTTCCTAGAATGTGTATGGTGGCCATTTCTGTTTCTTAGAAACAAGTGGGAGACAGGGAGCAGAGTTTGAACCTCTGATTTCCTACCAAGGATTCTCATGAACCGTGGGTGGGTAGTTCTGAGGGGATTGCTACAATGCCCAGTGTAGCATGGTCACCAACTAGGGATCAGGTTTTAGGGAAACAGAAGACTGCCCTCCACCAGACAGAGGGGGAAGCCAAAGACAACTTAACTTGAGAAAACCTAAACAAGTTAATGAGTGTGGAGTCAATTAGCACTGGCTGTAAAGTGCTGCCTGCTCTAATGTGACTAGGGTGCTGTCTGCACAACCCTGATTCTACCCAGGTAGCCAGTGCACCGAGAGTCAGCAAGCCTGCTTTGGGAATTAATGCAGTGGGAGGTAGAGGATGCTTGTCTTACCTCTAGCAGGCATAACTCACAGGGAAAAGGTCGGACAAGTGGCCCGGGACACCCAGGCTGCTAGATGGGTCATAACTAGCATCGTTCAGGAAGTGATCCTGTAGCTCCGTGAGGCCACAGGGAACCACTGACAGGAGGATCATGCATTCCCACTGCTGCTCAGAGCAACCCAGACAGACCTCAACGAGACCTCAACGGTCTTCTCGGTCTTGGATCCCATCTCCTTAGCTAGGAGGCTATGCTAGTCCTGCCAGAGCTAGCCTGTGGGTGTGTTTCAGCTGTTCCGTGTTCTCTGTGCTCTCTGTAACTAAACTTGGGTCCTGACTACCACTGGTCAAGAAGATGGTTAAATCTATGTTCCAGCAAAGTGGAGGAAAGAGACTCTCCCAGTGCACATTTCAGCGGGTTGGACAAGCAGCAAGAGTGCAAGTCAACATGGAGGAATTATTTTTACTGCAGTGGCTGCTCTCCTGAGACCTGCTCTTCCTGTGTTTAACCTCTCATTCTTAGAGCTGGAAAGAAACACACATTGAAACCCTATCCCCATGCACTCATTCACAGCCAAACCTGGGCCCAGGACCCTTCTGAAAAGATCAGAACTATCGCACTGTAACCAGTTATTTAGATTTGTAGCTAAACCTA
GF1 -1 -1 1 CCTCCTAGAATTCGTCCACTGCTG
GF2 -1 -1 1 GTCCTGCCCTCCTAGAATTCGTCC
GF3 -1 -1 1 GCTGGCCAGATGTGTAAGAGGTGACATC
GF4 -1 -1 1 CTACAGTGAGGAATCCGCAGTGGCTC
EX5 -1 -1 1 CATCCAGAGTCGCTGAAGGGCCAG
EX52 -1 -1 1 GAGCTTCCTGTGTGACTGCCAGCTCAAGTG
EX3 -1 -1 1 GGAAGCTCTCACTGCTGATGTAGC
EX32 -1 -1 1 GAGGTGAATATTTAACAGACCATAAGGAAG
GR1 -1 -1 1 CACTGTGTGCTGAGGGAAGAAGAG
GR2 -1 -1 1 GCTGAGGGAAGAAGAGAACCAGAG
GR3 -1 -1 1 GCATGTAGTGCTATGAATGTCGAC
GR4 -1 -1 1 CTTAAGTGTCTCCTACCTGTTGTATG
Comments:
Target: otter_06_09_21 OTTMUSG00000024528 -- 94579027 -- 94579190 OTTMUSE00000320553 -- OTTMUSE00000320553
creating candidate regions
attempting to insert candidate regions into db
done inserting candidate regions
running aos on us and ds
running aos on gaps
finished running aos
AOS Produced 8 oligo candidates from u/d regions
AOS Produced 14 oligo candidates altogether
inserted results of aos runs
Aligned target to NCBIM36 assembly: chr: chromosome:NCBIM36:6:1:149525685:1, start 94579026: end 94579190
Found best 129-bac on NCBIM36: bMQ35c02
Found 10 RP24 black6 bacs on NCBIM36
Entered all non-repetitive oligos
Sequence count unchanged by blasting
finished aligning oligos to bac
REJECT (4) gap pair G5:6:94583690:94584689_762 G3:6:94573527:94574526_82
REJECT (1) gap pair G5:6:94583690:94584689_762 G3:6:94573527:94574526_144
ACCEPT (0) gap pair G5:6:94583690:94584689_762 G3:6:94573527:94574526_489
REJECT (3) gap pair G5:6:94583690:94584689_686 G3:6:94573527:94574526_82
REJECT (1) gap pair G5:6:94583690:94584689_686 G3:6:94573527:94574526_144
ACCEPT (0) gap pair G5:6:94583690:94584689_686 G3:6:94573527:94574526_489
ACCEPT (0) gap pair G5:6:94583690:94584689_798 G3:6:94573527:94574526_82
REJECT (1) gap pair G5:6:94583690:94584689_798 G3:6:94573527:94574526_144
ACCEPT (0) gap pair G5:6:94583690:94584689_798 G3:6:94573527:94574526_489
DESIGN COMPLETE
U-type: U1
D-type: D1
Creating display features: mapping to reference assembly
Created display features
Inserted sequence arms between oligos

webmaster@sanger.ac.uk

Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SA, UK  Tel:+44 (0)1223 834244