High Throughput Gene Targeting: Create Design

This custom vector design tool is provided by the EUCOMM consortium as a service to the research community. When using this tool, the user agrees not to submit more than five designs per day for creation without prior discussion with the High Throughput Gene Targeting Group at the Sanger Institute.

Design Type Oligo Select Method Artificial Intron Design
5' retrieval block size U block size Min 5' spacer Critical Exon Min 3' spacer D block size 3' retrieval block size
 
       
Subtype Domain Disrupted
Gene Build Gene
Start Exon End Exon
Target Start Target End
Primer Length Design Comment
Created by
Valid After Annotation
not done
oligos on fwd strand oligos as ordered View gene and design in Ensembl UCSC BLAT recombineering primers
Design ID: 41505
Chr: 11
Strand: -1
Status: Ready to order
BACs: RP24-350I22 : RP24-431F24 : RP24-476K14 : RP24-147L22 : RP24-298J4 : RP24-230C23 : RP24-230K7 : RP24-251B9 : RP24-244L1 : bMQ415e13 : RP24-350I22 : RP24-431F24 : RP24-476K14 : RP24-147L22 : RP24-298J4 : RP24-230C23 : RP24-230K7 : RP24-251B9 : RP24-244L1 :
Instance: Plate 28: Well B07: BACs RP24-350I22 RP24-431F24 RP24-476K14 RP24-147L22
Oligos on GRCm38:
Type Start End Length Seq
G5 120021878 120021927 50 CACACATACAGTACACAGAAAACAGACATGCATTCAGGCCAAAGCATTCA
U5 120017262 120017311 50 CCTGTGAGACAGGCAGAGTGAAGTCAGAGGAGAAGAAGGGTCAGCGTGGG
U3 120017157 120017206 50 CCTACCCCTGCCACAGGCTGGCATTCAAACCCCCACCACAGCAAAGCCGC
D5 120015289 120015338 50 AATGATAAAGTTCCCTGCAGAGTGGCTATTTTTAGATGAACCCAGTTCAT
D3 120015146 120015195 50 TGCTACATAGTCCTGGCTATTCTGGAGTTCATTAGGTAGACCTAGCAGGA
G3 120010233 120010282 50 TTCTGAGATCAGTGGAACGGAGGTCAGCGGGAAACATTTGGAATGACTTG
Oligos:
Type Start End Length Seq
15_E_15 119814589 119846754 32166 GTGTGGTGGCAGTGGTGCCCAGACTTTTCTGGTCGGAGTTATGGACCTTGGGCACATGCCAGCCTCTGGGTAGTGATTGGTTCGAGGAGGCTTTTAAAGTGGCATCATAAAGTGGTGTGTCCTGTATGTACAGAGAGCACACATGATCCAGCCTACCCTGGCCAGATGGGAGGTGTCCTTGTTAGTGTGAGAGGTCAGTCACCACATCCGTGTCACCACATTCTCTGGAGCGGTCCCCAACCACTGTGACCAAAGAGAGGATAGAGAGTTGGTGTGGAAGGAGCCCGGCCGAGAGCTCCACAGGGGCAGGGCCATCTTTCCGAGAACAGGGACTTACACTGTCAGTGAGCGTGTGGGTGGCTCACAGTCTCCCTGCCCAACTTGATTGCTCTGCCTTTGTTCCCAGGGTCTGGATGACTACGGGGCACGGTCTGTGAGCAGGTAAGAGGTTTTAGGCTTCGTTGGGACTGTGGGTGGGTGGCCACAGACTTGGTTAGAGTAACCTCTCCCTTGGGACCTAGCTTTTCTTACTTTGGGAACCTTGACCCTAAGCCTGCCACCAGAGCTGGACCCACCCACCCACCCACCCGTCCTGGGCTCCTGTCTGCTCTTAGTACAGTGAGCCCCTCCTCCATCCTGCTGGGTCTTGGTGTCTTGGCCTGCTCTGCTCATCCCGGCAGGCAGGGCAGGGGTGAGGAGGGTTGTCAGCCGCCTCTAGGCCTTCTCTCCCTAGAACCAGGTAGATCCTCACCAAGGGCTGCGGCTGCTGCCTGCCGAGCACAGTCTTATTCTGGGTTCATCATCCTCCCAGAGGCCAGGTAGCCTGGCTGCTGGCTGGCCAGGGCTCTGCCGGGTGGCGGGCGGGCCTGCTGCCCCTGGCCGGCGGTGGGCATGCATCTGGGCAGCTGTCCTGTGCTTTGTTCCACAGTGGCAGTGGCACGCTGGTGTCCACAGTGTGAGGACGCTGACCCCAGGCAGCTGCTCTGAAGAGCTCCCCCCAGTCTCCACCGGTTCCCCTCCTCAGCTCTCGTTGGTTTGTTCTTGGGTTGTTTTCTTTCCCACCCGCTCCTGCCTTTTGGTTGGTGATCCCAGACTCTGAAATCCCCCAGGGTCCATGGTGCTGCTCTCTGCGCCCCTGCGCTCATGCCCCCAGCAGGTGTCCCCAGCCTTGAGCATTAACTGCCGGGTGGGGGCCTGCCGGCTGAGTGGCAAAGCAGCGTTGGCACCTGCTGCCCTAGCCCTGTGGTGTTCACGACGCACATCCCTTTTCTAAGGCTGGCCACGAGCCAGGGCTAGAGTTTGAAGAAAAAGAAAAAAATCTTTAAAAAAGAAAAAAAAAAAAGAAAAAAGAAAAACAGGAAAAAGGACTATTTTTTTTCCTAAAAACAAAAACAGATATGCATGGACTCCGGTGTACGTACTGTTATTCTGCATCTGACCCCCAGAGTTCTGGCGTCTTCTAGAACAGGACAGGACTTAGGGTCCTGGGGGGATCAAGCCCAGGGACCTTGACCTGCCTCAGGCCCCTTCCAAGGGCTGCACCAAGAAAAGGGGCCTGGGCACTTGGGAGCCTCCTGAGGAAGCTGACCACTCCTGTGATGGAGGCTGCAGCCCCAGCCAGGCCCTGCTCACCCCACAAGCCAGGCACTAGGCTTCTTCCTCAGCAGATACTGCTGGGCAGGCATGTGTAGAACAGAGTGCGGCATCCCAACACAGGGTGGCGTTACCTCATGCAGTGCCCTGGTGGGAGCTGGAGGCAAGAGCAGGTGCTGCCCGGCCACATGCGAACATTCCAAAGACCTCAAGACAAGCCCACCCACCCATCCACACATACACACACCTTTGGGGAATCTTTCTATGACCAGCCTTTGAGAAAGTCGCGGCGCAGAGGGTACAGCCAGCCAGTCAGGGCCAGGGAGAAGCAGGCTCTGGTCCAGCTCCTCCTAAGTTTCTCCTCTTGTGTGTGTCTTGGTAACTTTAGAAACAGGCACACTGGACTCAGTGGCTACTGGTTTTGTCTCTTCACACACTGAATTCTGGGCAGCGGAGCCCAAGGCCCAGTGGGCTCAGCCCTACAGCTGGCAGAAGCCCTTGGGAAGCTGCGGACGCGCCTCTGATGTGGTTAGCAAACCCAGCAAGCCTGCTGAGGACTAGGGCGTGGCTGGTCCAGTCTGACAGCAGCAGCAGCAGCTCAGACACAGACAGATCCTGTTTTATATTTAAGGAAAACACAGCCAGAACCTGGACCTGTGTAAAGAACTTTCTGTGTTGTTCTAATTTTGCTAAAAGATTTCAAATCCAGGGGATTCCATGTGCAATGGATGAATGTAGACACAAAACAGCAAACTTGTAAGAAGATGTAAAGTGCTAAAAAATATTTTTTCCTTTTTTCCTTTCCTTTTTTTTTTAAAAAAAAAAATCTGAACTGTGCCCTGTACTGCGGTCAACTGTTGGAATAAAGGCTTTATTTATTGCACTGAGTTGGTCTGTGCCTCCGTCCAGCTCTCTGGCATGTGTTGGGGCTGTGTGGGCCAAGCCACACCTCAGGGCACCCCAACTTGCAGCCCATCTTCAGTCTCTTAGCTCACCTGCAGATCATTCCAGGTCATTGCCAAAACCAGTCTAGGCTTGCAGACAGTGCAAGCCTAGATGGCTCTGATGGTGACACCCGGGTGGCCTGCCACCCTGGCTGAGAAAGCAGGGCTTAGAAGGGCTTGGTGCAGACTCCTAGCAAGAGTGAGCCCTCTAGTCCCCATTCCCCACCCAGCAGAGAGGTGTGTTCAAGGTCCCTTCCCAGCAGGTGTCCATCCTGCCTGGCCTTCTGCCTCCTGGTGTCCATAGGTACCCGTCGGCTGCTCTAGCTTTACCAATAAGCCTTGTGTTTCCTTACAGCGCGGATGTCGAAGTGGCCAGATTTTGAGCTGCCCCTGACTAGAGTTAGTAAGTTGCCCTGGTCTTTTGCCCATCTGTCTGCATCTATAATGGCTATGCCTAGACCCTCTCTGGCCTGAGTCAGGACAGCCTCCACAGGAAGGGTCTGGGCCTGGGCAGGGCTTGGGAGCCTGCTGAGATGCCTTGCTCCGGGCGCTGGGCCTTCCTTCCACCAGTTCCCTCCTCTGGCTTGTGGTTCACCTACCTTCCTTCCGCCTGGAGGCTTGTGGTTCTAACCCTGCTCCATCGCTGCCTTCGCTGCGGAATATGGAGCTGGCCTAGATCTGTTCTCTCCTACCCTACAGGGTGGTTCGTCACAATCATCGGGTGGCCTGGGGGAACAGCCTCCTCCCAGTCATGCAGCATGTACCTGGGTATTCATGTGGGATACCATGGGGTTGGCCATGAGTCCAGCTGTTGAGTACCACAGCTGAACTGAGCCTAGGTCAGGTGACTTCTGCCGTCAGATCTTGCCTCTCCTGGTTCCCTCCACCTCCCCTTATGGCTACAAGACACTGGCCTGTTGCTTCTTCCCTTGGTACTGGAGAAGTGGGCCGAGGTACACCACTTGGGGCAGGGAGGAGGACACTGCTGGGCATTGTCCACCACGGTGCAAGGGGCTTTTATTCCCTTCCCACACCATGGAGCGGGTGGCATGAGAAGCCTTGACCTGTGTGTGTCCCTTAGCAAGAGTGGTCATTATCTCCCTGATAGTCACAATGATGTATTTCAGCCCAGAACTCTCTGTTGCCTTCCTGGGTGTCTGTAATGTGAATTCTGGAGTAAAGTTCTGCTAAGGTTTACAGAGAGAATGAAATGTCCTTGGCAGACTCTAAGCCGGCCACCTTCTCCTGCCTCTGTCTCCACATCCAAGATGTTCCCTGGGAGGTGTACTTCTCCTGCCCAGCCTGGCAGACCCCCTACCTCACTGCCCACTGGGTCCCACTAAGCCAGTTAGGAGCCATGAGAAAAGGCTCAGAAAAGCTGGTGTAGCCTCTTCTGGGGACCAGGTCTCTTGTGTGTGCTAGGACTGAGACTTGGATGTGGTAGGCATAAGGCAGATGGGTTTGCTAGTTCAGCGCAGTGCTGCTGCGACCCTCCAAGCAGCTCCTGGCCACAGACTGCCTAGCCTTCCAGCTCACCTAGTGGGATTGAAGGGTGCCCCAAAGCTACCTGTGGTTGCTGAGAGTTCTGAGGGATCCCCAGCCCTGTGTAGGTAGAAGAAATGGAAACCCACAGGTGTGCACAGGTCCTCCGTGGGGACTTGTTCTTGGTGGTATCCATGCTCTCGCTCCATGGCTGACAGACTACTGCAGTCCAGCCTCTCAAGGTTTCTGGTACAGCGTTGTTCACAGATGGATGCAGGAAGTCCAGGGAGAGAACTGATGGGGGCCCCGCTACCCCACCTGCTTCCCACCACACTGCCAGATCCATTTGGCATGGATGTCACTGGTCATCCCTGGATGCCTGGTCCTCCTTTCCCCAGTTGGTGCAGCTTCAGATGTTGAGTCCTCCCACTCCTGGAGATAGGCTGTGTGCCGGCCATGCCCCCTTCAGGTTAATTTCACTAGTCTAGTTGGAGTCTTTGGAAGGAAACATGTCCCCAGATTCTGCTAACAGGAACATGTACAGAGCAAAACTTTGTAGTGGCTTTGGTATCTGTAGATGGTTCTTTGTGCTCCAAGTGGTCCCATGGCTTTGTGAGGAGGAGAGAAGAAAATGTCTCAGAGCCTCTTGGGTAGGGCACTCTGGATCGGAACTTTCACTCTGGTCCTAGCTGGTAATAGATGTCGGTGAGTAATGGCGCGAGCCAAGCACGGCAGGTGTGAGGCGTGTTCTGTAGGTATCTCAGCCGTTCTGCCCTGCTACCTGGGGCAACCTGCTAGTCGCTCTACTCTATCCCATTCCCTCAACAGGACAACCCGTCCTTATTCCAAGCCTCCCCAGAGCTGTCGCCCTCTTTGGGAGCCCTTCTGTAGACTCTGGAGTGGGCCAAGGGCAGCCTGGCCATGCCAGAGGCTGCAGCTAGCAATGGCCAGGGTCTGTATCTCACCTGTCAGTCAGCCCCTCTGCAGCCACCTTGAGGGACTGCAGCCACCAGCACAAAAGCAGAGAGAGGTGTAGCCTGGCCTGGGACGGCTCCGGCTACAGGCATAGCAGATAGTGGCCCTTAATCCCTGGCTCTCAGCAGAGGCGAGTAGCAGTGGAAACACAGACACCACCTGGGAGGGGACAGGGACCTGGGCCTCTCTCCGTGCTTCACCTTTAAAACCTCTCAGTCGAAGTGTTTGAGATTTTTAGAAAATGTCCTCTTCAGGAAAATGTAGGGTGAGACTCTACCTATGTAGGTCTTCTCAGGAAGCCTGAATGGAGAGCCTGCTAGCCCACCCTGGGCCTGCCACCAGCCCCGGGCTTCTGAGAACCCACCAGGGCCAGAGGTGACCCCATTGCAGGTAATGGCTGTAGAGCCAAGCGCGCTTCCCTAGGAGTGCAGTCCTGTGCCTTGCGAGCCCCCATGTCCACATGCCATCTGTGCTGTTACTGTGGAGCTGCCTGGCCCTTCCCACCTGCTGCCCTGTGCTGTTCCCACTGGAGTGGGTCCTCCCAAGCCTGACAGGGACAGCAGAAGAGGCTGCCGGGAGGGCTGGGCTGGGGCAGCCCGTCTGTGCCCATCCATTCCATCTCCACGTCTTGTCTTGAGTCATGTTTGTGTATCAGCTGTGGCCCGAAGGGCACTTGGGTGGCGCAGCCACCTCTCAGGGAGATGGCTAGTCCCTCAGCAAAGGACCTGGCCATCTGGCCAAGGTCCCGGTGTCAGTCCCCCACCTGTGGAGTCAGGGCACATGTACCTCATGTCTGTCATGTCTGCGTGTCTACAGCGTGCCTTCTACGGCGCCCTGCATGCCTGGGCTGGTTTGTGTGACCTACTGGGCCCTGTGCTCTGCACGGGAGCAGAGCCACTCCTTGGACTCAGCCTGGGTGTGGGAGCTTACCAAACCACAGCGAGCCTTCCTTAAGAATGGGGTCATCCACCCCAGGTTGGGAAGGGAACAGCTGGTCCTAACCATTCTGCCCACTCTGCTGCCTTTCCTGGAGCATGTAAGGTGACAGTGGGTAGCTGTGCTAGGGGCTAACGGGTCTTGAGACAACACCCAGCTCGATCCCTGGTTTCAAGAGTGGACCACTGGGCTCTAGTAGTAGGGGGGAGGGTCCCAGGAGCAGCCTGATGGCCCAGCTTAGCCAGGGCACCAACCCAAACTGAAACTGCTCTTCTTTCCCCAGGAATCCCTTCGCCAACGTCCATCTGAAACCAACAGTGACCAATGACAGATCAGCCCCTCTGCTCAGCTGACGGGCTCCTCTGCATCGACACTCTGTCCCCACCTGCCAGCTGAGGGTGATCAGGGCATGTTCCTGTCCAGAGAAGACCACAATGCCCCACTCCCTAGCCTCGCCTCACATCGGCCCAGCCTGGGCTGGATCCCAGGTGTTCCTGGTGAGGTGGCTGCCTCAAGAGGCCGATGCCCCAACAGAGGGGCCAGCACTTGGGCAACAGGGACCTCTGATCCTAACTGTGGAACCTCGAGAGCCTCTGGACACAGAGAGGACATTCTGCCGGCTTGCAGGGAAGGGAGCCTATTCCCATGCTGACTTTTAAACTTTTTTATCTCACGTGTGTCTGGTCAATAAACGTGTGCTCACCATGTGTAGTGTGTGGTCTGTTGTGCTATTGTGCGGAGAGGAGAGCCGGCCGCAGCCCAGCTCTCCAGCTACTTCCCCACTTCAGCTAAAAGGTAGGATCTCTATAAAACCCAGTCAGGCCCGTGTTCAGATGCAGCGGGGTGAGGAGCTCGGCTGATGGCAGAAGTCGTAGGATGCAGGGAAGACCCAGGCAGACTTCCTTCATCAGCTCCCCCAAGAAATCCTCTTGGAGGCACCCACCCATTATGTAGGCATACAGGCCAGCCCCAAAACAGAGTAGGGAACACAGGAGTCCCATTGCCAGTCTCCTGCCTCTCACTCCACAGTGGCCTGGCTCAGGACAGACTAGAAGCTAGGCAGATGGCTGCCCTGGAGGTCCCCTTTCATCCGACCTCAGAGAGCCGTCTTAAGGGACAGGAGAGGGTTGGAGGGACCTCACCTGGCATATGGGGGCAAAAGAGCTGAGTTCCCCATCTACCATACCGCAGGGTGTTAGCTACAGACCCCAAAAGAAAACACTGAGCACACAGGCTGTTTTTTTCTTAGCTTGGTTTCTCTTAAAAAACAAGGAACAAGAAAATCATTGCACCAGCGTCCATCCTAAGCCTCAAACTAAAAACAGAAACAAAAACAAAACAGAAAACATTGCCCCCACCCCCAAAGCAACAATATACTTTACATGTCTTTGGCAACAATAACTTAGAATCGCCCCATTTTCATTCACTCCAGCAAGTTACAAAAATATTCCCTGTACTGCCCACCCCAGCCCTGTTTTCTCCCAGCCCTGCCTGCAGGCAGGAGCCCCCAGTGGCTGTAGGGTACCCCCTACTCTCCTCTAGCCACCAGGGTGTGGGGCAGGCACTGCCCTGCAACAGAGAGCTGCCCACACTACCCTGCAGAGGGCATCTCTGAGGCAGCCAGCCGCAGCCTGGAAGCCCCTACTACTGGGCAGGACCTGGGCCAGAACAATCCAGACCGACCCTGTGGGGAAGGGCGTCCACAGAGGCAGTGAAGGGGAAATAGCTACGGACTCTGAGATAAGGGCTTAGAGCCCAGAGGTCCAACCTTGCTCTGAGCAAACCTAGACCCAGGTAAGAAAGGTGGGGGAACCCAAAAGGGACCTGCAGGCTTAAAGCCATCCTGAAACCTGGCCAAGTGCCCTTTGAACACATGGCAGGACCTAGCCAACAAGGGCATACAGGCCCTTGGACTGCCTGGTCCTGGCCTGGCCTGAGGCCAGTTTACCACCAACAGACATATTGGGGAGGGAGGCTCTTCCCAGGAGTGGAGAGTCACCTAAGAGTCAGGGGGCCCTTCTTGAGTGTGTACACATATGCTTACAGACACCCATAGACCCCCCCAGGCTACAGGTATCTCCAGGGGCTAGCAGCAAACCCCAGCATCCACTCGGGACACATTCTGTCATCAGGGCAGCACAGAGAAGGTACACAGCCCAATGCGTCTAGGGCTAGATACAGGCCTCTTGTCCACCTGCTTCTCCAGGATGCTGTAGGGTGCCGGTGGTCCCCATTCATTCCCAGTCAGTCACCAACCTTGTCGCTGCCTGGGCAGGATGGCAGGGGCTCCAGTGATGCCAGCCTCCGAAGGGTGGGATAACCTGGGTCTCAAGCCTCTGTGTATCGGCCCCCAGCACCTGCTGCTGGGCCTGGTAAAGGGGGTGCTTTGTGAGCATGTGGGGAGATACCAGACAAAGGTTCTCACACACCAAACCTCACCCACACCCACAACTGCCTGGCCCAGTGGCAGGCCTGTTCAATGTGGTAGGCCTGTGTCTAGATGAGGGATAACACACTTACACACACACACACACACACACACACACACACACCTGTAACCCAGATCCAAAGCATTTGTTTAGCAAATGTTCCCATGTCTGTGCACACATGGAAACTGAGGCCAAAACAAAGAAGGCATGGTCAGAGTCATGCAGGGACAAGGGTGACAAGTTCTTCCCTCAAGGTTACCACAGCCAGGGCAACTGGGGAGGAACAGGCAGAAAGGACTGGTCAAAACTGTGAGTAGGCTATGGGAGGAGAACCTGGTAGAGAGGATCCTACCAGGGTTAGGCAGTTGGAGGGGGCACGTGACTTGACAAAATGAACTATATGATACCACCACCTGGGTAAAGTCCCTACAGAGACTTCTAGCAAGAACCTCAGATTAGAGATGAGCCATAGATGGTGACAGGAGTACAGACCACCATGCTGGGAATGTTCTAGTAAAGTCACGGGAGTCTACGGTCAGACTGAGAAGAGAACAGATGCCCAGCATCCTGCTGTGGAGGGCGGAGTGGCAGGCCCTGGGCCCAGGAGGCAGTAGGCCAGGTCCACCAGAACATAATGTCTGCCCAGAGGCCAGGGGGCAGACACTGTTAACAGGGCAATGTCCAGCAGACCAGAGGCCACCAAATCACCCCTCATAGATCCCCATTCGTGGTGTCCCTCTGCTCCACCTCAGCCCCCACCACACTCATACCTCCCACGGACTGGGCATCTGAGTCAGATATGTGGGTGATGGAAAAGCGGGAGGCAGGTGTGGGTGACACGGTGAAGCGTGAGAAGGGCGCAGCTGGCGTGGGAGGCGCCGCCAGGACAGGGTCAGCAGGATCCAGCTCAGTCACCAAAGCAGCCTTGCCGGGCACCAACGGGAAATCACCATCCCATTCGAACCTACTGCCTGCAGGTCGGACCAGAAAGTCACTTCTGTTATGTGACCCACCCCAGCCCCCACTTAAGATGATATGGCGTCTTGAATCCAGACCTTCCGTGACAGTGATGTCACTCTCTGGCCCCCAAAACCTGGCTCACCTGGTTCAGGAGCAGAGCTGTCAGGAGAGTGGCCAGCCCGCAGTGGCAGGCCGGTGGCACTGGGTGAGCTGGGGCCACCCTCCAGGAACGTAGGGAGTGATTCCTTTGTGCTGGGAAAGGGCTCCCCAGTCTCTCGGGTGGGGCTTTCCTGGAGGGACAGAGCATAGTGTGTGACTCGAGCCGCCCAACCTCCCCCAGCTCTGTGTATACCCAAAGCAGCAGCCCACCTGGTCAAAGAGGTAGACCGTGACATCATCGAAGAAGGACACAGCCTTCTTCTTGCGCTCCAGGTCGTCACAGAAGGCCTCTGACAGCAGGCTGGGCATCTTCAGCAGGCTGCGTAGATTTCGGGCACTCTGGCTCTCAGCCACCACCACGGGCACCGCTGGCGGCTCCTCCTCGCTGTCCTCACTGGGCTCCTGGACGCTGTAGCACCGGAGCTCCTCATCAGACTCCTCGCTGTCCTCGGTGTCCTCATCCTCCTCCGGCCGGCCCTCCAAAGCCCCGGGGTGGCCAGGCAGGGCCAGGCAGAGCGGGGATCTGGGTGTGCTAGGATTGCCCATCTGCCCCTGCTGGGCTCGCCCTGACAGCTGTCCTGAGGGACCCTGGGGCTCCGTGCCACTGCCTTCTGAGATCAGTGGAACGGAGGTCAGCGGGAAACATTTGGAATGACTTGGGCCGGGCACAGGCTGCACTCCAACTGGGCCTTGAGCCCCGAGAGGCTCTGGCCTGGGGACTTCTGGCAAGGGCTCCTCTGACTGCTGTGGAGGGGACAGCACCTCGCTGGACACTGCAGACCTGGGAAAAGCCTGCACAGACTGATGCCCTGGGCTAGGTGGGCTCCTCAGGTCTTGCTCCTTTTGGGAGTCCTGGATCCCACTGTGCTTCTCAGGGCCAAAGGTGGGTTCGGACTCGGCATCCAGGTCTGAAAAGTAGGCAGAGTCTCGGTAGGGGCTCTTCTTGCTGAGGCCACCAAGGGAGACAGAGAGCAGAGGATCGGGCCCTGGGCTCTCACCCTCTGAGGCTGGCTCCCCAAAGGCCTCAGGCTCACTCGACTCATGGGCCTCCTTGAGCACAAACTCAGGAGACTCATAGTTCTCTGTATCATAGCCACTGTCCACGGCACGGGGCTGCCCGCCAGGTGGACCAGCAGCTGATGGGCTTAAGACCTCACAGCCACCATCACTGGCTGAGGACGGTATGTCCAGAGAGTCCAGGGAGTCAGGGGTCCCCACCTGCTTCTGCAGACTGCGCAAGGCTGGTACTATGCCTGACTTCTCCGTGTGTGGGCCGTCACTGGACAGGTCGGTGAAGACTCCTGATGTTGCCTCGGTCGTGTCTTCGTCCTCGCTGCTGGGTGCCTCTTGCCCCAGAGAACTGCCGCTGCTCTCCAGGGTGGGGGCTGGCTCAGGGACGGTCACCCAGCTGCCAGCAGCGGGTGTGGGTGAGGCAGGTAGGATGTCAGGAGCGCTTGCCTCCTCCGAGGGAAGTGAGGCTCCTTCACAGGATGGGGAGGGGACGGAAGGAAGGGGTAGCTGGGGTTCAGCAGATCCCTCAGCCTCCTGGGCAAGTTTGGGTTCCACAATGGGGTTCTCAGCCCCACCCACAGCTCCCTCTGTCCAAGGGGATGTGATGAGGCAGGCAGCAGGTGCCAGGCCTTTGGCAGGACACAGGGGGAGCAGGTTGAAGGGACGGCTTGGCTCCTGACCAGGGGAGACTGCTACTAGCCCAGGGAGAAAATCTCTGGGATCCTCCTGGGACAGGAGATGGCCCACCTCAGGGGAGGCTCGAGGGGTCTGCTCTAAGCTGGAGCAGTCGTCCCTGTAGCTGTCTGTGAAGCTGCTAACATAGCCAGGATCCCAGGATTCTGGGTCGCGACTGGCACTGTTGTTGTTAGCTGACATGTTAGAGCTCCAGTGTCCACACTGAGCGGCCAACCCCACCTTCCCCTCCTCTGGCTCCTCATCACTGGGGGAGGGCTGGGCCCCAGGACTCCCCGAGGGAGATGCACCCAGTGGGTCATCAAAGAAGGGCGGGCAGAAGGTAGCCACACCCCAGTCTATGTCTTCAGCTGGCAACATCGGGGTCCCAGGAGAGGGTGAGCGTGAGGGACAGGGTGACCCTTGCCTCCTATGTGAATGGTGGTCACAGGGGCCCCACAGACCCTCAGTTGGGGGTGCATGGCCCAGCAATGGCTCCATGGCAAGGGACGCAACAGTGCTCTCCTCAGAGTTATTGTCCTGGTCAGTCACAGCCTGGGGGCTGGGAGCGCAGCCGGCACAGTCTGGATCGTGGCCAGCAGCAGGCACTGCCCCCTCCAGGCGGATGAAGTACTCGCTACCCACTGAGGGGCTGTGGGCACTGAGGACTGGCACCACACCCGGCGGTGAACTGTCAGGCGCGCACAACTCCTGCAGGCGCGCTGCCGAGCCTGGGCTTGATGCAGCCCCCGAGGGTGGGTACTCCTCAGCGCCACAGCCAGCCTCCCACTTGTATTCAAAGTTGAGGCCGTGGCTTGTCTCCGTGACCGTCAGCACGTCATCACTGTCCACGTGAAAGCCGTCGCTGGTGAACCGCTCCAGCAGCGGGAAAGACGAGGCAGCGGTGAGCTCCGCGGAGGCGGCGGTGGCAGCTGCTGGGGCTGCAGAACCCGAGCCCAGGCCCGTGCTGCCCCCGGGCCGCAGGGAGCGCCAGCGCCGCTCAAACTCCTCCTCCAATTCTGTGGTGCCCTTAGCACACAAGTAGGACAGCAGTAGATGAACCTCTTCAGCTGTGGGCCTCTGCTCTGGCTGCAGCCAGCAGAACTGCATCACCTCGTACCTGCCGGGAGGCCCTCATGGGTGGCCCTGGCCATATCCAGAGGCACGCTGGCCGGAGTATAACCTGCCCTCCGGGGACAGTCCGTTCCCCCATGCTCAGAGTACCCTGGGAACACTAGGGGCAGTCAAGGCAATCTCCCAAGGCAGGCCCAGAGGCCTGGGAAGGGCCCTGAATTAGGGTAGTTCAGGCTGCAGAGACCCAGAAGCCCTGTAGAGGTGGACCGAGCAGCCCCAGGCTGTAGGGCTCAGCCCCCTGTGCCCCTCTGGCCTGCCTGCCCAGGGGGGTGGGGTCCTCACCATCGATCAGATAGAGCCAGCTGCAGCTGGGGCTTGGGCAACTTAAGCTGCTGCTCCCGGACGGCGTAAGCCAGCACCTGCCCGTCCGAGTGCTGGGGGTACGGCTGCGCACCCAACTCGAAAAGCTCCCAGATGGTCACACCCAGGGACCTGCGGGAGCAACCACAGTGACACGTGGCTGAGCATGACTGCACAGAATCCCTGAACACCTGTCATCATGTCAGCCTCTCTGGGACTGGACCTCACTACGCCACAGCCGCCCCTCTCTAGAGGCACAGATGCAAGGCAGAATCCTGTATCCCTTAAGGACAAGTGGCCTTCAACAGCATCTCAGGATGATTTTTAACCAAAATATGGTGCCAGTATTGGGGGGGTGTCAGTTGGTCCTATCCTGAAGGCCCCATACCCTTGACTGTCAAGGCAGTCCCCCCTACACACACACACACACACACACACACACACACACACACACACACACCAGTATAGGAACCTCAGGAACCCATCATCAACGAAGTAGCCTGTAAAGTGCCTCTCATGGCCACAAGGTGGCAGGCATGAGTACACTTTCCCTGTGTGGCAGCCCTAATCCTAGCCAGAGAAGGAAGTCAAAATGCTGGAGCAGGGGGCAGAACTGAAAGGCAGCATCCCCACTAGAATAGCTGACGCCAGCGCCATCTGGGGAGGCGGCATCCCAAGGCCCTCCCGGCAGCCCTGCCTGCGCTCACCACACGTTGCTGCTCTTGGTCTGGTCCACCACCAGCAGGTTGCCGTGAACCTCGTCCACCAGCTCTGGCGCGATCCAGCGCAGCGGCACCCACAGCTGGTCAGCGGTCACGAGATAGTCTTCCTGTAGCACGCAGGGACAGGATGGGAGTGAGCTCCGCTCAGCAGCTGCCCCTGCACACGGGCCCTGACGGCCTTACTCACCCTGTATTTGCAATGCGACAGGCCATAATCACCAACCTTCACTGTCAGGTCAGCCGTAAGCAGGCAGTTCCTCAGGGCCAGGTCACTGCGGAGTGGAAGGCAATGTCAGCAGAGTGTGCCAGCCTGAGTGAGCCCTGGTGGAATGGTTGGGCTCCCGGGCACAGCCAGGCAGACCGACAGGAAGGGGTGTCTGAGGGGCCACCCACTTGTGCCCAAGTTCTGGCTCCACACCCTGTACTGGCTATTTTGGAAGACCTGTGTGGACTTCAATGCATTTCTAATACTTCTTCTTCTTCTTTTTTTTCTTTTTTTTCCAGACAGGGTTTCTCTGTGTAGCCCTGGCTGTCCTGGAACTCATTTTGTAGACCAGGCTGGCCTCGAACTCAGAAATCCTCCTGACTCTGCCTCCCAAGTGCTGGGATTAAAGGCTTGCGCCACCAAGCCCGGTTTTCAATGCACTTCAATGCATGTGAAAATCAGGCAAAAGATGCTCAAGGACGACCCCCCCCCCCCAGCAAAGTGCTGTCTAACTGCACCAGAGCCCTAACCCGCTCCACCCTCTGTCTGATCTGCCCAACAAGGGCCAACAAGCCATGGAGCAGAGAGTCTGCAGTGTCCTCTCAGGACCCTCACCCTTCCGACTACACTCCACCATCCCAGTCCCCAGGAGGTAAGAACTGATGGAGAAACCGAAGCCCGGAGTGTCTCAGAGGGTCCTGCCAGCAGTCAGAGCCCATGTTCTAGAGTGCAGCCCTGCCTGGCCTGCTACACAAGCTGGAGCCGAGGTCTAGAACAGTATGGACCACAAAGGCCCCTTTGTGTGGAGGATAAAAATCACCAACTCAGTGGGAAGCCTGGAATGCCAGGCTCTGTATAACTCTTGCTTGGCTATAGCGCCCCACCCCCAGGTGTTTGGGGTACAGGACAATAGAGTGCCACGGGACGCACCCTCATCTGCCATACTGGCTGTTCTGCTGAGAGATCTCTGGATGTAGATGGGGCCACCTTGGCCTGCCTCTACCCCAGGAGGACTGTGTCAGGGGACAGGGTGGGGTGACCTGGGTCCATGCCTATGGGTGGGGCAGCTGGGCTAGGCAGCAGGCAGGGCAGGAGGCTGGCAGCTGCCCTCTTCAACAAAATCACTGATGCTGGAGTCACTGTGCACCCACTCAGCACCAGGATATTGTTGGGGAGGACGGCCTGTGCAGCGTTGGAGCTGGTGGGCCGCTTGTCCGTTGCCACTTCTTCCAGCATGTGCCCCCAGCTCATGGGAGGCTGGGCATCCTGGCCACCAGAGGCAGGAGAGAGCCACCCCTCCCACTACAGGGCCAGCCCAGCCACTCCCTTTGTGGCCTGAGGGAAAGAGGCTGGGGTTGGTATGGAGCCCAAGTATGGCTGACTGCTCTAGTAGACAGGATGGGTTTCTTCATTTAACTGTCTGCAAGGTGAGTTTCAAATGCCAAGTCTTCACAATTTATTTCATTTTGAGATGGTCCTGCTACATAGTCCTGGCTATTCTGGAGTTCATTAGGTAGACCTAGCAGGACTTGAACTCACAGAGATTCTCCTACCTCTGCCTCCCAAGCGCTGCAATTAAAGGCGTGAGCCACCATGCCCAGTTAGTTTTCCCAGTTCTAAGAATGATAAAGTTCCCTGCAGAGTGGCTATTTTTAGATGAACCCAGTTCATGAGGCCCACAACGTGGGATCACCGTGACTTTTCTGCACAGGGTCGTGTGATGGTGAGGGTTAAGGCCCTGGGGGAGTGGGGCTTTGTAGCTGTAGCCTGGCTAGTCTCGCTAGCCCTCACCTGTGTACATAGTTGTGTCGATGTAGATGCAAGACGCCACACGCCACCTCGCACGCCATGCGCTGCAAGGTAAGTGGGTCAGGCGCCATGGACTCTGTCACCCGGCAGCTCCGTAGATAACCTTTGAGGTCCCCCTGATGGACGAGAGAGCACACAGTCACCTGCTAGCTGCAGCGACCAGCCCATCACAAGTCTGCCACCCACACCAAGAGAACCTGGGTCTGGTGGCCTGTGGATCAGCTGTGAACCCTAGTGTTCACTGCTGTTTCAGCAAAGCCTGTGTCTCAATTCTGGCACAGTGACCTCCATATAAGCAGCCACCAGAGCTGTGCATGTAAAGGGCCCAAGGGGCAACACGAAGACCCAGAACTCAGGCTCTGCCCCAGGAGCTTCGGGAGCCCTGTGGCTGTCCCAGGACACCTCTCGCTGAACTATCCAAGACCCCACAGTGTTGCCCCTGCTGCTGCTGGCTCACTTTCTCTCCGCAGACCTCCTCTGAGGGAGAGCAAGGACTACCAGGACTCTACTTTAGAAATAACAAAAGACCCCAAGAGGCTGAGCAAGAGAGGAGCCACTCCCCTTTGGAACAATGAGCTACAGAACAGGACCGGGAGAGACAGAGCTACCTCCCCGAGAGGACCACTTACCAGTGGACAGAACTCCATAACCAGCAGGTAGGGGGTCACTTCAGCACACTGGGCCAGGCACTGGAGCAGGTTGCTGTGCTGCAGGGCCCTGGAAGAGTCCACGGGTGTTTAAGTTGGAGGGCAGGAGAGGGTGTCCCATAGCCCTCAGTTTCTCCCACTGTGCTGCTCCCCTGCCCGGCCCCACCCCGCCCCCGCCACACCACCCACCTGTAGGGCTGCGCCTCCTCCAGGAACTGCATCTGCTCCTGCACGCTGGCGCTCACCTTCAGCTCCTTCACCACCACCTGCGTGCCACTGACGCCCGAGTGTACCTCCCCCAAAAACACCTGCCAAATGTGACAGGCATCACCAGGTCCCCTTTCAGTCTCCATAGGAAAAGCCATCTAGCGCCCAGGGCCTCAGATGGTCATACAACTTCTCACCAAGCTCTGGCTAGAACCCTCAGCCCCAGTCCACCCACAAGGCTCCTACTTTTCTCACTGCCTGGGGACTACAATGAGGAAAAAGGAATCAGGTACATGGTCCAGTCTGGGGCGGGTGTTAGAAAGAGCCCCTCCCTAGGGGATCCCCAGGAGTAGTGGGTCCACCCTTTGCCATTCCTGCCACCCCGGGGCATGCTTACCTTCCCAAACCAGCCGTGGCCAATCTCCTTTAAGTACAGGAGGCTGTGCCGGCCCAGGTCCGTGGACTTGAGAAGTTGCACTAGAGTGGAACAGAAATCCAGACACAGCTTAGCCACCGCTCCCTCTCCATCTTCCCGACCACGCTCTCCAGAGCCCAGAGAGCTTTCCCAAGCTCCCCAGCCAAAGAAGCTTCAATAAAGTGGAGGCCAGGTTTGAGCGCTGTCATCGAGGGCCAGTGTCTCTTAGGCTCTGGGGTGGCTGCTGTCAGCAGAGCTATGGACCTCAAGTCTCCATCCAGGCAAAGCCTGGGGATGCCCAGAGCAGAGCCACAGGGAGAAGCCAAGCCCAAACAGCAGGGCCTGGAAAGGCGTTTGGATGAGGCAGGAAGCTGGTGCCGAGGCCTGGGAGGACAGCAGAGCAACCAACCCCCTACCCCTGCCACAGGCTGGCATTCAAACCCCCACCACAGCAAAGCCGCCTTTGTTGGGGGCTGCTTGGCACAGCCCTGTACGGGACACACTGGCTCCATTCTCCCTGTGAGACAGGCAGAGTGAAGTCAGAGGAGAAGAAGGGTCAGCGTGGGCAGAGGAAAGGGCCAGGGCTCACTGCACCCACTCATGCCCCCTCGGATTCTCTGAATTCTGCTCCCACGCTGATAGCCCAGAAGGCCGGGGTCAGGGCTGCTGGGACGCCCAAGGGAAGATGGCAGCCCTCGGGGACTAAGTCTGCTTGGTGCCCAGCTCATGGAAGAGTCTCACCGGGCACTGTGCCCCCAAGACTTACACCCTGAACCTAATCTGTCTAAATGCCTGGTGGAAACCCTGGGGTCTCTAGGACCTCAGTTGTCCCAGAGTGGGTTCAGGGTCCTGACAGTAGAACCCAGGGCAAGCACAGGGGGCAGGAGAGTGCTTGTATGTTAGGAGCTAGAGGTAGAGGAGGCGGCTTAGGTGGGCTGACCCATCTCACACAAATTTCTCCCTCCTTGAAAGAAGATGCACCCCCCCCCCAAAAAACCCAAAAAACAACAGAGCTGAGCAGTGCAAAAAGCACCTTTGCCCTCTCCTGGGTCCCTGTCCCACTGTCCTTGGCCATAGATAGCCAAGCCTGCCTCCTAGGAGGTGCTAAGGACACCTGCAGGCCTTTGAGCCAGTGGGTAAACGTGTCCATGTCTGGATCCTGCCTGACTTTTGAGCTCACTCCCTTGAGACTCGATGGGCCACAGAGCCATGCATTCAGGGTTGGGTCAGGCTGGTGGCGACCAGGGCAGCATTTATCTAAGTCTCTATTGGCTCAAACAGGTACTTTGATGCAGGCTGGGCCCTGGATGGGAAGCATTGTGTTGAGAGCCTGGGAGGGCTGGCCCAAGGTTAAGAGCGGCCTGCTTTTCACCACAGGGATGGGGCCAACCGCACTCTCCACTTGAAACCTTCCGCGGTGTCCTTGGCGCCATCAGATGGACAAGAGACAGCCCTGAGCTGAAACTTCCAGGCTGTAAAGGCCTGAGAGCTGACTGTTGTAGAGGTAGTCATAGTCCCAGGCACCAAGGTGACCAGGGCAGCATTTACCCGTCACCTCTAAAGAGGAGGGGGGTGGTGGTGGTGCAGGGAGAGGCTCTGGAAGGAAGGCAAATGGGAGAGGCAGACAGGGCAAGGAAGCTATGGGAAGAGGCCCTGCCTACACCTGGGTTGGGGGTAAGGGGGTGGGCATTGATGCTTCTCTTGTTCCCTATGCTGTGTGGGTAGCCTGTTTGGTAGGGACAACGGGGCCACATTCCTACAGGTACAAAGGAGCAGGAGTCTGGGAAGAACAGAGGTAGATGGATAATCCAGAGTGCTGAGCCACCTGCCCCAGTTACCTCATGGCAGCCCCTGGGGTGGAGGAGCGACAGACAAGGCTACTCTCAAGCCTGGGTCCCAGAGGGGCTCCACGCACCTCCCAACACAGCTCAGCCTGAGATGCGGCCAGGAGACCTCGGCTTCCCAGTGCCCATGCCCCAAGCGACCCCACACCACTCACCGGAGCGACCCGGCTGCTTGGCCATGGGTAAGGAGACCTCGGTGAGGGGCAGGACATACACATCGGGGCCGGTCTGTGCAGCTGCAGCCGGGGAGCCCTGCTCCGAGAAGTCGGCCACATACTCGTCCCCTTCAGCATTCTCAAACTCCTGTGGGTCGGGCCGGCACGGGTGGGTGAGCAGGACACAGGCTAATGGAGGCAGGCTAGGAGAGGCCCCTTTACCCCCAAACTCAACCTGACTTACACAGGCCTACAGCATGGGCCCCTGCCACATGGCCATTCCCCACCTGTTCACCGGCCCCAATTCCTCAGGGACACCATCTCAGCAGAGGTCAAAGGCCTCAGGCCCAGGTGGGGCTGGGAACCCAAGGCTGAGTCCTGCTTGGAGAAGGGCTAAAGAGTTCAAAGGGACAGAGGCAGAGTAGCCCCTCATAGGCCCTGTCAGTGGTCTCCTCCCTGCCCCCACCCCCTGCCACCCCATGGCTTAGAGCAGATTTACAGGCAGGGGCTCACTGCACATCTCGGGGAAGGTAATTCGGTTCCTCTTCCCTAGCTGGGCAGGGAGCAAGGAACCCAGGGACTTGTTCTTCATCCACACCTCCACTGCCTGCCTGCATGCCGTGGGGTACCCTCAGCCCTGCACCCCCCCCCCCCAGTGCACCCTAAGAGCTTGCTCCTGCATCCCTGGAGATCACTCTGGGGACAGGCTGCTAACTCTGAAGACTATCAGCCTAGGAGAGACCACCCGACCCCCACCCCACCCCATCTAGATCACATTCCAAGCAGCATTAGTCTGGGGTAGGCCACAGCCATAAACAAGGACAGGGTTTCTCGTGGAAGAACACTTGCCCTAGAACCACAAACAAACACATCAAAACCAAAACAGGAACAGAGCAGAAACCAGGCCAGCTTGTCCTCAGCACCGGGCAAATCTCCCTGCCACATCTCCCACCCAGGTGAAAACTGGGCTCTGAGGACTGGGCATAAACCCGGAGCTTGGCTGCCCGCTCCGGGCCACGTTCCTGCGGACAAACGGCTAAACATACCCTGGGGACCTTTTTCTAGGTCATCTGTCTTTCTGTAAAGGGGGTGGCCCTACATTCCTAGTGGTTAGCCCAGCTCTGCATTCTGAGAGCAGAGCCTCTAACACCTGTGGCAACTCTTCCTCCCCGGAGCCTAAAAGACCACATTAGAACGTCCTCTAGCCCCACACGCTGGGGCCTGCGATGCCCGCTTCCCCCTTTGTAGTATGAATTAGTTCTGGCTTCAACCATTACCTTCCCTTGCCAGAGAGCCAGCCGGGTTCCCCCAGCACAGCGGGCGATCAGGTAGCACAGGGTTAGCATCCAGCCCCTGCCCAGAACAGCCCCGGTGGGGAGCTCGCTGTGGAAGCAGGAGGCAGTGACCCTCCAACCAAAGCACACTGGTGCTGGAATGTTCTGGGCACCATGTTCCCAAGGAGGTGAGAAGGGCGAGGGTGGGAGGGACTGCTGTCAGTCCTTGTGTGGGGCCTTGTTCTCAGCGCCTGAGGAGGGGCTTGCTACACAATGGCTGCCTAAGCTGTGCCCTAGCTTCCCACCCCCACGTCTCTGACCTGAGGTTCTGCCCTCAGGGTCCTCCAGGATGCAACTCTCCTTTGATTGTCCAGCCCATTGTGCGCTGACAATCAGGAGGTCGGGAGATTGTCCCCTGGGGTGGGGGCACCAGGGAGGGGGGCACACTGCACTGCTGTTAAGGAACTAAACACCCAAGTTTGGCTGGGGTCTGTGCTACCAGGTACTGGGACTCTGCAAAAGGGTAATAGCATTTGGTGCAGGTTACCCAGTAGGAGGTACCCCTAAGATACAGGCTGGCTCTGTGCTGGACCACAAGCCCTGTTCCCACCCTGACCTCCTACCCAGCCTGCAACCCCACGTGGGTGCGGGAATGTCCAGGGCTCTGGCCAGGCCTCAATATGCTGACAGACAAGGCTGCAGCCCCCGCAGCTCCCGGTGGCGCTTCCTGGGGGTGGGTAGCTCTGTGCTTTCTGCCCTGCATTCTTGTTTGGAACCACAGTGTGACAGCAGGGTGGCCACTGGGTTGGAAAGATGCAGGGCCTCCATCACTGGAGTGAAGGCCTCAGCTGTGGGGTCTAGCCTCCTAGGGAGACTGTACTAGGGAGAGTGTAGTGAAGGCCCCAGGGCCCTCAGTGGACATTCCAGAAATAGGATGGCCCTTGTCTCGGGAATCTGATGGATGTCCTCTGAGCAAAACATGCCCAGCTAGGAGCTCCCCAGTGATGTCGCTGCCGGGGACATGTGTCTTGGGGCTTCACTTTCCCTCTGACTCAGTGAGCACAGATGTAAGGACCTCTGTGGGGGTCCCCTTCACTGAGAGTCGGAATGTTCTCGAGAGCCCCTAAATGCTCCTTATGGTCATTTCGGCTTCTCTGGACATGGACAGGCCTGACCTGGCGCTGGAAAGGGTCAGGCCATGTCTACAAAGAAGGTCCCAAAACGAGGGGCAGGGGGTGGGGTCCCAGGAGCCCCCAGTAGAGGGACTATTGGAGACCAGACAAGGGGTTCAGCTGGTCACAGGTGAAAAATCAACCATCACGGTAACCCCAAACTGGAGGGGAGCCGGGTGGTGGGTGGATGCGGTCGGTGCGAGGTCCTCACCTTGAACCCGATGCCGCCCTTCTTACAACACAGGCAGGCCAGCATGAGGATGACGACAGTGAAGATTCCAGAGAAGGACACGGCTACCACCGCGAGGGACGAGGACCAGGACAGCTCACTGAGCGGGGCACCGTCTGCAAGGAAGCAGAGCACAAATGTCTCATCCCAGCCTCGGCATGTGACCCCTCGCTCTGGTCCCCCACCTGGATGTGGCCTCAAGCCAACGGCCAGGGCTAGTGAAGCGGCCAGTATGGGCCCAGCTCCTCCCAAGGTCCATGGACAGCTCTCTGTGATATCAGGGTCACTGTTGTATCAGGCTCACTACTGAGGCTAGAGGAATGGCTTGGTAGCTCAGAGTGCTGGCTGCTCTTCCAGAGGACTTGGGGTCAATTTCCAGCACCCACACAGCAGCTCCCAACCACCCTAACTCCAGCCCCAAGGGATCCGCTGCCTCTGTGGCCTCCGCTGGCACCGGGCACACATACAGTACACAGAAAACAGACATGCATTCAGGCCAAAGCATTCACGCACATAAAATTTTTATTTAAGAAAAAGAAAAAATCCACAGTGGTGACTCCATCTCTGCTCACGGGACTCAGCTCACTTTGGGGCTGGAAGGCCACTGAAGGCCCTGGCTGCCAAGGGACAGAGACCCTCTGGCACTGCGGAGCTACCCTGTCTCTGCCTGGCAGCAAAGTGCCCCCTATTCCAACCCTGGTTTGTCCCCCAAGTCCCTGGGGGCTGCTTCTGGCCTGGGGAGAGCAGGAACTTTCACCTTCTTCGCCCCTGATATAAATGAGCCCCCACATCTCAGACGGGAAACCAAAGTGCTCAGGACAGCAGAACACACCCCAGTGTCTCACACTGAGCTTCCAAACTGAGGTTCGTTAGCAGACTGGGGGTGGGGGGAGCCAGCTCTGGTGTCTCCAGATGGCTTCTGGGGCCAGCCCAGCGTGTCCACTGGATGGGAAGGAATGAGCTTGGGGATTGCTCTGCCTTCCAGGCCTGCCCTTCCTCAGCACGCAGGCTCTGAGTCATCCTATCCATGGGTCCTCATTGAACTCCTGGCAATGTGGAGCACCCCAGCTCCCCCAGGTGCTGAGTCCGTGCAGCCTTTGTCACCGAGGCAGCTGTACCACACACTTGGGAATTCCTAACTCGGCATGGATGAGGCCCCAGGGCTGCTGGCTAACGAACATCTGGAGGGCTGCCTGGAGGAAGGGTGAACCTGAGGGCCAAGAGGAGCACAGATATAGCTTGGGGTTCCTGCTCGGGTGCCTGTGAACACTTCCCATCTCACACCTAGAGACGAGAGGGTCCTTGTGAGCCAGAGCAATGGTGGCCAGCGTTCATGGTGACACCATAGCAGAGTAAACCGCTAGAAGCTAAAAATCCATAGGAGGCATTCACACTCCTGAGCCAATGCCCTTCCAGCAGCCTTGTCAGGCAGGGTTTCCAGGCATGCCTGCGTGTGTCTGCCGTTTTACACGTCTGTCCTGCATGTATATATGTGACCATCCTCACACCGTGCAGCTGGTACTGTGTGCTCACACCTGAATGCTCCACGAGTGTAAGTACTAATTCTACCACAGGGTGGACACCTGAGTGAGCATGTCGCATGCCCTCCTGCACCTCCAGGAAGCGGCGAGCCCCTGCGGACTCTGCCGTTGCCATGGTGAGCCCTTTCTCCTTTCTCCATCTGGTGCTGCTATGGCATCAGAGCTCACCCCTCCCACACCCACTGCTCCCTGCATTCACAGACCCACTTGACGGCCCTGAGGCCTGGGGCTGGCATCTGGCGCATCAGCCCATCCCTTGCTTACTCCCTGGGCTGCATGGGCACGTACCAGGTAAAGGTCACCTTGGGAAGGGCCAAGCTCAACATCCACAAGCCCTCGCCCCGGCCGCCCATCAAGGCCACTGGGCTTTCTGTGGCTTTCTTCTGACCTTCAGCAGGCCCTGGCCACAGAGGGTTGTGGCGAGTTGCTGGCTGGTAAGTGGGCCTGTGTGGGAAGCACAGAGGTTCTTGTGCTCACAGATAAGCCATAGGGGAACTAGGAATGTTAACACATAGGGTTGTTCCTTCAAAGGAAGAGATGCAGAGCCAGCCCCACAGCTAGCACCCAATGTGGGGCTCAACTATTGGAGAAGGTAAGAAATTTCAACAAAAGTAGGGAGTTAGGAAGTGAGTCCACTCACCCCAGGAGCTAGGACAGGAAGAGGTGAGATAACAATGTGGGTTCTTCTCCGTCCTGAGACAATGCATCTTATACAATGTCTGTGAAGATCCAGAGGAGCAAAATATTCAGAGCAAAAGCTCTGCACCTTTATGCAAGTGGCTAAAAGTTAACCCTCCGTTTCCTGAACAAGGAACCTCTGATGTTGAAAACTGGAAACATATAGGCGCCAATGTAAAAAGAACACATGGGAGGGGGTTGGGGAATCCCAGTCAATTACCTTGCAAACTGAATCTCAGTAATGCAGGACCATAAAAAAATAATAAATTCTCTGTGGGACACATCTTGTTAGGTCTTGGCAGGCGGGAGCTCAGAGCTCATGAGGAGTCACTGATCTAACTTGGGTGATGTGTATCAGACTCTGCCTGTTCTGACCAGAGAGACAGAAACAGGTCTTCAAACGCCAGACTCCACTGTTTATCAGATGGACTCAGGAAGAATCAGAGACGAGCAGTTGTGACGGGGCTCTGGAGCCCCGGTTTGCACATCCTCACCCAAAGTGGGTATGGTGAAGGAAGACTGAGGCTCGACACCAACGACTCCCTGTATAAATTAGCACATGAGGGTAGAGAAGCTCTGAGAATGGGGACCAGCCTAATGTGAGAGACGAGGAACTTTGCAGAAGGGTTCTGGATGTAGGGAGGGTGTGATGGAAGGATGGAGATGTCTGGGGTGAGGGCCTCAGATGGAGTGAGGCACTTAAGAGTGCAGTCTGGTGAGCAGAAAGCAGAAAGAGCGGGGAGTGAGTAGCTCGGAAACAGAAAACAGAAGAGGGTTGGCTTCTCTGTAAATGAATCCTGCCCTACAACTGAGTTTGTCTGACTTTGAGGTTTTCACCTAAAATTATTATTTTGGGTATAGCCTGAGAATCTATTACATCAGACTGTCTGAGAAATGTGTTAAACTAGAACCTTCCAGCAAGTTCTTGCTCCATGGAACTATCACTCTCGTGGTGTTCACGTTTTCTTGTGTTGTTTACAGCATCAGCTGGTGTGAACTTTCAGTGACTGCTTCTCAGGTATTTCTGAGTACCCTGTCAGTCACCCAGTGCGGGGAGTCCTTCTCAACCTCAGAATTAAAATCTCCCTGAATTTTAAAGATCCCAAACCTTACATAAACAGCCTTAAGTTTAAATCTTTAGAAGTTAATGACCATTGTTAATTAAGTAGGTTTGGTTTGCTCTTCAGTATTGTACTTGCCTTTCTCTGACATAAATGATTAGACTCTGGCAATGGCAGGAGTCAGAGGAGGCTCACAAGAGCCTGCTTTCTATGGGAGGCTTATATTACACAATATTCCAAGCTTCTAGTGCATAATTAGTCATGGGTGGTTCTCACATCAGCTTGATATCTGGAACGAGGGCTGTCTGTGACTGAGGCCTTCTTTGTGGTCAGGTGTGGAGAGATGTGTGTTCTACAAGTGTGCACAGTACCTGTCCCTAACTTGTCAGCCGAAGAGCAGGGTCCCGGGCATGGCATGGAGCTCTGTGGGCTCACCGAAAATACCATTGTCAAATAGCACCTTGTGCATTTCCTTTCTAGGGCTCCCAATACAACTAAAAGCTGATAATGGTCCTACTTATATGAGCAAACCACTTGAGGAATTTTGCAATTTCTGGAATAATAATTATATGTCCTTGCTGTCACTAAAATCCCTGACAGCCCACAGGACTGGGTCAAGCCATTGTGGAATGACACTATCAAACACTTAAACAGCAAATTTTAAAGATTAATAAGGGGAAAGGGTGAGAGGAGAGGAGGGAGGGCGGCTGTGATGGGGATGTAAAGTGAATAAATAAATAGGTTAGTGAAAAAATATAAAAATAAAGAGGGGTCTATACACCGACCTAAGTTCCCACCTGCTGTGCTACACTCAGCCAAGCTAACTTTAAACTTTTCTCCCCTAAAGAACGCTTCTTCTATTGCCCCAAGGCATTTTGCCCTAAAGAGACAGAGCCTAACGTGTATGTTAATGGAAAGATCTAGAAACCAATCGATGGAAAGGGTCTGATGCTCTTCTAACGTCATGGTGAGGCTACACTTATGTGTTTCCAAATATAAACGCAGTCCCAGATGGCACCCACTCTGATGCATCTGACCAGGACAGCATCCTGAAGACAGCCAGATAAAGGAAGTATCCGACGACAACAAACCCATCAAGAGGAGATGTCCCAGGAGGAGGAATAAGCCAGTGCCTTAGGGAGGCAGCAAGGACACAATATCAGTGACCTAAAAATGACGCTGTTACATTATCTGAGCTCACGTTAGCTCTCAGCTTGTCAATGCAGAATCCAAAAGCTTTTTGTCATGAGGAATAAGAGGCACAGCCATGGTAGCACACAGTGTGACATTTTGACAGTGTGACGTTTTGTGACGCTGTTTTGCCAAGCTAGAGAATGTTTTTAGTCTCTTTTTATTACCAGTCACAAGAGTGACTACTAGAATACAAAGAGAGGTTTCAGATAGGGCCTGTATGATTAGTAAAATCACAGCAATTATTGGTAATTAATAAGTAATAGTTCATTAATTACTAATTATTAATATTCACTAATTACTAATACTAGCAAAATATCAGTAATTAGTAATATTACAGCAAAAACATTAGCAAAAGTTAGTCAAGAGATGAGAGGCTTAAGAACCTCATTTCTGCAAGACAGAGCTACTGTAGACTATGTGTTGTTCAAGCACGGTGTGGTGATCAACAACCTCCCAACCTGTGCTGCTAACCGTGTCAGGTTTCTCTCATCAATAAAAAGATAAGGTCTCTCAGGTGACTTCTGAGTGGCCATCGTGGTGAAGCTGGCTTTCCCTTGGTCCTCTGTAGGCTATTCTGATAACTCTGTTATGGTTGCCTGTATTGGTTCAACTGGCCATGCAGGCAGTGCGTTCAGCCTTGGCCTCTATTACAACCACAATTTTCTCTTTAAGAACTGAAAAGGAGAGAAGCGTGGGAGGCGTGGAGGTTCTGTGCTCACAGAGAAGCACTAGAGGAGCCAGGGATGTTGAACACACAGTCTTGTTCCTTCAAAGAAGCGGGTGCTTAACCTGTTAACCTCCCAGAAAGCTGGGAGCAGACATGGTGAATAGCCTAGTGCCCTTTGTACTGTGTGGCAGAGACTACACTGCAGCCTCCCCCAGACTCTTGCCATAAGCTTGTCAATCGATAGAGCCTGTCTTTATGGAAGGTGTCATGTGTAGTCAAACTATAGACCCCATCTTTATGGGAGATGTCACATGGAGTATATAAAGAAGTTCAATGAAGTCAAACCTTTAGCTATATTGTGCACATGGCTTGAGTTATTACCAGAAAAATATTTCACCAAATTGTGCTGTGCTTAAATAGGCCTATAATCAACTATTTGGCATCAGACTCCAGAACTTTGAACCAACATCAGATGCTTATTCATCTTGAACTGAACTACCTTCTTGCCTCCTGCAGATCCTGCCTCTGCTGGCCGTAGCCGTCACAGAGACCCAACAGGCCTGTCTGTTATTCAGTGCCCAAGTCCCTGATGGGGGATGGGCAGGAAGAGACAGCCAACTGGAATGGCCAGAACCACACAGCCAGGAATGCTCTTAAACTCTCAAATCTGCATGTGTACCTGGGTTTCTGAAGCCCACCTGCACCAGGGGAGCCCCAGGGACCCTCCTCCCAGACTGACTAAAGCCAACCACAACCCGCAAACACAGAAGTTATCCAAACTGGCTCCATCCTGGGTCCCAACTAAGTGCCACTGAGGCCTAGGAACCATAGAGATCATGCAAAGTGATTGGTTAAAGAAAGGAAAGGCAGATGGTTCGGGAGAGATGGCTCAGCAGTTAAGAACACTAACTGCTCTTTCAGAGGTCCTGAGCTCAATTCCCAGCAACCACATGGTGGCTCACAACCATCTGTGATGGGATCCGATGCCCTCTTCTGGTTAGTCTGAAGACAGCTACACTGTATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATATGAATATGAAAGAGAGAGAGAGGAAGAAAGGAAGGAAGGAAGGAAAGAAAAGAAAAGAAAAGAAAAGAAAAGGGAAAGGGAAAGGGAAAGGGAAAGGGAAAGGGAAAGGGAAAGGGAAAAGGAAAAGGAAAAGGAAAAGGAAAAGGAAAAGGAAAAAGGAAAAGGAAAAGCTAGGCCAGGCAATGGTGGCGCACGCCTTTAATTCCAGAGCTCGAGAGACAGAGGCAGGCAGATCTACAGCCTGGTCTTAACTCTGTCTCAAAAAACCAAAATAAATAAATAAATGGAAAGGGAAGGGAGAGCTAGATGCATGAGAGGACCGTGCAGCACCTCAAGTATGATTCGGGGTTGGCCCGGCCCCCAGACATTCCCTGGCACTAACACCAAGAGAGCTAGGCCCAACATCTTTAGCTGACATGGGTAGAGATGGGGATGGAAAAGCCATGGCCCTTGGCCTGGGACCAAGGCTCTGTAGGAAAGGGTAGAGGTGAAAGGCAGGTGATGCTGTGCTGTGGTTCACACAAGTCACAACACTGAGTACCAGGCACCATCCTGTCTCTGGACACTGAGAGCGACAGGGCCTCGGTTTGGGTTGGAAGCATCACTGTATAAGCAGGCCTTACAAATCTAAGTCTCTGTAGTGGGCGGCCTGCAATTCCACCCGGGCTCAGGAGCACAGACAGAAAACCACGCCCAGCTAGGGCATGCTGACAGGACGGCCCTGCCCACCATCAAGCTGACCGCCCATTCTAAACCGTCACACTGAATAAAACAGAAAGTGTGTGCATGCCTTCGCGGTTCTCCCTGTGTCTTAGGAAGCGCTTTAAACATTAACCACACTGAGGCCTTGGCTCCGCTGAGGTCATTAGTGCCTCCTACCCAGTCCTATGCTAGTTGTTGCCCTGAGAGGCCCAGTTCACAGGCGCCCCCACCCTGGCCGTCCATCTCCCACACTCCCTCGCAGGACTTGGCTGGGGGATGTGGTCAGGAATCATTACACAAAGCCACATTTGCATAGGAGTGGGACCTTACCATGGGGTGGGTGTCCAAAAACACTTTCGTTAAGATTTCTGTCATCAGTCTTGTCTGCAAGCACCCAGATCCACTACAAGCTCCAAACTCCACATCACTCAGCTCCCGGGAGCAGCCATGTTGGTGCCACTCCTGTACTGCTGAGGCCTGTCTGATGGGAGCTGGGCGATCCCCTCCACTGTGCGGTGTCAGCCAGCCCTCTCCTCTCTATTCTTTTTTTTTTTTTAAAGATTTATTTATTTTATGTACACTGTCGCTGTCTTCAAACACACCAGAAGATGGCATCAGATCCCATTACAGAGGGCTGTGAGCCACCATGTGGTTGCTGGGAATTGAACTCAGGACCTCTAGAAGAGCAGTTAGCGCTCTTAACTGTTGAGCCATCTCTCCAGCCCCCTCTCCTCTCTATTCTTATTGCTGTTGATTGGTTGGCTTTGTTTTCCCAAAGACAACGTTTCTCTATGTAGCTTTTGCTGTCCTGGAACCCACTCTGTAGACCAGGCTGGCCTCGAACTCAGAGATCGCCTGCCTCTCTGCCTCTGCCTCCCGAGTGTTGGGATCAAAGATGTGTGCCACCTGCCCAGGATCTCTTAGCTACTCATGTTACCCCCAACCCCCAGATGCTGAGATTTTCCAGAAATTGAACCGTGTTTGGGTAGTGACTGCCTTTGTGTCTCAGGAGGCCCAGGTTTGGTGGGAGTGTACTTGCGGTTGTCAGAGTGACCCCAAGGCTGCCCACTTGCTTCTCCCTCTGGCCTGCAGCTGTGTCACCTGCTTAGCCTGGCCAAGGAGACTTTGCAGATATTGGTAGATCTTCCCATAGCTCCATGGGTGGTGGCCCTTTGACCCTTTGCTGTCAACCAATGGGATTGACCTTAACCTTTTGACCCCAGTTGTCAGGGAAGCCATTGAAAATAAACATGTGGCCCTTCTCAGGGGAGGGAAGCCTCAGAGGTGAGCACATTCCTCAGATCCTCTTTGCCTCCCAGGTGACACAGGACAGGCCACATGGGGAGGAGAAGGTACCCATAAACAGGCAGACCAACCTTGGCAGCAGGGCAGGTATACCAGGCCCTGATTGGACTAGAGCTCCCAGCAACACTCACAGTGTGACGGGTCAGGCTGGCCGGCAGCCAGTGCTGATGTGAGCATGGTTCGGGCCTCTCCCACCCCCTTCCCTTCTGTTTGAATGCTAGGCAGACACTCTGTTGCTGCCTGGAAGGTTCTGGACAGAAGTGTGCCTCTCAGGTCACATGCTTATTAGCTGGGCCGGACACACCCCTCAAGCCCTCAGGCTCATTCTGCACTCGGCCACTGTCTGGAAACACGGGGCCAGCTGAGGCACAAGAGGAATTAAGGACGGAGGCTGGGGGAAAAGGACGGGCAGGCACCTGCAGTGCAGTCAGAAACCCCCAAAAGTGAACGTGGCTTTGATCTGGTCCTGGCTGTACAGCTCTACCCAACATGGTCCTGTTCCAACCTGTGAGTCCCTGTCCAAACCCACATCTCCACGTTTTGACTAGCCTAGAGTCCAGAAAATCAGGGGGCCAACAGGCCACCCAGGTCTCTTCATAGCACATACCCAATTTAGGTCACCGCAGATGACCCACTTCTGCCACCAGATGGCGATCCCTGGGCATTTTACAGTAATTGCTGAGTGGGGTCCAGAGACTCCCAACTCCTTGGCAAGGGTGTGGAGGAACCAGAAGGCCACCTCAGGCTGGGCGCAACCCCAGCAGCTAATACATGGGCACACCAGGGAGGTGGCCTGCTGGAGGGCAAAGGTCGAGGTGTAGTCGTTCCCCCAGCATCCTCACAACCAGCCTAGGCTGCTGGGAGGTGACTCTGTTCTGGGTCCCAGTCGTGCCAGGCTTCAGACCACCTGTGTGGTCACCTGCTCTATGTAACCTTTCTGTCAGACCTGATGTCTCCAGGATCCCCCATTCTATGGCCCTGTCACAAAACTTCCTGGACCTGGCTCCCAGACACTGCCTTCAAACAAGAAGGAAAGCCAGAGACCCCACAGAGTGGCAGCTGGCTCCCAGAACGCAGTTCCTTCTCTGATAGGCTCCTCTGAGGCCCTGGGGAGAGGCAGTGCTCCCAGACCTGCACGAGGCCAGGGTTTGCTGGCTGGTGCTAGTTGCTCCGTCAGCCCAGTGACACCATTCATGGCTCCAGGGGACGGTGTTTAGGATACACTTTAACTATAGGAAACTTTGTCCCCTTCAAGAAGCCTCCTGTGCCTCAGGGCCCCTGGCCACTGTGGTTGTCTCTTTCCATCTGTTCCACGGTCCCCTCAAGAAAAGTATACAGAAGGCTGTTTGGGGGCTGGAGAGATGGCTCAGCAATTGAGAGCACTGTCTGCTCTTCCAGAGGTCCTGAGTTCAATTCCCAGCAACCACATTGTGGCTCACAGCCATCTGTATTTTCTGATGCCCTCTTCTGGTGTGTCTGAAGACAGCTACAGTGTACTCATATACATCAAATAAATAATTCTTTTTAAACAAAACAAAACAAAAAAACCTAAAGGCTGTTTGGCTGCTGGATTCTCCACATCTTTTCTTTTCTTTTTTTTTTTTTTTTTAAGATTTATTTATTTATTATATGTAAGTACACTATAGCTGTCTTCAGACACTCCAGAAGAGGGAGTCAGGTCTCATTACGGATGGTTGTGAGCCACCATGTGGTTGCTGGGATTTGAACTCCGGACCTTTGGAAGAGCAGTCGGGTGCTCTTACCCACTGAGCCATCTCGCCAGCCCTCTCCACATCTTTTCATAGGTGACAGAGAGGTCCCTGGTCAGAGGGCAGATGGATACCCACCTGCCTTCTACAGGATGGGATAAGTCAACTCCATCAAGTGTGATTCTACCCGGAGTCCACCAGCCAGGAAACTGCCAAGCTGGAAAGGGTAGGTAGGTGGGACCAAGGTTGGTTGCTGGGGCCCAAAATACATAGGGTCAGCTACTTCCCACCATAGGGACTTAAGCTCGGCCTTCCTGTCCTGAGGGGAGGACCTCTTATTACCAGAGCTGCCCTCCCCCCACCCCCGCCTTCCTCTGAGCAATGAAAACATGTCACCCTTCAACATGTCATCCTTCAACATCACCTGGGCCTGACCTGTACCTCAGTCTCCCACACTGAAAGCCCTATTGCCTTACCTGAGGCCAAGGCTTCTGTTGGTCCCCCTGGGCCCTGGAGCAACTCTGCTGAGGGAGCCTCACCCTCACCCTCCTCTCTTCAGTGAAGCCCCAAGCAGTGAGGGAAGGGGCTTGACTTAGAGCCTAAACCAGGAGCCCCCCAGAAAACAAGGGGCTGTGCACGGAGTGACTTCCTCCAGGGCTCTGTGACCTCTGTCTCCTCAGTACTGCGTGAAGGATTAGCAGATATGCACGGGCCAGCTGCTTAGAGTTGGGGACCTGGCTACCCATCCACCGTCTGTGAACTTTGCCTGTTTATACTGAGCTCCTGGCACAAGCAGCCTCACAGATGTTTATAACATGCCGATGACAGGAATACAGAGCTGAAGAATCCGGCCACCCACCCAGACAC
D5_D3 119829639 119829731 93 CTTGAACTCACAGAGATTCTCCTACCTCTGCCTCCCAAGCGCTGCAATTAAAGGCGTGAGCCACCATGCCCAGTTAGTTTTCCCAGTTCTAAG
G5 119836321 119836370 50 CACACATACAGTACACAGAAAACAGACATGCATTCAGGCCAAAGCATTCA
U5 119831705 119831754 50 CCTGTGAGACAGGCAGAGTGAAGTCAGAGGAGAAGAAGGGTCAGCGTGGG
U3 119831600 119831649 50 CCTACCCCTGCCACAGGCTGGCATTCAAACCCCCACCACAGCAAAGCCGC
D5 119829732 119829781 50 AATGATAAAGTTCCCTGCAGAGTGGCTATTTTTAGATGAACCCAGTTCAT
D3 119829589 119829638 50 TGCTACATAGTCCTGGCTATTCTGGAGTTCATTAGGTAGACCTAGCAGGA
G3 119824676 119824725 50 TTCTGAGATCAGTGGAACGGAGGTCAGCGGGAAACATTTGGAATGACTTG
G5_U5 119831705 119836370 4666 CCTGTGAGACAGGCAGAGTGAAGTCAGAGGAGAAGAAGGGTCAGCGTGGGCAGAGGAAAGGGCCAGGGCTCACTGCACCCACTCATGCCCCCTCGGATTCTCTGAATTCTGCTCCCACGCTGATAGCCCAGAAGGCCGGGGTCAGGGCTGCTGGGACGCCCAAGGGAAGATGGCAGCCCTCGGGGACTAAGTCTGCTTGGTGCCCAGCTCATGGAAGAGTCTCACCGGGCACTGTGCCCCCAAGACTTACACCCTGAACCTAATCTGTCTAAATGCCTGGTGGAAACCCTGGGGTCTCTAGGACCTCAGTTGTCCCAGAGTGGGTTCAGGGTCCTGACAGTAGAACCCAGGGCAAGCACAGGGGGCAGGAGAGTGCTTGTATGTTAGGAGCTAGAGGTAGAGGAGGCGGCTTAGGTGGGCTGACCCATCTCACACAAATTTCTCCCTCCTTGAAAGAAGATGCACCCCCCCCCCAAAAAACCCAAAAAACAACAGAGCTGAGCAGTGCAAAAAGCACCTTTGCCCTCTCCTGGGTCCCTGTCCCACTGTCCTTGGCCATAGATAGCCAAGCCTGCCTCCTAGGAGGTGCTAAGGACACCTGCAGGCCTTTGAGCCAGTGGGTAAACGTGTCCATGTCTGGATCCTGCCTGACTTTTGAGCTCACTCCCTTGAGACTCGATGGGCCACAGAGCCATGCATTCAGGGTTGGGTCAGGCTGGTGGCGACCAGGGCAGCATTTATCTAAGTCTCTATTGGCTCAAACAGGTACTTTGATGCAGGCTGGGCCCTGGATGGGAAGCATTGTGTTGAGAGCCTGGGAGGGCTGGCCCAAGGTTAAGAGCGGCCTGCTTTTCACCACAGGGATGGGGCCAACCGCACTCTCCACTTGAAACCTTCCGCGGTGTCCTTGGCGCCATCAGATGGACAAGAGACAGCCCTGAGCTGAAACTTCCAGGCTGTAAAGGCCTGAGAGCTGACTGTTGTAGAGGTAGTCATAGTCCCAGGCACCAAGGTGACCAGGGCAGCATTTACCCGTCACCTCTAAAGAGGAGGGGGGTGGTGGTGGTGCAGGGAGAGGCTCTGGAAGGAAGGCAAATGGGAGAGGCAGACAGGGCAAGGAAGCTATGGGAAGAGGCCCTGCCTACACCTGGGTTGGGGGTAAGGGGGTGGGCATTGATGCTTCTCTTGTTCCCTATGCTGTGTGGGTAGCCTGTTTGGTAGGGACAACGGGGCCACATTCCTACAGGTACAAAGGAGCAGGAGTCTGGGAAGAACAGAGGTAGATGGATAATCCAGAGTGCTGAGCCACCTGCCCCAGTTACCTCATGGCAGCCCCTGGGGTGGAGGAGCGACAGACAAGGCTACTCTCAAGCCTGGGTCCCAGAGGGGCTCCACGCACCTCCCAACACAGCTCAGCCTGAGATGCGGCCAGGAGACCTCGGCTTCCCAGTGCCCATGCCCCAAGCGACCCCACACCACTCACCGGAGCGACCCGGCTGCTTGGCCATGGGTAAGGAGACCTCGGTGAGGGGCAGGACATACACATCGGGGCCGGTCTGTGCAGCTGCAGCCGGGGAGCCCTGCTCCGAGAAGTCGGCCACATACTCGTCCCCTTCAGCATTCTCAAACTCCTGTGGGTCGGGCCGGCACGGGTGGGTGAGCAGGACACAGGCTAATGGAGGCAGGCTAGGAGAGGCCCCTTTACCCCCAAACTCAACCTGACTTACACAGGCCTACAGCATGGGCCCCTGCCACATGGCCATTCCCCACCTGTTCACCGGCCCCAATTCCTCAGGGACACCATCTCAGCAGAGGTCAAAGGCCTCAGGCCCAGGTGGGGCTGGGAACCCAAGGCTGAGTCCTGCTTGGAGAAGGGCTAAAGAGTTCAAAGGGACAGAGGCAGAGTAGCCCCTCATAGGCCCTGTCAGTGGTCTCCTCCCTGCCCCCACCCCCTGCCACCCCATGGCTTAGAGCAGATTTACAGGCAGGGGCTCACTGCACATCTCGGGGAAGGTAATTCGGTTCCTCTTCCCTAGCTGGGCAGGGAGCAAGGAACCCAGGGACTTGTTCTTCATCCACACCTCCACTGCCTGCCTGCATGCCGTGGGGTACCCTCAGCCCTGCACCCCCCCCCCCCAGTGCACCCTAAGAGCTTGCTCCTGCATCCCTGGAGATCACTCTGGGGACAGGCTGCTAACTCTGAAGACTATCAGCCTAGGAGAGACCACCCGACCCCCACCCCACCCCATCTAGATCACATTCCAAGCAGCATTAGTCTGGGGTAGGCCACAGCCATAAACAAGGACAGGGTTTCTCGTGGAAGAACACTTGCCCTAGAACCACAAACAAACACATCAAAACCAAAACAGGAACAGAGCAGAAACCAGGCCAGCTTGTCCTCAGCACCGGGCAAATCTCCCTGCCACATCTCCCACCCAGGTGAAAACTGGGCTCTGAGGACTGGGCATAAACCCGGAGCTTGGCTGCCCGCTCCGGGCCACGTTCCTGCGGACAAACGGCTAAACATACCCTGGGGACCTTTTTCTAGGTCATCTGTCTTTCTGTAAAGGGGGTGGCCCTACATTCCTAGTGGTTAGCCCAGCTCTGCATTCTGAGAGCAGAGCCTCTAACACCTGTGGCAACTCTTCCTCCCCGGAGCCTAAAAGACCACATTAGAACGTCCTCTAGCCCCACACGCTGGGGCCTGCGATGCCCGCTTCCCCCTTTGTAGTATGAATTAGTTCTGGCTTCAACCATTACCTTCCCTTGCCAGAGAGCCAGCCGGGTTCCCCCAGCACAGCGGGCGATCAGGTAGCACAGGGTTAGCATCCAGCCCCTGCCCAGAACAGCCCCGGTGGGGAGCTCGCTGTGGAAGCAGGAGGCAGTGACCCTCCAACCAAAGCACACTGGTGCTGGAATGTTCTGGGCACCATGTTCCCAAGGAGGTGAGAAGGGCGAGGGTGGGAGGGACTGCTGTCAGTCCTTGTGTGGGGCCTTGTTCTCAGCGCCTGAGGAGGGGCTTGCTACACAATGGCTGCCTAAGCTGTGCCCTAGCTTCCCACCCCCACGTCTCTGACCTGAGGTTCTGCCCTCAGGGTCCTCCAGGATGCAACTCTCCTTTGATTGTCCAGCCCATTGTGCGCTGACAATCAGGAGGTCGGGAGATTGTCCCCTGGGGTGGGGGCACCAGGGAGGGGGGCACACTGCACTGCTGTTAAGGAACTAAACACCCAAGTTTGGCTGGGGTCTGTGCTACCAGGTACTGGGACTCTGCAAAAGGGTAATAGCATTTGGTGCAGGTTACCCAGTAGGAGGTACCCCTAAGATACAGGCTGGCTCTGTGCTGGACCACAAGCCCTGTTCCCACCCTGACCTCCTACCCAGCCTGCAACCCCACGTGGGTGCGGGAATGTCCAGGGCTCTGGCCAGGCCTCAATATGCTGACAGACAAGGCTGCAGCCCCCGCAGCTCCCGGTGGCGCTTCCTGGGGGTGGGTAGCTCTGTGCTTTCTGCCCTGCATTCTTGTTTGGAACCACAGTGTGACAGCAGGGTGGCCACTGGGTTGGAAAGATGCAGGGCCTCCATCACTGGAGTGAAGGCCTCAGCTGTGGGGTCTAGCCTCCTAGGGAGACTGTACTAGGGAGAGTGTAGTGAAGGCCCCAGGGCCCTCAGTGGACATTCCAGAAATAGGATGGCCCTTGTCTCGGGAATCTGATGGATGTCCTCTGAGCAAAACATGCCCAGCTAGGAGCTCCCCAGTGATGTCGCTGCCGGGGACATGTGTCTTGGGGCTTCACTTTCCCTCTGACTCAGTGAGCACAGATGTAAGGACCTCTGTGGGGGTCCCCTTCACTGAGAGTCGGAATGTTCTCGAGAGCCCCTAAATGCTCCTTATGGTCATTTCGGCTTCTCTGGACATGGACAGGCCTGACCTGGCGCTGGAAAGGGTCAGGCCATGTCTACAAAGAAGGTCCCAAAACGAGGGGCAGGGGGTGGGGTCCCAGGAGCCCCCAGTAGAGGGACTATTGGAGACCAGACAAGGGGTTCAGCTGGTCACAGGTGAAAAATCAACCATCACGGTAACCCCAAACTGGAGGGGAGCCGGGTGGTGGGTGGATGCGGTCGGTGCGAGGTCCTCACCTTGAACCCGATGCCGCCCTTCTTACAACACAGGCAGGCCAGCATGAGGATGACGACAGTGAAGATTCCAGAGAAGGACACGGCTACCACCGCGAGGGACGAGGACCAGGACAGCTCACTGAGCGGGGCACCGTCTGCAAGGAAGCAGAGCACAAATGTCTCATCCCAGCCTCGGCATGTGACCCCTCGCTCTGGTCCCCCACCTGGATGTGGCCTCAAGCCAACGGCCAGGGCTAGTGAAGCGGCCAGTATGGGCCCAGCTCCTCCCAAGGTCCATGGACAGCTCTCTGTGATATCAGGGTCACTGTTGTATCAGGCTCACTACTGAGGCTAGAGGAATGGCTTGGTAGCTCAGAGTGCTGGCTGCTCTTCCAGAGGACTTGGGGTCAATTTCCAGCACCCACACAGCAGCTCCCAACCACCCTAACTCCAGCCCCAAGGGATCCGCTGCCTCTGTGGCCTCCGCTGGCACCGGGCACACATACAGTACACAGAAAACAGACATGCATTCAGGCCAAAGCATTCA
U3_D5 119829732 119831649 1918 AATGATAAAGTTCCCTGCAGAGTGGCTATTTTTAGATGAACCCAGTTCATGAGGCCCACAACGTGGGATCACCGTGACTTTTCTGCACAGGGTCGTGTGATGGTGAGGGTTAAGGCCCTGGGGGAGTGGGGCTTTGTAGCTGTAGCCTGGCTAGTCTCGCTAGCCCTCACCTGTGTACATAGTTGTGTCGATGTAGATGCAAGACGCCACACGCCACCTCGCACGCCATGCGCTGCAAGGTAAGTGGGTCAGGCGCCATGGACTCTGTCACCCGGCAGCTCCGTAGATAACCTTTGAGGTCCCCCTGATGGACGAGAGAGCACACAGTCACCTGCTAGCTGCAGCGACCAGCCCATCACAAGTCTGCCACCCACACCAAGAGAACCTGGGTCTGGTGGCCTGTGGATCAGCTGTGAACCCTAGTGTTCACTGCTGTTTCAGCAAAGCCTGTGTCTCAATTCTGGCACAGTGACCTCCATATAAGCAGCCACCAGAGCTGTGCATGTAAAGGGCCCAAGGGGCAACACGAAGACCCAGAACTCAGGCTCTGCCCCAGGAGCTTCGGGAGCCCTGTGGCTGTCCCAGGACACCTCTCGCTGAACTATCCAAGACCCCACAGTGTTGCCCCTGCTGCTGCTGGCTCACTTTCTCTCCGCAGACCTCCTCTGAGGGAGAGCAAGGACTACCAGGACTCTACTTTAGAAATAACAAAAGACCCCAAGAGGCTGAGCAAGAGAGGAGCCACTCCCCTTTGGAACAATGAGCTACAGAACAGGACCGGGAGAGACAGAGCTACCTCCCCGAGAGGACCACTTACCAGTGGACAGAACTCCATAACCAGCAGGTAGGGGGTCACTTCAGCACACTGGGCCAGGCACTGGAGCAGGTTGCTGTGCTGCAGGGCCCTGGAAGAGTCCACGGGTGTTTAAGTTGGAGGGCAGGAGAGGGTGTCCCATAGCCCTCAGTTTCTCCCACTGTGCTGCTCCCCTGCCCGGCCCCACCCCGCCCCCGCCACACCACCCACCTGTAGGGCTGCGCCTCCTCCAGGAACTGCATCTGCTCCTGCACGCTGGCGCTCACCTTCAGCTCCTTCACCACCACCTGCGTGCCACTGACGCCCGAGTGTACCTCCCCCAAAAACACCTGCCAAATGTGACAGGCATCACCAGGTCCCCTTTCAGTCTCCATAGGAAAAGCCATCTAGCGCCCAGGGCCTCAGATGGTCATACAACTTCTCACCAAGCTCTGGCTAGAACCCTCAGCCCCAGTCCACCCACAAGGCTCCTACTTTTCTCACTGCCTGGGGACTACAATGAGGAAAAAGGAATCAGGTACATGGTCCAGTCTGGGGCGGGTGTTAGAAAGAGCCCCTCCCTAGGGGATCCCCAGGAGTAGTGGGTCCACCCTTTGCCATTCCTGCCACCCCGGGGCATGCTTACCTTCCCAAACCAGCCGTGGCCAATCTCCTTTAAGTACAGGAGGCTGTGCCGGCCCAGGTCCGTGGACTTGAGAAGTTGCACTAGAGTGGAACAGAAATCCAGACACAGCTTAGCCACCGCTCCCTCTCCATCTTCCCGACCACGCTCTCCAGAGCCCAGAGAGCTTTCCCAAGCTCCCCAGCCAAAGAAGCTTCAATAAAGTGGAGGCCAGGTTTGAGCGCTGTCATCGAGGGCCAGTGTCTCTTAGGCTCTGGGGTGGCTGCTGTCAGCAGAGCTATGGACCTCAAGTCTCCATCCAGGCAAAGCCTGGGGATGCCCAGAGCAGAGCCACAGGGAGAAGCCAAGCCCAAACAGCAGGGCCTGGAAAGGCGTTTGGATGAGGCAGGAAGCTGGTGCCGAGGCCTGGGAGGACAGCAGAGCAACCAACCCCCTACCCCTGCCACAGGCTGGCATTCAAACCCCCACCACAGCAAAGCCGC
D3_G3 119824676 119829638 4963 TTCTGAGATCAGTGGAACGGAGGTCAGCGGGAAACATTTGGAATGACTTGGGCCGGGCACAGGCTGCACTCCAACTGGGCCTTGAGCCCCGAGAGGCTCTGGCCTGGGGACTTCTGGCAAGGGCTCCTCTGACTGCTGTGGAGGGGACAGCACCTCGCTGGACACTGCAGACCTGGGAAAAGCCTGCACAGACTGATGCCCTGGGCTAGGTGGGCTCCTCAGGTCTTGCTCCTTTTGGGAGTCCTGGATCCCACTGTGCTTCTCAGGGCCAAAGGTGGGTTCGGACTCGGCATCCAGGTCTGAAAAGTAGGCAGAGTCTCGGTAGGGGCTCTTCTTGCTGAGGCCACCAAGGGAGACAGAGAGCAGAGGATCGGGCCCTGGGCTCTCACCCTCTGAGGCTGGCTCCCCAAAGGCCTCAGGCTCACTCGACTCATGGGCCTCCTTGAGCACAAACTCAGGAGACTCATAGTTCTCTGTATCATAGCCACTGTCCACGGCACGGGGCTGCCCGCCAGGTGGACCAGCAGCTGATGGGCTTAAGACCTCACAGCCACCATCACTGGCTGAGGACGGTATGTCCAGAGAGTCCAGGGAGTCAGGGGTCCCCACCTGCTTCTGCAGACTGCGCAAGGCTGGTACTATGCCTGACTTCTCCGTGTGTGGGCCGTCACTGGACAGGTCGGTGAAGACTCCTGATGTTGCCTCGGTCGTGTCTTCGTCCTCGCTGCTGGGTGCCTCTTGCCCCAGAGAACTGCCGCTGCTCTCCAGGGTGGGGGCTGGCTCAGGGACGGTCACCCAGCTGCCAGCAGCGGGTGTGGGTGAGGCAGGTAGGATGTCAGGAGCGCTTGCCTCCTCCGAGGGAAGTGAGGCTCCTTCACAGGATGGGGAGGGGACGGAAGGAAGGGGTAGCTGGGGTTCAGCAGATCCCTCAGCCTCCTGGGCAAGTTTGGGTTCCACAATGGGGTTCTCAGCCCCACCCACAGCTCCCTCTGTCCAAGGGGATGTGATGAGGCAGGCAGCAGGTGCCAGGCCTTTGGCAGGACACAGGGGGAGCAGGTTGAAGGGACGGCTTGGCTCCTGACCAGGGGAGACTGCTACTAGCCCAGGGAGAAAATCTCTGGGATCCTCCTGGGACAGGAGATGGCCCACCTCAGGGGAGGCTCGAGGGGTCTGCTCTAAGCTGGAGCAGTCGTCCCTGTAGCTGTCTGTGAAGCTGCTAACATAGCCAGGATCCCAGGATTCTGGGTCGCGACTGGCACTGTTGTTGTTAGCTGACATGTTAGAGCTCCAGTGTCCACACTGAGCGGCCAACCCCACCTTCCCCTCCTCTGGCTCCTCATCACTGGGGGAGGGCTGGGCCCCAGGACTCCCCGAGGGAGATGCACCCAGTGGGTCATCAAAGAAGGGCGGGCAGAAGGTAGCCACACCCCAGTCTATGTCTTCAGCTGGCAACATCGGGGTCCCAGGAGAGGGTGAGCGTGAGGGACAGGGTGACCCTTGCCTCCTATGTGAATGGTGGTCACAGGGGCCCCACAGACCCTCAGTTGGGGGTGCATGGCCCAGCAATGGCTCCATGGCAAGGGACGCAACAGTGCTCTCCTCAGAGTTATTGTCCTGGTCAGTCACAGCCTGGGGGCTGGGAGCGCAGCCGGCACAGTCTGGATCGTGGCCAGCAGCAGGCACTGCCCCCTCCAGGCGGATGAAGTACTCGCTACCCACTGAGGGGCTGTGGGCACTGAGGACTGGCACCACACCCGGCGGTGAACTGTCAGGCGCGCACAACTCCTGCAGGCGCGCTGCCGAGCCTGGGCTTGATGCAGCCCCCGAGGGTGGGTACTCCTCAGCGCCACAGCCAGCCTCCCACTTGTATTCAAAGTTGAGGCCGTGGCTTGTCTCCGTGACCGTCAGCACGTCATCACTGTCCACGTGAAAGCCGTCGCTGGTGAACCGCTCCAGCAGCGGGAAAGACGAGGCAGCGGTGAGCTCCGCGGAGGCGGCGGTGGCAGCTGCTGGGGCTGCAGAACCCGAGCCCAGGCCCGTGCTGCCCCCGGGCCGCAGGGAGCGCCAGCGCCGCTCAAACTCCTCCTCCAATTCTGTGGTGCCCTTAGCACACAAGTAGGACAGCAGTAGATGAACCTCTTCAGCTGTGGGCCTCTGCTCTGGCTGCAGCCAGCAGAACTGCATCACCTCGTACCTGCCGGGAGGCCCTCATGGGTGGCCCTGGCCATATCCAGAGGCACGCTGGCCGGAGTATAACCTGCCCTCCGGGGACAGTCCGTTCCCCCATGCTCAGAGTACCCTGGGAACACTAGGGGCAGTCAAGGCAATCTCCCAAGGCAGGCCCAGAGGCCTGGGAAGGGCCCTGAATTAGGGTAGTTCAGGCTGCAGAGACCCAGAAGCCCTGTAGAGGTGGACCGAGCAGCCCCAGGCTGTAGGGCTCAGCCCCCTGTGCCCCTCTGGCCTGCCTGCCCAGGGGGGTGGGGTCCTCACCATCGATCAGATAGAGCCAGCTGCAGCTGGGGCTTGGGCAACTTAAGCTGCTGCTCCCGGACGGCGTAAGCCAGCACCTGCCCGTCCGAGTGCTGGGGGTACGGCTGCGCACCCAACTCGAAAAGCTCCCAGATGGTCACACCCAGGGACCTGCGGGAGCAACCACAGTGACACGTGGCTGAGCATGACTGCACAGAATCCCTGAACACCTGTCATCATGTCAGCCTCTCTGGGACTGGACCTCACTACGCCACAGCCGCCCCTCTCTAGAGGCACAGATGCAAGGCAGAATCCTGTATCCCTTAAGGACAAGTGGCCTTCAACAGCATCTCAGGATGATTTTTAACCAAAATATGGTGCCAGTATTGGGGGGGTGTCAGTTGGTCCTATCCTGAAGGCCCCATACCCTTGACTGTCAAGGCAGTCCCCCCTACACACACACACACACACACACACACACACACACACACACACACACCAGTATAGGAACCTCAGGAACCCATCATCAACGAAGTAGCCTGTAAAGTGCCTCTCATGGCCACAAGGTGGCAGGCATGAGTACACTTTCCCTGTGTGGCAGCCCTAATCCTAGCCAGAGAAGGAAGTCAAAATGCTGGAGCAGGGGGCAGAACTGAAAGGCAGCATCCCCACTAGAATAGCTGACGCCAGCGCCATCTGGGGAGGCGGCATCCCAAGGCCCTCCCGGCAGCCCTGCCTGCGCTCACCACACGTTGCTGCTCTTGGTCTGGTCCACCACCAGCAGGTTGCCGTGAACCTCGTCCACCAGCTCTGGCGCGATCCAGCGCAGCGGCACCCACAGCTGGTCAGCGGTCACGAGATAGTCTTCCTGTAGCACGCAGGGACAGGATGGGAGTGAGCTCCGCTCAGCAGCTGCCCCTGCACACGGGCCCTGACGGCCTTACTCACCCTGTATTTGCAATGCGACAGGCCATAATCACCAACCTTCACTGTCAGGTCAGCCGTAAGCAGGCAGTTCCTCAGGGCCAGGTCACTGCGGAGTGGAAGGCAATGTCAGCAGAGTGTGCCAGCCTGAGTGAGCCCTGGTGGAATGGTTGGGCTCCCGGGCACAGCCAGGCAGACCGACAGGAAGGGGTGTCTGAGGGGCCACCCACTTGTGCCCAAGTTCTGGCTCCACACCCTGTACTGGCTATTTTGGAAGACCTGTGTGGACTTCAATGCATTTCTAATACTTCTTCTTCTTCTTTTTTTTCTTTTTTTTCCAGACAGGGTTTCTCTGTGTAGCCCTGGCTGTCCTGGAACTCATTTTGTAGACCAGGCTGGCCTCGAACTCAGAAATCCTCCTGACTCTGCCTCCCAAGTGCTGGGATTAAAGGCTTGCGCCACCAAGCCCGGTTTTCAATGCACTTCAATGCATGTGAAAATCAGGCAAAAGATGCTCAAGGACGACCCCCCCCCCCCAGCAAAGTGCTGTCTAACTGCACCAGAGCCCTAACCCGCTCCACCCTCTGTCTGATCTGCCCAACAAGGGCCAACAAGCCATGGAGCAGAGAGTCTGCAGTGTCCTCTCAGGACCCTCACCCTTCCGACTACACTCCACCATCCCAGTCCCCAGGAGGTAAGAACTGATGGAGAAACCGAAGCCCGGAGTGTCTCAGAGGGTCCTGCCAGCAGTCAGAGCCCATGTTCTAGAGTGCAGCCCTGCCTGGCCTGCTACACAAGCTGGAGCCGAGGTCTAGAACAGTATGGACCACAAAGGCCCCTTTGTGTGGAGGATAAAAATCACCAACTCAGTGGGAAGCCTGGAATGCCAGGCTCTGTATAACTCTTGCTTGGCTATAGCGCCCCACCCCCAGGTGTTTGGGGTACAGGACAATAGAGTGCCACGGGACGCACCCTCATCTGCCATACTGGCTGTTCTGCTGAGAGATCTCTGGATGTAGATGGGGCCACCTTGGCCTGCCTCTACCCCAGGAGGACTGTGTCAGGGGACAGGGTGGGGTGACCTGGGTCCATGCCTATGGGTGGGGCAGCTGGGCTAGGCAGCAGGCAGGGCAGGAGGCTGGCAGCTGCCCTCTTCAACAAAATCACTGATGCTGGAGTCACTGTGCACCCACTCAGCACCAGGATATTGTTGGGGAGGACGGCCTGTGCAGCGTTGGAGCTGGTGGGCCGCTTGTCCGTTGCCACTTCTTCCAGCATGTGCCCCCAGCTCATGGGAGGCTGGGCATCCTGGCCACCAGAGGCAGGAGAGAGCCACCCCTCCCACTACAGGGCCAGCCCAGCCACTCCCTTTGTGGCCTGAGGGAAAGAGGCTGGGGTTGGTATGGAGCCCAAGTATGGCTGACTGCTCTAGTAGACAGGATGGGTTTCTTCATTTAACTGTCTGCAAGGTGAGTTTCAAATGCCAAGTCTTCACAATTTATTTCATTTTGAGATGGTCCTGCTACATAGTCCTGGCTATTCTGGAGTTCATTAGGTAGACCTAGCAGGA
U5_15 119831705 119846754 15050 CCTGTGAGACAGGCAGAGTGAAGTCAGAGGAGAAGAAGGGTCAGCGTGGGCAGAGGAAAGGGCCAGGGCTCACTGCACCCACTCATGCCCCCTCGGATTCTCTGAATTCTGCTCCCACGCTGATAGCCCAGAAGGCCGGGGTCAGGGCTGCTGGGACGCCCAAGGGAAGATGGCAGCCCTCGGGGACTAAGTCTGCTTGGTGCCCAGCTCATGGAAGAGTCTCACCGGGCACTGTGCCCCCAAGACTTACACCCTGAACCTAATCTGTCTAAATGCCTGGTGGAAACCCTGGGGTCTCTAGGACCTCAGTTGTCCCAGAGTGGGTTCAGGGTCCTGACAGTAGAACCCAGGGCAAGCACAGGGGGCAGGAGAGTGCTTGTATGTTAGGAGCTAGAGGTAGAGGAGGCGGCTTAGGTGGGCTGACCCATCTCACACAAATTTCTCCCTCCTTGAAAGAAGATGCACCCCCCCCCCAAAAAACCCAAAAAACAACAGAGCTGAGCAGTGCAAAAAGCACCTTTGCCCTCTCCTGGGTCCCTGTCCCACTGTCCTTGGCCATAGATAGCCAAGCCTGCCTCCTAGGAGGTGCTAAGGACACCTGCAGGCCTTTGAGCCAGTGGGTAAACGTGTCCATGTCTGGATCCTGCCTGACTTTTGAGCTCACTCCCTTGAGACTCGATGGGCCACAGAGCCATGCATTCAGGGTTGGGTCAGGCTGGTGGCGACCAGGGCAGCATTTATCTAAGTCTCTATTGGCTCAAACAGGTACTTTGATGCAGGCTGGGCCCTGGATGGGAAGCATTGTGTTGAGAGCCTGGGAGGGCTGGCCCAAGGTTAAGAGCGGCCTGCTTTTCACCACAGGGATGGGGCCAACCGCACTCTCCACTTGAAACCTTCCGCGGTGTCCTTGGCGCCATCAGATGGACAAGAGACAGCCCTGAGCTGAAACTTCCAGGCTGTAAAGGCCTGAGAGCTGACTGTTGTAGAGGTAGTCATAGTCCCAGGCACCAAGGTGACCAGGGCAGCATTTACCCGTCACCTCTAAAGAGGAGGGGGGTGGTGGTGGTGCAGGGAGAGGCTCTGGAAGGAAGGCAAATGGGAGAGGCAGACAGGGCAAGGAAGCTATGGGAAGAGGCCCTGCCTACACCTGGGTTGGGGGTAAGGGGGTGGGCATTGATGCTTCTCTTGTTCCCTATGCTGTGTGGGTAGCCTGTTTGGTAGGGACAACGGGGCCACATTCCTACAGGTACAAAGGAGCAGGAGTCTGGGAAGAACAGAGGTAGATGGATAATCCAGAGTGCTGAGCCACCTGCCCCAGTTACCTCATGGCAGCCCCTGGGGTGGAGGAGCGACAGACAAGGCTACTCTCAAGCCTGGGTCCCAGAGGGGCTCCACGCACCTCCCAACACAGCTCAGCCTGAGATGCGGCCAGGAGACCTCGGCTTCCCAGTGCCCATGCCCCAAGCGACCCCACACCACTCACCGGAGCGACCCGGCTGCTTGGCCATGGGTAAGGAGACCTCGGTGAGGGGCAGGACATACACATCGGGGCCGGTCTGTGCAGCTGCAGCCGGGGAGCCCTGCTCCGAGAAGTCGGCCACATACTCGTCCCCTTCAGCATTCTCAAACTCCTGTGGGTCGGGCCGGCACGGGTGGGTGAGCAGGACACAGGCTAATGGAGGCAGGCTAGGAGAGGCCCCTTTACCCCCAAACTCAACCTGACTTACACAGGCCTACAGCATGGGCCCCTGCCACATGGCCATTCCCCACCTGTTCACCGGCCCCAATTCCTCAGGGACACCATCTCAGCAGAGGTCAAAGGCCTCAGGCCCAGGTGGGGCTGGGAACCCAAGGCTGAGTCCTGCTTGGAGAAGGGCTAAAGAGTTCAAAGGGACAGAGGCAGAGTAGCCCCTCATAGGCCCTGTCAGTGGTCTCCTCCCTGCCCCCACCCCCTGCCACCCCATGGCTTAGAGCAGATTTACAGGCAGGGGCTCACTGCACATCTCGGGGAAGGTAATTCGGTTCCTCTTCCCTAGCTGGGCAGGGAGCAAGGAACCCAGGGACTTGTTCTTCATCCACACCTCCACTGCCTGCCTGCATGCCGTGGGGTACCCTCAGCCCTGCACCCCCCCCCCCCAGTGCACCCTAAGAGCTTGCTCCTGCATCCCTGGAGATCACTCTGGGGACAGGCTGCTAACTCTGAAGACTATCAGCCTAGGAGAGACCACCCGACCCCCACCCCACCCCATCTAGATCACATTCCAAGCAGCATTAGTCTGGGGTAGGCCACAGCCATAAACAAGGACAGGGTTTCTCGTGGAAGAACACTTGCCCTAGAACCACAAACAAACACATCAAAACCAAAACAGGAACAGAGCAGAAACCAGGCCAGCTTGTCCTCAGCACCGGGCAAATCTCCCTGCCACATCTCCCACCCAGGTGAAAACTGGGCTCTGAGGACTGGGCATAAACCCGGAGCTTGGCTGCCCGCTCCGGGCCACGTTCCTGCGGACAAACGGCTAAACATACCCTGGGGACCTTTTTCTAGGTCATCTGTCTTTCTGTAAAGGGGGTGGCCCTACATTCCTAGTGGTTAGCCCAGCTCTGCATTCTGAGAGCAGAGCCTCTAACACCTGTGGCAACTCTTCCTCCCCGGAGCCTAAAAGACCACATTAGAACGTCCTCTAGCCCCACACGCTGGGGCCTGCGATGCCCGCTTCCCCCTTTGTAGTATGAATTAGTTCTGGCTTCAACCATTACCTTCCCTTGCCAGAGAGCCAGCCGGGTTCCCCCAGCACAGCGGGCGATCAGGTAGCACAGGGTTAGCATCCAGCCCCTGCCCAGAACAGCCCCGGTGGGGAGCTCGCTGTGGAAGCAGGAGGCAGTGACCCTCCAACCAAAGCACACTGGTGCTGGAATGTTCTGGGCACCATGTTCCCAAGGAGGTGAGAAGGGCGAGGGTGGGAGGGACTGCTGTCAGTCCTTGTGTGGGGCCTTGTTCTCAGCGCCTGAGGAGGGGCTTGCTACACAATGGCTGCCTAAGCTGTGCCCTAGCTTCCCACCCCCACGTCTCTGACCTGAGGTTCTGCCCTCAGGGTCCTCCAGGATGCAACTCTCCTTTGATTGTCCAGCCCATTGTGCGCTGACAATCAGGAGGTCGGGAGATTGTCCCCTGGGGTGGGGGCACCAGGGAGGGGGGCACACTGCACTGCTGTTAAGGAACTAAACACCCAAGTTTGGCTGGGGTCTGTGCTACCAGGTACTGGGACTCTGCAAAAGGGTAATAGCATTTGGTGCAGGTTACCCAGTAGGAGGTACCCCTAAGATACAGGCTGGCTCTGTGCTGGACCACAAGCCCTGTTCCCACCCTGACCTCCTACCCAGCCTGCAACCCCACGTGGGTGCGGGAATGTCCAGGGCTCTGGCCAGGCCTCAATATGCTGACAGACAAGGCTGCAGCCCCCGCAGCTCCCGGTGGCGCTTCCTGGGGGTGGGTAGCTCTGTGCTTTCTGCCCTGCATTCTTGTTTGGAACCACAGTGTGACAGCAGGGTGGCCACTGGGTTGGAAAGATGCAGGGCCTCCATCACTGGAGTGAAGGCCTCAGCTGTGGGGTCTAGCCTCCTAGGGAGACTGTACTAGGGAGAGTGTAGTGAAGGCCCCAGGGCCCTCAGTGGACATTCCAGAAATAGGATGGCCCTTGTCTCGGGAATCTGATGGATGTCCTCTGAGCAAAACATGCCCAGCTAGGAGCTCCCCAGTGATGTCGCTGCCGGGGACATGTGTCTTGGGGCTTCACTTTCCCTCTGACTCAGTGAGCACAGATGTAAGGACCTCTGTGGGGGTCCCCTTCACTGAGAGTCGGAATGTTCTCGAGAGCCCCTAAATGCTCCTTATGGTCATTTCGGCTTCTCTGGACATGGACAGGCCTGACCTGGCGCTGGAAAGGGTCAGGCCATGTCTACAAAGAAGGTCCCAAAACGAGGGGCAGGGGGTGGGGTCCCAGGAGCCCCCAGTAGAGGGACTATTGGAGACCAGACAAGGGGTTCAGCTGGTCACAGGTGAAAAATCAACCATCACGGTAACCCCAAACTGGAGGGGAGCCGGGTGGTGGGTGGATGCGGTCGGTGCGAGGTCCTCACCTTGAACCCGATGCCGCCCTTCTTACAACACAGGCAGGCCAGCATGAGGATGACGACAGTGAAGATTCCAGAGAAGGACACGGCTACCACCGCGAGGGACGAGGACCAGGACAGCTCACTGAGCGGGGCACCGTCTGCAAGGAAGCAGAGCACAAATGTCTCATCCCAGCCTCGGCATGTGACCCCTCGCTCTGGTCCCCCACCTGGATGTGGCCTCAAGCCAACGGCCAGGGCTAGTGAAGCGGCCAGTATGGGCCCAGCTCCTCCCAAGGTCCATGGACAGCTCTCTGTGATATCAGGGTCACTGTTGTATCAGGCTCACTACTGAGGCTAGAGGAATGGCTTGGTAGCTCAGAGTGCTGGCTGCTCTTCCAGAGGACTTGGGGTCAATTTCCAGCACCCACACAGCAGCTCCCAACCACCCTAACTCCAGCCCCAAGGGATCCGCTGCCTCTGTGGCCTCCGCTGGCACCGGGCACACATACAGTACACAGAAAACAGACATGCATTCAGGCCAAAGCATTCACGCACATAAAATTTTTATTTAAGAAAAAGAAAAAATCCACAGTGGTGACTCCATCTCTGCTCACGGGACTCAGCTCACTTTGGGGCTGGAAGGCCACTGAAGGCCCTGGCTGCCAAGGGACAGAGACCCTCTGGCACTGCGGAGCTACCCTGTCTCTGCCTGGCAGCAAAGTGCCCCCTATTCCAACCCTGGTTTGTCCCCCAAGTCCCTGGGGGCTGCTTCTGGCCTGGGGAGAGCAGGAACTTTCACCTTCTTCGCCCCTGATATAAATGAGCCCCCACATCTCAGACGGGAAACCAAAGTGCTCAGGACAGCAGAACACACCCCAGTGTCTCACACTGAGCTTCCAAACTGAGGTTCGTTAGCAGACTGGGGGTGGGGGGAGCCAGCTCTGGTGTCTCCAGATGGCTTCTGGGGCCAGCCCAGCGTGTCCACTGGATGGGAAGGAATGAGCTTGGGGATTGCTCTGCCTTCCAGGCCTGCCCTTCCTCAGCACGCAGGCTCTGAGTCATCCTATCCATGGGTCCTCATTGAACTCCTGGCAATGTGGAGCACCCCAGCTCCCCCAGGTGCTGAGTCCGTGCAGCCTTTGTCACCGAGGCAGCTGTACCACACACTTGGGAATTCCTAACTCGGCATGGATGAGGCCCCAGGGCTGCTGGCTAACGAACATCTGGAGGGCTGCCTGGAGGAAGGGTGAACCTGAGGGCCAAGAGGAGCACAGATATAGCTTGGGGTTCCTGCTCGGGTGCCTGTGAACACTTCCCATCTCACACCTAGAGACGAGAGGGTCCTTGTGAGCCAGAGCAATGGTGGCCAGCGTTCATGGTGACACCATAGCAGAGTAAACCGCTAGAAGCTAAAAATCCATAGGAGGCATTCACACTCCTGAGCCAATGCCCTTCCAGCAGCCTTGTCAGGCAGGGTTTCCAGGCATGCCTGCGTGTGTCTGCCGTTTTACACGTCTGTCCTGCATGTATATATGTGACCATCCTCACACCGTGCAGCTGGTACTGTGTGCTCACACCTGAATGCTCCACGAGTGTAAGTACTAATTCTACCACAGGGTGGACACCTGAGTGAGCATGTCGCATGCCCTCCTGCACCTCCAGGAAGCGGCGAGCCCCTGCGGACTCTGCCGTTGCCATGGTGAGCCCTTTCTCCTTTCTCCATCTGGTGCTGCTATGGCATCAGAGCTCACCCCTCCCACACCCACTGCTCCCTGCATTCACAGACCCACTTGACGGCCCTGAGGCCTGGGGCTGGCATCTGGCGCATCAGCCCATCCCTTGCTTACTCCCTGGGCTGCATGGGCACGTACCAGGTAAAGGTCACCTTGGGAAGGGCCAAGCTCAACATCCACAAGCCCTCGCCCCGGCCGCCCATCAAGGCCACTGGGCTTTCTGTGGCTTTCTTCTGACCTTCAGCAGGCCCTGGCCACAGAGGGTTGTGGCGAGTTGCTGGCTGGTAAGTGGGCCTGTGTGGGAAGCACAGAGGTTCTTGTGCTCACAGATAAGCCATAGGGGAACTAGGAATGTTAACACATAGGGTTGTTCCTTCAAAGGAAGAGATGCAGAGCCAGCCCCACAGCTAGCACCCAATGTGGGGCTCAACTATTGGAGAAGGTAAGAAATTTCAACAAAAGTAGGGAGTTAGGAAGTGAGTCCACTCACCCCAGGAGCTAGGACAGGAAGAGGTGAGATAACAATGTGGGTTCTTCTCCGTCCTGAGACAATGCATCTTATACAATGTCTGTGAAGATCCAGAGGAGCAAAATATTCAGAGCAAAAGCTCTGCACCTTTATGCAAGTGGCTAAAAGTTAACCCTCCGTTTCCTGAACAAGGAACCTCTGATGTTGAAAACTGGAAACATATAGGCGCCAATGTAAAAAGAACACATGGGAGGGGGTTGGGGAATCCCAGTCAATTACCTTGCAAACTGAATCTCAGTAATGCAGGACCATAAAAAAATAATAAATTCTCTGTGGGACACATCTTGTTAGGTCTTGGCAGGCGGGAGCTCAGAGCTCATGAGGAGTCACTGATCTAACTTGGGTGATGTGTATCAGACTCTGCCTGTTCTGACCAGAGAGACAGAAACAGGTCTTCAAACGCCAGACTCCACTGTTTATCAGATGGACTCAGGAAGAATCAGAGACGAGCAGTTGTGACGGGGCTCTGGAGCCCCGGTTTGCACATCCTCACCCAAAGTGGGTATGGTGAAGGAAGACTGAGGCTCGACACCAACGACTCCCTGTATAAATTAGCACATGAGGGTAGAGAAGCTCTGAGAATGGGGACCAGCCTAATGTGAGAGACGAGGAACTTTGCAGAAGGGTTCTGGATGTAGGGAGGGTGTGATGGAAGGATGGAGATGTCTGGGGTGAGGGCCTCAGATGGAGTGAGGCACTTAAGAGTGCAGTCTGGTGAGCAGAAAGCAGAAAGAGCGGGGAGTGAGTAGCTCGGAAACAGAAAACAGAAGAGGGTTGGCTTCTCTGTAAATGAATCCTGCCCTACAACTGAGTTTGTCTGACTTTGAGGTTTTCACCTAAAATTATTATTTTGGGTATAGCCTGAGAATCTATTACATCAGACTGTCTGAGAAATGTGTTAAACTAGAACCTTCCAGCAAGTTCTTGCTCCATGGAACTATCACTCTCGTGGTGTTCACGTTTTCTTGTGTTGTTTACAGCATCAGCTGGTGTGAACTTTCAGTGACTGCTTCTCAGGTATTTCTGAGTACCCTGTCAGTCACCCAGTGCGGGGAGTCCTTCTCAACCTCAGAATTAAAATCTCCCTGAATTTTAAAGATCCCAAACCTTACATAAACAGCCTTAAGTTTAAATCTTTAGAAGTTAATGACCATTGTTAATTAAGTAGGTTTGGTTTGCTCTTCAGTATTGTACTTGCCTTTCTCTGACATAAATGATTAGACTCTGGCAATGGCAGGAGTCAGAGGAGGCTCACAAGAGCCTGCTTTCTATGGGAGGCTTATATTACACAATATTCCAAGCTTCTAGTGCATAATTAGTCATGGGTGGTTCTCACATCAGCTTGATATCTGGAACGAGGGCTGTCTGTGACTGAGGCCTTCTTTGTGGTCAGGTGTGGAGAGATGTGTGTTCTACAAGTGTGCACAGTACCTGTCCCTAACTTGTCAGCCGAAGAGCAGGGTCCCGGGCATGGCATGGAGCTCTGTGGGCTCACCGAAAATACCATTGTCAAATAGCACCTTGTGCATTTCCTTTCTAGGGCTCCCAATACAACTAAAAGCTGATAATGGTCCTACTTATATGAGCAAACCACTTGAGGAATTTTGCAATTTCTGGAATAATAATTATATGTCCTTGCTGTCACTAAAATCCCTGACAGCCCACAGGACTGGGTCAAGCCATTGTGGAATGACACTATCAAACACTTAAACAGCAAATTTTAAAGATTAATAAGGGGAAAGGGTGAGAGGAGAGGAGGGAGGGCGGCTGTGATGGGGATGTAAAGTGAATAAATAAATAGGTTAGTGAAAAAATATAAAAATAAAGAGGGGTCTATACACCGACCTAAGTTCCCACCTGCTGTGCTACACTCAGCCAAGCTAACTTTAAACTTTTCTCCCCTAAAGAACGCTTCTTCTATTGCCCCAAGGCATTTTGCCCTAAAGAGACAGAGCCTAACGTGTATGTTAATGGAAAGATCTAGAAACCAATCGATGGAAAGGGTCTGATGCTCTTCTAACGTCATGGTGAGGCTACACTTATGTGTTTCCAAATATAAACGCAGTCCCAGATGGCACCCACTCTGATGCATCTGACCAGGACAGCATCCTGAAGACAGCCAGATAAAGGAAGTATCCGACGACAACAAACCCATCAAGAGGAGATGTCCCAGGAGGAGGAATAAGCCAGTGCCTTAGGGAGGCAGCAAGGACACAATATCAGTGACCTAAAAATGACGCTGTTACATTATCTGAGCTCACGTTAGCTCTCAGCTTGTCAATGCAGAATCCAAAAGCTTTTTGTCATGAGGAATAAGAGGCACAGCCATGGTAGCACACAGTGTGACATTTTGACAGTGTGACGTTTTGTGACGCTGTTTTGCCAAGCTAGAGAATGTTTTTAGTCTCTTTTTATTACCAGTCACAAGAGTGACTACTAGAATACAAAGAGAGGTTTCAGATAGGGCCTGTATGATTAGTAAAATCACAGCAATTATTGGTAATTAATAAGTAATAGTTCATTAATTACTAATTATTAATATTCACTAATTACTAATACTAGCAAAATATCAGTAATTAGTAATATTACAGCAAAAACATTAGCAAAAGTTAGTCAAGAGATGAGAGGCTTAAGAACCTCATTTCTGCAAGACAGAGCTACTGTAGACTATGTGTTGTTCAAGCACGGTGTGGTGATCAACAACCTCCCAACCTGTGCTGCTAACCGTGTCAGGTTTCTCTCATCAATAAAAAGATAAGGTCTCTCAGGTGACTTCTGAGTGGCCATCGTGGTGAAGCTGGCTTTCCCTTGGTCCTCTGTAGGCTATTCTGATAACTCTGTTATGGTTGCCTGTATTGGTTCAACTGGCCATGCAGGCAGTGCGTTCAGCCTTGGCCTCTATTACAACCACAATTTTCTCTTTAAGAACTGAAAAGGAGAGAAGCGTGGGAGGCGTGGAGGTTCTGTGCTCACAGAGAAGCACTAGAGGAGCCAGGGATGTTGAACACACAGTCTTGTTCCTTCAAAGAAGCGGGTGCTTAACCTGTTAACCTCCCAGAAAGCTGGGAGCAGACATGGTGAATAGCCTAGTGCCCTTTGTACTGTGTGGCAGAGACTACACTGCAGCCTCCCCCAGACTCTTGCCATAAGCTTGTCAATCGATAGAGCCTGTCTTTATGGAAGGTGTCATGTGTAGTCAAACTATAGACCCCATCTTTATGGGAGATGTCACATGGAGTATATAAAGAAGTTCAATGAAGTCAAACCTTTAGCTATATTGTGCACATGGCTTGAGTTATTACCAGAAAAATATTTCACCAAATTGTGCTGTGCTTAAATAGGCCTATAATCAACTATTTGGCATCAGACTCCAGAACTTTGAACCAACATCAGATGCTTATTCATCTTGAACTGAACTACCTTCTTGCCTCCTGCAGATCCTGCCTCTGCTGGCCGTAGCCGTCACAGAGACCCAACAGGCCTGTCTGTTATTCAGTGCCCAAGTCCCTGATGGGGGATGGGCAGGAAGAGACAGCCAACTGGAATGGCCAGAACCACACAGCCAGGAATGCTCTTAAACTCTCAAATCTGCATGTGTACCTGGGTTTCTGAAGCCCACCTGCACCAGGGGAGCCCCAGGGACCCTCCTCCCAGACTGACTAAAGCCAACCACAACCCGCAAACACAGAAGTTATCCAAACTGGCTCCATCCTGGGTCCCAACTAAGTGCCACTGAGGCCTAGGAACCATAGAGATCATGCAAAGTGATTGGTTAAAGAAAGGAAAGGCAGATGGTTCGGGAGAGATGGCTCAGCAGTTAAGAACACTAACTGCTCTTTCAGAGGTCCTGAGCTCAATTCCCAGCAACCACATGGTGGCTCACAACCATCTGTGATGGGATCCGATGCCCTCTTCTGGTTAGTCTGAAGACAGCTACACTGTATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATATGAATATGAAAGAGAGAGAGAGGAAGAAAGGAAGGAAGGAAGGAAAGAAAAGAAAAGAAAAGAAAAGAAAAGGGAAAGGGAAAGGGAAAGGGAAAGGGAAAGGGAAAGGGAAAGGGAAAAGGAAAAGGAAAAGGAAAAGGAAAAGGAAAAGGAAAAAGGAAAAGGAAAAGCTAGGCCAGGCAATGGTGGCGCACGCCTTTAATTCCAGAGCTCGAGAGACAGAGGCAGGCAGATCTACAGCCTGGTCTTAACTCTGTCTCAAAAAACCAAAATAAATAAATAAATGGAAAGGGAAGGGAGAGCTAGATGCATGAGAGGACCGTGCAGCACCTCAAGTATGATTCGGGGTTGGCCCGGCCCCCAGACATTCCCTGGCACTAACACCAAGAGAGCTAGGCCCAACATCTTTAGCTGACATGGGTAGAGATGGGGATGGAAAAGCCATGGCCCTTGGCCTGGGACCAAGGCTCTGTAGGAAAGGGTAGAGGTGAAAGGCAGGTGATGCTGTGCTGTGGTTCACACAAGTCACAACACTGAGTACCAGGCACCATCCTGTCTCTGGACACTGAGAGCGACAGGGCCTCGGTTTGGGTTGGAAGCATCACTGTATAAGCAGGCCTTACAAATCTAAGTCTCTGTAGTGGGCGGCCTGCAATTCCACCCGGGCTCAGGAGCACAGACAGAAAACCACGCCCAGCTAGGGCATGCTGACAGGACGGCCCTGCCCACCATCAAGCTGACCGCCCATTCTAAACCGTCACACTGAATAAAACAGAAAGTGTGTGCATGCCTTCGCGGTTCTCCCTGTGTCTTAGGAAGCGCTTTAAACATTAACCACACTGAGGCCTTGGCTCCGCTGAGGTCATTAGTGCCTCCTACCCAGTCCTATGCTAGTTGTTGCCCTGAGAGGCCCAGTTCACAGGCGCCCCCACCCTGGCCGTCCATCTCCCACACTCCCTCGCAGGACTTGGCTGGGGGATGTGGTCAGGAATCATTACACAAAGCCACATTTGCATAGGAGTGGGACCTTACCATGGGGTGGGTGTCCAAAAACACTTTCGTTAAGATTTCTGTCATCAGTCTTGTCTGCAAGCACCCAGATCCACTACAAGCTCCAAACTCCACATCACTCAGCTCCCGGGAGCAGCCATGTTGGTGCCACTCCTGTACTGCTGAGGCCTGTCTGATGGGAGCTGGGCGATCCCCTCCACTGTGCGGTGTCAGCCAGCCCTCTCCTCTCTATTCTTTTTTTTTTTTTAAAGATTTATTTATTTTATGTACACTGTCGCTGTCTTCAAACACACCAGAAGATGGCATCAGATCCCATTACAGAGGGCTGTGAGCCACCATGTGGTTGCTGGGAATTGAACTCAGGACCTCTAGAAGAGCAGTTAGCGCTCTTAACTGTTGAGCCATCTCTCCAGCCCCCTCTCCTCTCTATTCTTATTGCTGTTGATTGGTTGGCTTTGTTTTCCCAAAGACAACGTTTCTCTATGTAGCTTTTGCTGTCCTGGAACCCACTCTGTAGACCAGGCTGGCCTCGAACTCAGAGATCGCCTGCCTCTCTGCCTCTGCCTCCCGAGTGTTGGGATCAAAGATGTGTGCCACCTGCCCAGGATCTCTTAGCTACTCATGTTACCCCCAACCCCCAGATGCTGAGATTTTCCAGAAATTGAACCGTGTTTGGGTAGTGACTGCCTTTGTGTCTCAGGAGGCCCAGGTTTGGTGGGAGTGTACTTGCGGTTGTCAGAGTGACCCCAAGGCTGCCCACTTGCTTCTCCCTCTGGCCTGCAGCTGTGTCACCTGCTTAGCCTGGCCAAGGAGACTTTGCAGATATTGGTAGATCTTCCCATAGCTCCATGGGTGGTGGCCCTTTGACCCTTTGCTGTCAACCAATGGGATTGACCTTAACCTTTTGACCCCAGTTGTCAGGGAAGCCATTGAAAATAAACATGTGGCCCTTCTCAGGGGAGGGAAGCCTCAGAGGTGAGCACATTCCTCAGATCCTCTTTGCCTCCCAGGTGACACAGGACAGGCCACATGGGGAGGAGAAGGTACCCATAAACAGGCAGACCAACCTTGGCAGCAGGGCAGGTATACCAGGCCCTGATTGGACTAGAGCTCCCAGCAACACTCACAGTGTGACGGGTCAGGCTGGCCGGCAGCCAGTGCTGATGTGAGCATGGTTCGGGCCTCTCCCACCCCCTTCCCTTCTGTTTGAATGCTAGGCAGACACTCTGTTGCTGCCTGGAAGGTTCTGGACAGAAGTGTGCCTCTCAGGTCACATGCTTATTAGCTGGGCCGGACACACCCCTCAAGCCCTCAGGCTCATTCTGCACTCGGCCACTGTCTGGAAACACGGGGCCAGCTGAGGCACAAGAGGAATTAAGGACGGAGGCTGGGGGAAAAGGACGGGCAGGCACCTGCAGTGCAGTCAGAAACCCCCAAAAGTGAACGTGGCTTTGATCTGGTCCTGGCTGTACAGCTCTACCCAACATGGTCCTGTTCCAACCTGTGAGTCCCTGTCCAAACCCACATCTCCACGTTTTGACTAGCCTAGAGTCCAGAAAATCAGGGGGCCAACAGGCCACCCAGGTCTCTTCATAGCACATACCCAATTTAGGTCACCGCAGATGACCCACTTCTGCCACCAGATGGCGATCCCTGGGCATTTTACAGTAATTGCTGAGTGGGGTCCAGAGACTCCCAACTCCTTGGCAAGGGTGTGGAGGAACCAGAAGGCCACCTCAGGCTGGGCGCAACCCCAGCAGCTAATACATGGGCACACCAGGGAGGTGGCCTGCTGGAGGGCAAAGGTCGAGGTGTAGTCGTTCCCCCAGCATCCTCACAACCAGCCTAGGCTGCTGGGAGGTGACTCTGTTCTGGGTCCCAGTCGTGCCAGGCTTCAGACCACCTGTGTGGTCACCTGCTCTATGTAACCTTTCTGTCAGACCTGATGTCTCCAGGATCCCCCATTCTATGGCCCTGTCACAAAACTTCCTGGACCTGGCTCCCAGACACTGCCTTCAAACAAGAAGGAAAGCCAGAGACCCCACAGAGTGGCAGCTGGCTCCCAGAACGCAGTTCCTTCTCTGATAGGCTCCTCTGAGGCCCTGGGGAGAGGCAGTGCTCCCAGACCTGCACGAGGCCAGGGTTTGCTGGCTGGTGCTAGTTGCTCCGTCAGCCCAGTGACACCATTCATGGCTCCAGGGGACGGTGTTTAGGATACACTTTAACTATAGGAAACTTTGTCCCCTTCAAGAAGCCTCCTGTGCCTCAGGGCCCCTGGCCACTGTGGTTGTCTCTTTCCATCTGTTCCACGGTCCCCTCAAGAAAAGTATACAGAAGGCTGTTTGGGGGCTGGAGAGATGGCTCAGCAATTGAGAGCACTGTCTGCTCTTCCAGAGGTCCTGAGTTCAATTCCCAGCAACCACATTGTGGCTCACAGCCATCTGTATTTTCTGATGCCCTCTTCTGGTGTGTCTGAAGACAGCTACAGTGTACTCATATACATCAAATAAATAATTCTTTTTAAACAAAACAAAACAAAAAAACCTAAAGGCTGTTTGGCTGCTGGATTCTCCACATCTTTTCTTTTCTTTTTTTTTTTTTTTTTAAGATTTATTTATTTATTATATGTAAGTACACTATAGCTGTCTTCAGACACTCCAGAAGAGGGAGTCAGGTCTCATTACGGATGGTTGTGAGCCACCATGTGGTTGCTGGGATTTGAACTCCGGACCTTTGGAAGAGCAGTCGGGTGCTCTTACCCACTGAGCCATCTCGCCAGCCCTCTCCACATCTTTTCATAGGTGACAGAGAGGTCCCTGGTCAGAGGGCAGATGGATACCCACCTGCCTTCTACAGGATGGGATAAGTCAACTCCATCAAGTGTGATTCTACCCGGAGTCCACCAGCCAGGAAACTGCCAAGCTGGAAAGGGTAGGTAGGTGGGACCAAGGTTGGTTGCTGGGGCCCAAAATACATAGGGTCAGCTACTTCCCACCATAGGGACTTAAGCTCGGCCTTCCTGTCCTGAGGGGAGGACCTCTTATTACCAGAGCTGCCCTCCCCCCACCCCCGCCTTCCTCTGAGCAATGAAAACATGTCACCCTTCAACATGTCATCCTTCAACATCACCTGGGCCTGACCTGTACCTCAGTCTCCCACACTGAAAGCCCTATTGCCTTACCTGAGGCCAAGGCTTCTGTTGGTCCCCCTGGGCCCTGGAGCAACTCTGCTGAGGGAGCCTCACCCTCACCCTCCTCTCTTCAGTGAAGCCCCAAGCAGTGAGGGAAGGGGCTTGACTTAGAGCCTAAACCAGGAGCCCCCCAGAAAACAAGGGGCTGTGCACGGAGTGACTTCCTCCAGGGCTCTGTGACCTCTGTCTCCTCAGTACTGCGTGAAGGATTAGCAGATATGCACGGGCCAGCTGCTTAGAGTTGGGGACCTGGCTACCCATCCACCGTCTGTGAACTTTGCCTGTTTATACTGAGCTCCTGGCACAAGCAGCCTCACAGATGTTTATAACATGCCGATGACAGGAATACAGAGCTGAAGAATCCGGCCACCCACCCAGACAC
D3_15 119814589 119829638 15050 GTGTGGTGGCAGTGGTGCCCAGACTTTTCTGGTCGGAGTTATGGACCTTGGGCACATGCCAGCCTCTGGGTAGTGATTGGTTCGAGGAGGCTTTTAAAGTGGCATCATAAAGTGGTGTGTCCTGTATGTACAGAGAGCACACATGATCCAGCCTACCCTGGCCAGATGGGAGGTGTCCTTGTTAGTGTGAGAGGTCAGTCACCACATCCGTGTCACCACATTCTCTGGAGCGGTCCCCAACCACTGTGACCAAAGAGAGGATAGAGAGTTGGTGTGGAAGGAGCCCGGCCGAGAGCTCCACAGGGGCAGGGCCATCTTTCCGAGAACAGGGACTTACACTGTCAGTGAGCGTGTGGGTGGCTCACAGTCTCCCTGCCCAACTTGATTGCTCTGCCTTTGTTCCCAGGGTCTGGATGACTACGGGGCACGGTCTGTGAGCAGGTAAGAGGTTTTAGGCTTCGTTGGGACTGTGGGTGGGTGGCCACAGACTTGGTTAGAGTAACCTCTCCCTTGGGACCTAGCTTTTCTTACTTTGGGAACCTTGACCCTAAGCCTGCCACCAGAGCTGGACCCACCCACCCACCCACCCGTCCTGGGCTCCTGTCTGCTCTTAGTACAGTGAGCCCCTCCTCCATCCTGCTGGGTCTTGGTGTCTTGGCCTGCTCTGCTCATCCCGGCAGGCAGGGCAGGGGTGAGGAGGGTTGTCAGCCGCCTCTAGGCCTTCTCTCCCTAGAACCAGGTAGATCCTCACCAAGGGCTGCGGCTGCTGCCTGCCGAGCACAGTCTTATTCTGGGTTCATCATCCTCCCAGAGGCCAGGTAGCCTGGCTGCTGGCTGGCCAGGGCTCTGCCGGGTGGCGGGCGGGCCTGCTGCCCCTGGCCGGCGGTGGGCATGCATCTGGGCAGCTGTCCTGTGCTTTGTTCCACAGTGGCAGTGGCACGCTGGTGTCCACAGTGTGAGGACGCTGACCCCAGGCAGCTGCTCTGAAGAGCTCCCCCCAGTCTCCACCGGTTCCCCTCCTCAGCTCTCGTTGGTTTGTTCTTGGGTTGTTTTCTTTCCCACCCGCTCCTGCCTTTTGGTTGGTGATCCCAGACTCTGAAATCCCCCAGGGTCCATGGTGCTGCTCTCTGCGCCCCTGCGCTCATGCCCCCAGCAGGTGTCCCCAGCCTTGAGCATTAACTGCCGGGTGGGGGCCTGCCGGCTGAGTGGCAAAGCAGCGTTGGCACCTGCTGCCCTAGCCCTGTGGTGTTCACGACGCACATCCCTTTTCTAAGGCTGGCCACGAGCCAGGGCTAGAGTTTGAAGAAAAAGAAAAAAATCTTTAAAAAAGAAAAAAAAAAAAGAAAAAAGAAAAACAGGAAAAAGGACTATTTTTTTTCCTAAAAACAAAAACAGATATGCATGGACTCCGGTGTACGTACTGTTATTCTGCATCTGACCCCCAGAGTTCTGGCGTCTTCTAGAACAGGACAGGACTTAGGGTCCTGGGGGGATCAAGCCCAGGGACCTTGACCTGCCTCAGGCCCCTTCCAAGGGCTGCACCAAGAAAAGGGGCCTGGGCACTTGGGAGCCTCCTGAGGAAGCTGACCACTCCTGTGATGGAGGCTGCAGCCCCAGCCAGGCCCTGCTCACCCCACAAGCCAGGCACTAGGCTTCTTCCTCAGCAGATACTGCTGGGCAGGCATGTGTAGAACAGAGTGCGGCATCCCAACACAGGGTGGCGTTACCTCATGCAGTGCCCTGGTGGGAGCTGGAGGCAAGAGCAGGTGCTGCCCGGCCACATGCGAACATTCCAAAGACCTCAAGACAAGCCCACCCACCCATCCACACATACACACACCTTTGGGGAATCTTTCTATGACCAGCCTTTGAGAAAGTCGCGGCGCAGAGGGTACAGCCAGCCAGTCAGGGCCAGGGAGAAGCAGGCTCTGGTCCAGCTCCTCCTAAGTTTCTCCTCTTGTGTGTGTCTTGGTAACTTTAGAAACAGGCACACTGGACTCAGTGGCTACTGGTTTTGTCTCTTCACACACTGAATTCTGGGCAGCGGAGCCCAAGGCCCAGTGGGCTCAGCCCTACAGCTGGCAGAAGCCCTTGGGAAGCTGCGGACGCGCCTCTGATGTGGTTAGCAAACCCAGCAAGCCTGCTGAGGACTAGGGCGTGGCTGGTCCAGTCTGACAGCAGCAGCAGCAGCTCAGACACAGACAGATCCTGTTTTATATTTAAGGAAAACACAGCCAGAACCTGGACCTGTGTAAAGAACTTTCTGTGTTGTTCTAATTTTGCTAAAAGATTTCAAATCCAGGGGATTCCATGTGCAATGGATGAATGTAGACACAAAACAGCAAACTTGTAAGAAGATGTAAAGTGCTAAAAAATATTTTTTCCTTTTTTCCTTTCCTTTTTTTTTTAAAAAAAAAAATCTGAACTGTGCCCTGTACTGCGGTCAACTGTTGGAATAAAGGCTTTATTTATTGCACTGAGTTGGTCTGTGCCTCCGTCCAGCTCTCTGGCATGTGTTGGGGCTGTGTGGGCCAAGCCACACCTCAGGGCACCCCAACTTGCAGCCCATCTTCAGTCTCTTAGCTCACCTGCAGATCATTCCAGGTCATTGCCAAAACCAGTCTAGGCTTGCAGACAGTGCAAGCCTAGATGGCTCTGATGGTGACACCCGGGTGGCCTGCCACCCTGGCTGAGAAAGCAGGGCTTAGAAGGGCTTGGTGCAGACTCCTAGCAAGAGTGAGCCCTCTAGTCCCCATTCCCCACCCAGCAGAGAGGTGTGTTCAAGGTCCCTTCCCAGCAGGTGTCCATCCTGCCTGGCCTTCTGCCTCCTGGTGTCCATAGGTACCCGTCGGCTGCTCTAGCTTTACCAATAAGCCTTGTGTTTCCTTACAGCGCGGATGTCGAAGTGGCCAGATTTTGAGCTGCCCCTGACTAGAGTTAGTAAGTTGCCCTGGTCTTTTGCCCATCTGTCTGCATCTATAATGGCTATGCCTAGACCCTCTCTGGCCTGAGTCAGGACAGCCTCCACAGGAAGGGTCTGGGCCTGGGCAGGGCTTGGGAGCCTGCTGAGATGCCTTGCTCCGGGCGCTGGGCCTTCCTTCCACCAGTTCCCTCCTCTGGCTTGTGGTTCACCTACCTTCCTTCCGCCTGGAGGCTTGTGGTTCTAACCCTGCTCCATCGCTGCCTTCGCTGCGGAATATGGAGCTGGCCTAGATCTGTTCTCTCCTACCCTACAGGGTGGTTCGTCACAATCATCGGGTGGCCTGGGGGAACAGCCTCCTCCCAGTCATGCAGCATGTACCTGGGTATTCATGTGGGATACCATGGGGTTGGCCATGAGTCCAGCTGTTGAGTACCACAGCTGAACTGAGCCTAGGTCAGGTGACTTCTGCCGTCAGATCTTGCCTCTCCTGGTTCCCTCCACCTCCCCTTATGGCTACAAGACACTGGCCTGTTGCTTCTTCCCTTGGTACTGGAGAAGTGGGCCGAGGTACACCACTTGGGGCAGGGAGGAGGACACTGCTGGGCATTGTCCACCACGGTGCAAGGGGCTTTTATTCCCTTCCCACACCATGGAGCGGGTGGCATGAGAAGCCTTGACCTGTGTGTGTCCCTTAGCAAGAGTGGTCATTATCTCCCTGATAGTCACAATGATGTATTTCAGCCCAGAACTCTCTGTTGCCTTCCTGGGTGTCTGTAATGTGAATTCTGGAGTAAAGTTCTGCTAAGGTTTACAGAGAGAATGAAATGTCCTTGGCAGACTCTAAGCCGGCCACCTTCTCCTGCCTCTGTCTCCACATCCAAGATGTTCCCTGGGAGGTGTACTTCTCCTGCCCAGCCTGGCAGACCCCCTACCTCACTGCCCACTGGGTCCCACTAAGCCAGTTAGGAGCCATGAGAAAAGGCTCAGAAAAGCTGGTGTAGCCTCTTCTGGGGACCAGGTCTCTTGTGTGTGCTAGGACTGAGACTTGGATGTGGTAGGCATAAGGCAGATGGGTTTGCTAGTTCAGCGCAGTGCTGCTGCGACCCTCCAAGCAGCTCCTGGCCACAGACTGCCTAGCCTTCCAGCTCACCTAGTGGGATTGAAGGGTGCCCCAAAGCTACCTGTGGTTGCTGAGAGTTCTGAGGGATCCCCAGCCCTGTGTAGGTAGAAGAAATGGAAACCCACAGGTGTGCACAGGTCCTCCGTGGGGACTTGTTCTTGGTGGTATCCATGCTCTCGCTCCATGGCTGACAGACTACTGCAGTCCAGCCTCTCAAGGTTTCTGGTACAGCGTTGTTCACAGATGGATGCAGGAAGTCCAGGGAGAGAACTGATGGGGGCCCCGCTACCCCACCTGCTTCCCACCACACTGCCAGATCCATTTGGCATGGATGTCACTGGTCATCCCTGGATGCCTGGTCCTCCTTTCCCCAGTTGGTGCAGCTTCAGATGTTGAGTCCTCCCACTCCTGGAGATAGGCTGTGTGCCGGCCATGCCCCCTTCAGGTTAATTTCACTAGTCTAGTTGGAGTCTTTGGAAGGAAACATGTCCCCAGATTCTGCTAACAGGAACATGTACAGAGCAAAACTTTGTAGTGGCTTTGGTATCTGTAGATGGTTCTTTGTGCTCCAAGTGGTCCCATGGCTTTGTGAGGAGGAGAGAAGAAAATGTCTCAGAGCCTCTTGGGTAGGGCACTCTGGATCGGAACTTTCACTCTGGTCCTAGCTGGTAATAGATGTCGGTGAGTAATGGCGCGAGCCAAGCACGGCAGGTGTGAGGCGTGTTCTGTAGGTATCTCAGCCGTTCTGCCCTGCTACCTGGGGCAACCTGCTAGTCGCTCTACTCTATCCCATTCCCTCAACAGGACAACCCGTCCTTATTCCAAGCCTCCCCAGAGCTGTCGCCCTCTTTGGGAGCCCTTCTGTAGACTCTGGAGTGGGCCAAGGGCAGCCTGGCCATGCCAGAGGCTGCAGCTAGCAATGGCCAGGGTCTGTATCTCACCTGTCAGTCAGCCCCTCTGCAGCCACCTTGAGGGACTGCAGCCACCAGCACAAAAGCAGAGAGAGGTGTAGCCTGGCCTGGGACGGCTCCGGCTACAGGCATAGCAGATAGTGGCCCTTAATCCCTGGCTCTCAGCAGAGGCGAGTAGCAGTGGAAACACAGACACCACCTGGGAGGGGACAGGGACCTGGGCCTCTCTCCGTGCTTCACCTTTAAAACCTCTCAGTCGAAGTGTTTGAGATTTTTAGAAAATGTCCTCTTCAGGAAAATGTAGGGTGAGACTCTACCTATGTAGGTCTTCTCAGGAAGCCTGAATGGAGAGCCTGCTAGCCCACCCTGGGCCTGCCACCAGCCCCGGGCTTCTGAGAACCCACCAGGGCCAGAGGTGACCCCATTGCAGGTAATGGCTGTAGAGCCAAGCGCGCTTCCCTAGGAGTGCAGTCCTGTGCCTTGCGAGCCCCCATGTCCACATGCCATCTGTGCTGTTACTGTGGAGCTGCCTGGCCCTTCCCACCTGCTGCCCTGTGCTGTTCCCACTGGAGTGGGTCCTCCCAAGCCTGACAGGGACAGCAGAAGAGGCTGCCGGGAGGGCTGGGCTGGGGCAGCCCGTCTGTGCCCATCCATTCCATCTCCACGTCTTGTCTTGAGTCATGTTTGTGTATCAGCTGTGGCCCGAAGGGCACTTGGGTGGCGCAGCCACCTCTCAGGGAGATGGCTAGTCCCTCAGCAAAGGACCTGGCCATCTGGCCAAGGTCCCGGTGTCAGTCCCCCACCTGTGGAGTCAGGGCACATGTACCTCATGTCTGTCATGTCTGCGTGTCTACAGCGTGCCTTCTACGGCGCCCTGCATGCCTGGGCTGGTTTGTGTGACCTACTGGGCCCTGTGCTCTGCACGGGAGCAGAGCCACTCCTTGGACTCAGCCTGGGTGTGGGAGCTTACCAAACCACAGCGAGCCTTCCTTAAGAATGGGGTCATCCACCCCAGGTTGGGAAGGGAACAGCTGGTCCTAACCATTCTGCCCACTCTGCTGCCTTTCCTGGAGCATGTAAGGTGACAGTGGGTAGCTGTGCTAGGGGCTAACGGGTCTTGAGACAACACCCAGCTCGATCCCTGGTTTCAAGAGTGGACCACTGGGCTCTAGTAGTAGGGGGGAGGGTCCCAGGAGCAGCCTGATGGCCCAGCTTAGCCAGGGCACCAACCCAAACTGAAACTGCTCTTCTTTCCCCAGGAATCCCTTCGCCAACGTCCATCTGAAACCAACAGTGACCAATGACAGATCAGCCCCTCTGCTCAGCTGACGGGCTCCTCTGCATCGACACTCTGTCCCCACCTGCCAGCTGAGGGTGATCAGGGCATGTTCCTGTCCAGAGAAGACCACAATGCCCCACTCCCTAGCCTCGCCTCACATCGGCCCAGCCTGGGCTGGATCCCAGGTGTTCCTGGTGAGGTGGCTGCCTCAAGAGGCCGATGCCCCAACAGAGGGGCCAGCACTTGGGCAACAGGGACCTCTGATCCTAACTGTGGAACCTCGAGAGCCTCTGGACACAGAGAGGACATTCTGCCGGCTTGCAGGGAAGGGAGCCTATTCCCATGCTGACTTTTAAACTTTTTTATCTCACGTGTGTCTGGTCAATAAACGTGTGCTCACCATGTGTAGTGTGTGGTCTGTTGTGCTATTGTGCGGAGAGGAGAGCCGGCCGCAGCCCAGCTCTCCAGCTACTTCCCCACTTCAGCTAAAAGGTAGGATCTCTATAAAACCCAGTCAGGCCCGTGTTCAGATGCAGCGGGGTGAGGAGCTCGGCTGATGGCAGAAGTCGTAGGATGCAGGGAAGACCCAGGCAGACTTCCTTCATCAGCTCCCCCAAGAAATCCTCTTGGAGGCACCCACCCATTATGTAGGCATACAGGCCAGCCCCAAAACAGAGTAGGGAACACAGGAGTCCCATTGCCAGTCTCCTGCCTCTCACTCCACAGTGGCCTGGCTCAGGACAGACTAGAAGCTAGGCAGATGGCTGCCCTGGAGGTCCCCTTTCATCCGACCTCAGAGAGCCGTCTTAAGGGACAGGAGAGGGTTGGAGGGACCTCACCTGGCATATGGGGGCAAAAGAGCTGAGTTCCCCATCTACCATACCGCAGGGTGTTAGCTACAGACCCCAAAAGAAAACACTGAGCACACAGGCTGTTTTTTTCTTAGCTTGGTTTCTCTTAAAAAACAAGGAACAAGAAAATCATTGCACCAGCGTCCATCCTAAGCCTCAAACTAAAAACAGAAACAAAAACAAAACAGAAAACATTGCCCCCACCCCCAAAGCAACAATATACTTTACATGTCTTTGGCAACAATAACTTAGAATCGCCCCATTTTCATTCACTCCAGCAAGTTACAAAAATATTCCCTGTACTGCCCACCCCAGCCCTGTTTTCTCCCAGCCCTGCCTGCAGGCAGGAGCCCCCAGTGGCTGTAGGGTACCCCCTACTCTCCTCTAGCCACCAGGGTGTGGGGCAGGCACTGCCCTGCAACAGAGAGCTGCCCACACTACCCTGCAGAGGGCATCTCTGAGGCAGCCAGCCGCAGCCTGGAAGCCCCTACTACTGGGCAGGACCTGGGCCAGAACAATCCAGACCGACCCTGTGGGGAAGGGCGTCCACAGAGGCAGTGAAGGGGAAATAGCTACGGACTCTGAGATAAGGGCTTAGAGCCCAGAGGTCCAACCTTGCTCTGAGCAAACCTAGACCCAGGTAAGAAAGGTGGGGGAACCCAAAAGGGACCTGCAGGCTTAAAGCCATCCTGAAACCTGGCCAAGTGCCCTTTGAACACATGGCAGGACCTAGCCAACAAGGGCATACAGGCCCTTGGACTGCCTGGTCCTGGCCTGGCCTGAGGCCAGTTTACCACCAACAGACATATTGGGGAGGGAGGCTCTTCCCAGGAGTGGAGAGTCACCTAAGAGTCAGGGGGCCCTTCTTGAGTGTGTACACATATGCTTACAGACACCCATAGACCCCCCCAGGCTACAGGTATCTCCAGGGGCTAGCAGCAAACCCCAGCATCCACTCGGGACACATTCTGTCATCAGGGCAGCACAGAGAAGGTACACAGCCCAATGCGTCTAGGGCTAGATACAGGCCTCTTGTCCACCTGCTTCTCCAGGATGCTGTAGGGTGCCGGTGGTCCCCATTCATTCCCAGTCAGTCACCAACCTTGTCGCTGCCTGGGCAGGATGGCAGGGGCTCCAGTGATGCCAGCCTCCGAAGGGTGGGATAACCTGGGTCTCAAGCCTCTGTGTATCGGCCCCCAGCACCTGCTGCTGGGCCTGGTAAAGGGGGTGCTTTGTGAGCATGTGGGGAGATACCAGACAAAGGTTCTCACACACCAAACCTCACCCACACCCACAACTGCCTGGCCCAGTGGCAGGCCTGTTCAATGTGGTAGGCCTGTGTCTAGATGAGGGATAACACACTTACACACACACACACACACACACACACACACACACCTGTAACCCAGATCCAAAGCATTTGTTTAGCAAATGTTCCCATGTCTGTGCACACATGGAAACTGAGGCCAAAACAAAGAAGGCATGGTCAGAGTCATGCAGGGACAAGGGTGACAAGTTCTTCCCTCAAGGTTACCACAGCCAGGGCAACTGGGGAGGAACAGGCAGAAAGGACTGGTCAAAACTGTGAGTAGGCTATGGGAGGAGAACCTGGTAGAGAGGATCCTACCAGGGTTAGGCAGTTGGAGGGGGCACGTGACTTGACAAAATGAACTATATGATACCACCACCTGGGTAAAGTCCCTACAGAGACTTCTAGCAAGAACCTCAGATTAGAGATGAGCCATAGATGGTGACAGGAGTACAGACCACCATGCTGGGAATGTTCTAGTAAAGTCACGGGAGTCTACGGTCAGACTGAGAAGAGAACAGATGCCCAGCATCCTGCTGTGGAGGGCGGAGTGGCAGGCCCTGGGCCCAGGAGGCAGTAGGCCAGGTCCACCAGAACATAATGTCTGCCCAGAGGCCAGGGGGCAGACACTGTTAACAGGGCAATGTCCAGCAGACCAGAGGCCACCAAATCACCCCTCATAGATCCCCATTCGTGGTGTCCCTCTGCTCCACCTCAGCCCCCACCACACTCATACCTCCCACGGACTGGGCATCTGAGTCAGATATGTGGGTGATGGAAAAGCGGGAGGCAGGTGTGGGTGACACGGTGAAGCGTGAGAAGGGCGCAGCTGGCGTGGGAGGCGCCGCCAGGACAGGGTCAGCAGGATCCAGCTCAGTCACCAAAGCAGCCTTGCCGGGCACCAACGGGAAATCACCATCCCATTCGAACCTACTGCCTGCAGGTCGGACCAGAAAGTCACTTCTGTTATGTGACCCACCCCAGCCCCCACTTAAGATGATATGGCGTCTTGAATCCAGACCTTCCGTGACAGTGATGTCACTCTCTGGCCCCCAAAACCTGGCTCACCTGGTTCAGGAGCAGAGCTGTCAGGAGAGTGGCCAGCCCGCAGTGGCAGGCCGGTGGCACTGGGTGAGCTGGGGCCACCCTCCAGGAACGTAGGGAGTGATTCCTTTGTGCTGGGAAAGGGCTCCCCAGTCTCTCGGGTGGGGCTTTCCTGGAGGGACAGAGCATAGTGTGTGACTCGAGCCGCCCAACCTCCCCCAGCTCTGTGTATACCCAAAGCAGCAGCCCACCTGGTCAAAGAGGTAGACCGTGACATCATCGAAGAAGGACACAGCCTTCTTCTTGCGCTCCAGGTCGTCACAGAAGGCCTCTGACAGCAGGCTGGGCATCTTCAGCAGGCTGCGTAGATTTCGGGCACTCTGGCTCTCAGCCACCACCACGGGCACCGCTGGCGGCTCCTCCTCGCTGTCCTCACTGGGCTCCTGGACGCTGTAGCACCGGAGCTCCTCATCAGACTCCTCGCTGTCCTCGGTGTCCTCATCCTCCTCCGGCCGGCCCTCCAAAGCCCCGGGGTGGCCAGGCAGGGCCAGGCAGAGCGGGGATCTGGGTGTGCTAGGATTGCCCATCTGCCCCTGCTGGGCTCGCCCTGACAGCTGTCCTGAGGGACCCTGGGGCTCCGTGCCACTGCCTTCTGAGATCAGTGGAACGGAGGTCAGCGGGAAACATTTGGAATGACTTGGGCCGGGCACAGGCTGCACTCCAACTGGGCCTTGAGCCCCGAGAGGCTCTGGCCTGGGGACTTCTGGCAAGGGCTCCTCTGACTGCTGTGGAGGGGACAGCACCTCGCTGGACACTGCAGACCTGGGAAAAGCCTGCACAGACTGATGCCCTGGGCTAGGTGGGCTCCTCAGGTCTTGCTCCTTTTGGGAGTCCTGGATCCCACTGTGCTTCTCAGGGCCAAAGGTGGGTTCGGACTCGGCATCCAGGTCTGAAAAGTAGGCAGAGTCTCGGTAGGGGCTCTTCTTGCTGAGGCCACCAAGGGAGACAGAGAGCAGAGGATCGGGCCCTGGGCTCTCACCCTCTGAGGCTGGCTCCCCAAAGGCCTCAGGCTCACTCGACTCATGGGCCTCCTTGAGCACAAACTCAGGAGACTCATAGTTCTCTGTATCATAGCCACTGTCCACGGCACGGGGCTGCCCGCCAGGTGGACCAGCAGCTGATGGGCTTAAGACCTCACAGCCACCATCACTGGCTGAGGACGGTATGTCCAGAGAGTCCAGGGAGTCAGGGGTCCCCACCTGCTTCTGCAGACTGCGCAAGGCTGGTACTATGCCTGACTTCTCCGTGTGTGGGCCGTCACTGGACAGGTCGGTGAAGACTCCTGATGTTGCCTCGGTCGTGTCTTCGTCCTCGCTGCTGGGTGCCTCTTGCCCCAGAGAACTGCCGCTGCTCTCCAGGGTGGGGGCTGGCTCAGGGACGGTCACCCAGCTGCCAGCAGCGGGTGTGGGTGAGGCAGGTAGGATGTCAGGAGCGCTTGCCTCCTCCGAGGGAAGTGAGGCTCCTTCACAGGATGGGGAGGGGACGGAAGGAAGGGGTAGCTGGGGTTCAGCAGATCCCTCAGCCTCCTGGGCAAGTTTGGGTTCCACAATGGGGTTCTCAGCCCCACCCACAGCTCCCTCTGTCCAAGGGGATGTGATGAGGCAGGCAGCAGGTGCCAGGCCTTTGGCAGGACACAGGGGGAGCAGGTTGAAGGGACGGCTTGGCTCCTGACCAGGGGAGACTGCTACTAGCCCAGGGAGAAAATCTCTGGGATCCTCCTGGGACAGGAGATGGCCCACCTCAGGGGAGGCTCGAGGGGTCTGCTCTAAGCTGGAGCAGTCGTCCCTGTAGCTGTCTGTGAAGCTGCTAACATAGCCAGGATCCCAGGATTCTGGGTCGCGACTGGCACTGTTGTTGTTAGCTGACATGTTAGAGCTCCAGTGTCCACACTGAGCGGCCAACCCCACCTTCCCCTCCTCTGGCTCCTCATCACTGGGGGAGGGCTGGGCCCCAGGACTCCCCGAGGGAGATGCACCCAGTGGGTCATCAAAGAAGGGCGGGCAGAAGGTAGCCACACCCCAGTCTATGTCTTCAGCTGGCAACATCGGGGTCCCAGGAGAGGGTGAGCGTGAGGGACAGGGTGACCCTTGCCTCCTATGTGAATGGTGGTCACAGGGGCCCCACAGACCCTCAGTTGGGGGTGCATGGCCCAGCAATGGCTCCATGGCAAGGGACGCAACAGTGCTCTCCTCAGAGTTATTGTCCTGGTCAGTCACAGCCTGGGGGCTGGGAGCGCAGCCGGCACAGTCTGGATCGTGGCCAGCAGCAGGCACTGCCCCCTCCAGGCGGATGAAGTACTCGCTACCCACTGAGGGGCTGTGGGCACTGAGGACTGGCACCACACCCGGCGGTGAACTGTCAGGCGCGCACAACTCCTGCAGGCGCGCTGCCGAGCCTGGGCTTGATGCAGCCCCCGAGGGTGGGTACTCCTCAGCGCCACAGCCAGCCTCCCACTTGTATTCAAAGTTGAGGCCGTGGCTTGTCTCCGTGACCGTCAGCACGTCATCACTGTCCACGTGAAAGCCGTCGCTGGTGAACCGCTCCAGCAGCGGGAAAGACGAGGCAGCGGTGAGCTCCGCGGAGGCGGCGGTGGCAGCTGCTGGGGCTGCAGAACCCGAGCCCAGGCCCGTGCTGCCCCCGGGCCGCAGGGAGCGCCAGCGCCGCTCAAACTCCTCCTCCAATTCTGTGGTGCCCTTAGCACACAAGTAGGACAGCAGTAGATGAACCTCTTCAGCTGTGGGCCTCTGCTCTGGCTGCAGCCAGCAGAACTGCATCACCTCGTACCTGCCGGGAGGCCCTCATGGGTGGCCCTGGCCATATCCAGAGGCACGCTGGCCGGAGTATAACCTGCCCTCCGGGGACAGTCCGTTCCCCCATGCTCAGAGTACCCTGGGAACACTAGGGGCAGTCAAGGCAATCTCCCAAGGCAGGCCCAGAGGCCTGGGAAGGGCCCTGAATTAGGGTAGTTCAGGCTGCAGAGACCCAGAAGCCCTGTAGAGGTGGACCGAGCAGCCCCAGGCTGTAGGGCTCAGCCCCCTGTGCCCCTCTGGCCTGCCTGCCCAGGGGGGTGGGGTCCTCACCATCGATCAGATAGAGCCAGCTGCAGCTGGGGCTTGGGCAACTTAAGCTGCTGCTCCCGGACGGCGTAAGCCAGCACCTGCCCGTCCGAGTGCTGGGGGTACGGCTGCGCACCCAACTCGAAAAGCTCCCAGATGGTCACACCCAGGGACCTGCGGGAGCAACCACAGTGACACGTGGCTGAGCATGACTGCACAGAATCCCTGAACACCTGTCATCATGTCAGCCTCTCTGGGACTGGACCTCACTACGCCACAGCCGCCCCTCTCTAGAGGCACAGATGCAAGGCAGAATCCTGTATCCCTTAAGGACAAGTGGCCTTCAACAGCATCTCAGGATGATTTTTAACCAAAATATGGTGCCAGTATTGGGGGGGTGTCAGTTGGTCCTATCCTGAAGGCCCCATACCCTTGACTGTCAAGGCAGTCCCCCCTACACACACACACACACACACACACACACACACACACACACACACACCAGTATAGGAACCTCAGGAACCCATCATCAACGAAGTAGCCTGTAAAGTGCCTCTCATGGCCACAAGGTGGCAGGCATGAGTACACTTTCCCTGTGTGGCAGCCCTAATCCTAGCCAGAGAAGGAAGTCAAAATGCTGGAGCAGGGGGCAGAACTGAAAGGCAGCATCCCCACTAGAATAGCTGACGCCAGCGCCATCTGGGGAGGCGGCATCCCAAGGCCCTCCCGGCAGCCCTGCCTGCGCTCACCACACGTTGCTGCTCTTGGTCTGGTCCACCACCAGCAGGTTGCCGTGAACCTCGTCCACCAGCTCTGGCGCGATCCAGCGCAGCGGCACCCACAGCTGGTCAGCGGTCACGAGATAGTCTTCCTGTAGCACGCAGGGACAGGATGGGAGTGAGCTCCGCTCAGCAGCTGCCCCTGCACACGGGCCCTGACGGCCTTACTCACCCTGTATTTGCAATGCGACAGGCCATAATCACCAACCTTCACTGTCAGGTCAGCCGTAAGCAGGCAGTTCCTCAGGGCCAGGTCACTGCGGAGTGGAAGGCAATGTCAGCAGAGTGTGCCAGCCTGAGTGAGCCCTGGTGGAATGGTTGGGCTCCCGGGCACAGCCAGGCAGACCGACAGGAAGGGGTGTCTGAGGGGCCACCCACTTGTGCCCAAGTTCTGGCTCCACACCCTGTACTGGCTATTTTGGAAGACCTGTGTGGACTTCAATGCATTTCTAATACTTCTTCTTCTTCTTTTTTTTCTTTTTTTTCCAGACAGGGTTTCTCTGTGTAGCCCTGGCTGTCCTGGAACTCATTTTGTAGACCAGGCTGGCCTCGAACTCAGAAATCCTCCTGACTCTGCCTCCCAAGTGCTGGGATTAAAGGCTTGCGCCACCAAGCCCGGTTTTCAATGCACTTCAATGCATGTGAAAATCAGGCAAAAGATGCTCAAGGACGACCCCCCCCCCCCAGCAAAGTGCTGTCTAACTGCACCAGAGCCCTAACCCGCTCCACCCTCTGTCTGATCTGCCCAACAAGGGCCAACAAGCCATGGAGCAGAGAGTCTGCAGTGTCCTCTCAGGACCCTCACCCTTCCGACTACACTCCACCATCCCAGTCCCCAGGAGGTAAGAACTGATGGAGAAACCGAAGCCCGGAGTGTCTCAGAGGGTCCTGCCAGCAGTCAGAGCCCATGTTCTAGAGTGCAGCCCTGCCTGGCCTGCTACACAAGCTGGAGCCGAGGTCTAGAACAGTATGGACCACAAAGGCCCCTTTGTGTGGAGGATAAAAATCACCAACTCAGTGGGAAGCCTGGAATGCCAGGCTCTGTATAACTCTTGCTTGGCTATAGCGCCCCACCCCCAGGTGTTTGGGGTACAGGACAATAGAGTGCCACGGGACGCACCCTCATCTGCCATACTGGCTGTTCTGCTGAGAGATCTCTGGATGTAGATGGGGCCACCTTGGCCTGCCTCTACCCCAGGAGGACTGTGTCAGGGGACAGGGTGGGGTGACCTGGGTCCATGCCTATGGGTGGGGCAGCTGGGCTAGGCAGCAGGCAGGGCAGGAGGCTGGCAGCTGCCCTCTTCAACAAAATCACTGATGCTGGAGTCACTGTGCACCCACTCAGCACCAGGATATTGTTGGGGAGGACGGCCTGTGCAGCGTTGGAGCTGGTGGGCCGCTTGTCCGTTGCCACTTCTTCCAGCATGTGCCCCCAGCTCATGGGAGGCTGGGCATCCTGGCCACCAGAGGCAGGAGAGAGCCACCCCTCCCACTACAGGGCCAGCCCAGCCACTCCCTTTGTGGCCTGAGGGAAAGAGGCTGGGGTTGGTATGGAGCCCAAGTATGGCTGACTGCTCTAGTAGACAGGATGGGTTTCTTCATTTAACTGTCTGCAAGGTGAGTTTCAAATGCCAAGTCTTCACAATTTATTTCATTTTGAGATGGTCCTGCTACATAGTCCTGGCTATTCTGGAGTTCATTAGGTAGACCTAGCAGGA
GF1 -1 -1 1 CGGTTTACTCTGCTATGGTGTCAC
GF2 -1 -1 1 GTTAACATTCCTAGTTCCCCTATG
GF3 -1 -1 1 CATTGTCTCAGGACGGAGAAGAAC
GF4 -1 -1 1 GCTCAGGAGTGTGAATGCCTCCTATG
EX5 -1 -1 1 CAGCTGATCCACAGGCCACCAGAC
EX52 -1 -1 1 CACTTACCTTGCAGCGCATGGCGTGCGAG
EX3 -1 -1 1 GTCTGGTGGCCTGTGGATCAGCTG
EX32 -1 -1 1 CACCTCGCACGCCATGCGCTGCAAGGTAAG
GR1 -1 -1 1 CAGACCTTCCGTGACAGTGATGTC
GR2 -1 -1 1 CCAGGTCCACCAGAACATAATGTC
GR3 -1 -1 1 CGTCTTGAATCCAGACCTTCCGTGACAG
GR4 -1 -1 1 GCGTCTTGAATCCAGACCTTCCGTGACAG
Comments:
Target: otter_06_09_21 OTTMUSG00000004053 -- 119829903 -- 119831251 OTTMUSE00000043384 -- OTTMUSE00000043379
creating candidate regions
attempting to insert candidate regions into db
done inserting candidate regions
running aos on us and ds
running aos on gaps
finished running aos
AOS Produced 8 oligo candidates from u/d regions
AOS Produced 14 oligo candidates altogether
inserted results of aos runs
Aligned target to NCBIM36 assembly: chr: chromosome:NCBIM36:11:1:121798632:1, start 119831548: end 119832897
Found best 129-bac on NCBIM36: bMQ415e13
Found 9 RP24 black6 bacs on NCBIM36
Entered all non-repetitive oligos
Sequence count unchanged by blasting
finished aligning oligos to bac
REJECT (1) gap pair G5:11:119835751:119836750_634 G3:11:119824403:119825402_724
REJECT (1) gap pair G5:11:119835751:119836750_634 G3:11:119824403:119825402_719
REJECT (1) gap pair G5:11:119835751:119836750_634 G3:11:119824403:119825402_274
ACCEPT (0) gap pair G5:11:119835751:119836750_571 G3:11:119824403:119825402_724
ACCEPT (0) gap pair G5:11:119835751:119836750_571 G3:11:119824403:119825402_719
ACCEPT (0) gap pair G5:11:119835751:119836750_571 G3:11:119824403:119825402_274
REJECT (1) gap pair G5:11:119835751:119836750_639 G3:11:119824403:119825402_724
REJECT (1) gap pair G5:11:119835751:119836750_639 G3:11:119824403:119825402_719
REJECT (1) gap pair G5:11:119835751:119836750_639 G3:11:119824403:119825402_274
DESIGN COMPLETE
U-type: U1
D-type: D1
Creating display features: mapping to reference assembly
Created display features
Inserted sequence arms between oligos

webmaster@sanger.ac.uk

Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SA, UK  Tel:+44 (0)1223 834244