High Throughput Gene Targeting: Create Design

This custom vector design tool is provided by the EUCOMM consortium as a service to the research community. When using this tool, the user agrees not to submit more than five designs per day for creation without prior discussion with the High Throughput Gene Targeting Group at the Sanger Institute.

Design Type Oligo Select Method Artificial Intron Design
5' retrieval block size U block size Min 5' spacer Critical Exon Min 3' spacer D block size 3' retrieval block size
 
       
Subtype Domain Disrupted
Gene Build Gene
Start Exon End Exon
Target Start Target End
Primer Length Design Comment
Created by
Valid After Annotation
not done
oligos on fwd strand oligos as ordered View gene and design in Ensembl UCSC BLAT recombineering primers
Design ID: 35367
Chr: 2
Strand: 1
Status: Ordered
BACs: bMQ429l08 : RP24-87K1 : RP24-224N13 : RP24-198A4 : RP24-340M20 : RP24-160A11 : RP24-352N11 : RP24-75E17 : RP24-75M17 : RP24-358A23 : RP24-556G11 : RP24-143P12 :
Instance: Plate 25: Well D12: BACs bMQ429l08
Instance: Plate 26: Well D12: BACs RP24-224N13 RP24-87K1 RP24-340M20 RP24-198A4
Oligos on GRCm38:
Type Start End Length Seq
G5 153351646 153351695 50 TTCCAGAGCTGCTAAGGTCTTATATATTATTACACATTGATGTTAAAGTA
U5 153356570 153356619 50 AAAAGAGGGCATAAGTATCCCCCGTAGCTAACAGTGTTAATAGGTTGTGA
U3 153356668 153356717 50 TCGACTCTTGTTTTTGTTTCTTCAAGGTAGGAGACAAGTTTCTTCACTCT
D5 153357292 153357341 50 ACTAATGTCTTGGTCCTCAATGGTACTCTGAGATGCTGTAGTCTTTTTTT
D3 153357466 153357515 50 CTGGGATTAGAGATGCTGTCTCTTAACAGACTATTAGGAGTTACTAAGTT
G3 153362375 153362424 50 TATAAAGAATTTATAAAAGACAGACTATTTGGGGCCTTCAGTTTCAGAAG
Oligos:
Type Start End Length Seq
D5_D3 153620192 153620315 124 TTGGGGGGGGTGGTGGTGGTTTGGAGACAGGGTTTCTCTGTGTAGCCCTGGGTGTCTTGGAACTCACTCTGTAGACCAGGCTGGCCTTGAACTCAGAAATCCACCTGCCTCTGCCTCCCGAGTG
G5 153614496 153614545 50 TTCCAGAGCTGCTAAGGTCTTATATATTATTACACATTGATGTTAAAGTA
U5 153619420 153619469 50 AAAAGAGGGCATAAGTATCCCCCGTAGCTAACAGTGTTAATAGGTTGTGA
U3 153619518 153619567 50 TCGACTCTTGTTTTTGTTTCTTCAAGGTAGGAGACAAGTTTCTTCACTCT
D5 153620142 153620191 50 ACTAATGTCTTGGTCCTCAATGGTACTCTGAGATGCTGTAGTCTTTTTTT
D3 153620316 153620365 50 CTGGGATTAGAGATGCTGTCTCTTAACAGACTATTAGGAGTTACTAAGTT
G3 153625225 153625274 50 TATAAAGAATTTATAAAAGACAGACTATTTGGGGCCTTCAGTTTCAGAAG
G5_U5 153614496 153619469 4974 TTCCAGAGCTGCTAAGGTCTTATATATTATTACACATTGATGTTAAAGTAGCTGTCCTTAGAATTGAGAATTAGAATATTTTCATGTAATTGTGGCTTTTTTTCCCCCTAATTGCAGTGAACTTTCAGTGTACTGCTAAGAGTGTGATTTGAATCTGAAGTAATTGTTTTAATGCCATGTTGGGGCTTTGCACTTCTGCCATCGAGCCATATCTATAGCTCCAGAGTCATTTTGATAGTGGTAAATCTCTGGGGCTGGAGAGATGGCTCAGCGGTTAAGAGCACTGACTGCTCTTCCAGAGGTCCTGAGTTCAAATTCCAGCAACCACATGGTGGCCAACAACCACCCATAATGAGATCTGATACCCTCTTCTGGAGTGTCTGAAGACAGCTACAGTGTACTTACATATAATAATAAATAAATCTTTTAAAAAAGAAAAAGATAGTGGTAAATCTCACCTGTCACTGACAGCTCCTCATAGCAGGCCATGCTACAGACTAATGAACGTTTCACACTGAAATCAGAACGTTTCTGTTTTCTCAGGTGTTAGAAAACTACTCAGATGCTCCAATGACACCAAAACAGATTCTGCAGGTCATAGAGGCAGAAGGACTGAAGGAAATGAGGTTTGTATTGCTCTTACTGTTTAAATGACATATGTGCCTGTGAGAGTCATCTGTTGGTCTATCTGTGGTTGTGTATGTAATGGTAGTGTATCTGGTGTGTATTTTGAGGGTGGGAGTGGAGTGGGTAAACATCTGTTTGTTTACATCAGAAATACAGTCTTTCACAAGACCTTACCTAGGTCTTGACTTACAGCTAGAACTGGGTTCTTCTTTTCTTTTCTTTTCTTTCCTTTTTTTTATTTACATGAGTACGCTGTAGCTGTCTTCAGACACACCAGAAGAGGGCATCAGATCCCATTGCAGATGGTTGTGAGCCACTATGTGGTTGCTGGGAATTGAACTCAGGACCTCTATCAGTGCTCTTAACCGCTGAGCCATCTCTCCAGTCCGGAGTTCTAACTTTCTAATACAGTTTTGTTTTTTTGTTTTTGTCTTTTTTTATTTTTATTTTTATTTTTTTATTTTATTTTATTTTTGGTTTTTTGAGACAGGGTTTCTCTGTGTAGCCCTGGCTGTCCTGGCACTCACTCTGTAGACCAGGCTGGCCTCAAACTCAGAAATCCGCCTGCCTCTGCCTCCCAAGTGCTGGGACTAAAGGCGTGCGCCACCACGCCCGGCTCGTTATTTTGTTTTTTAAGGTAAGGTCTCATTGCAGCTTTACCTTCTCGTAGACTCTTGTTTTCAAGTTTTGGTAATAGAGAAGGAACAAATATATATATTCTTTTCTCTATACTCTTTATACACAGGCCTGAAGTCTTTTCCTTTCTGATCCAAGAAAAATGGTCTCGGTGCCATTACACCCTCTATCTATCTACTCACTAATTTAGTCATTCACTCCTGTTTCTAAGTCTCTTGCAGCCCAGGTGGCTTCCAAATTGCTGCTCAGCTGAGGGCTTGCCTTGAATTCTGATCCTCATGTTTCTACCTTGCCATCCACAAGTAGCTAATTTAGCCAGTTGTGATGCAAATATACTAAGGAGTAATTTGTGGAATTTGATACAATGTAGTTTTCCTGGAGAACAAAAAAATACAGAAGTAATTGGAGGCATAAAAACCAGGGGTGCCTTTAATTCGGTTCTTTTCTCATCATTATACCAATTTCTCCTTTTTTACTTTTTTTTATTCATCTATATCTGTCTATCCATTTATTTTTTTTGAGACAGGATTTCCCTGTGTAGCACTGACTATCTTGGAATTTATTCTGTAGACCAAGTTGACCTCAACTCAGATCTACTTGCCTCTGCCTCCCAAATGCTTGAGTTAAAGTCATGTGCCACCTCTACCCAGTGAAAAAAACCTTTTTATTGTTATTGTGTGTGTTTTACACTAGTGTATGTCTAAATGGTGTGCATTTACTGCCTATGGAGGCCAGAAGAGGGCATTGGGACAACTGGAACTGAAATTACATACAGTTGTGAACTGCTAATGGGTACTGGAAATTTGAACCCAGGTCCTCTGGAAGAGCAGTTAATATTGTTCTTTTTTTTTTTTTTTTTTGGTTTTTCGAGACAGGGTTTCTCTGTGTAGCCCAGGCTGCCCTGGAATTCACTGTAGACCAGGCTGGTCTCGAACTCAGAAATCCACCTGCCTCTGCCTCCCGAGTGCTGGGATTAAAGGCGTGTACCACCACGCCTGGCCAGTTAATGCTTTTAACACCACTGAGCCACTACCTCAGCTATTTCCCCACCCACCTTTCTTTTTAATGTGAGCGAGGAAGGGGGAGTCCATAGAGTAGCAGTCCTTTTTTGGGGCTTGGAACAAACAGCATTTTGTCTGTGGTGGATATTGCATACATGCTTATGTATGTGCAGGGGCGTGGCGTGTGTTAGATCAGAGGACAACTTTGGATGTCATTCTTCCTTGCTTTTTGAGAAAAAGGGTCTCTTATGGGACCTACTGCTTGCAAATTGGGCTGTGCTGGTTTGCTACCAAGCCTGTCTCTGTCTCCCCAGCACCAGGACTGCAGGCGCCTGGCTACCATGCCTGCTCTAGGTTTTTTTTTTTGTTTGTTTGTTTGTTTGTTTTGTTTTGTTTTTTTAACATGTGGTTTTTGGGGTGTGAAGTCTGGTCTAAGTGTTTGCTTGAGAAGCACTTTATTGAAGGAGCCCTAAGCCCTAATTTCTCCTCAGCCCTAAGCAGTTAGTGTATTATATTGCTAATCACATTGTAGGCATTTAAAGTGAGAAGTTATTTCTCAGGTTGCATATTCTTTAGCTAATGTATTGTGGGATGGGATGCTTGGGGTTGCCTCCAGCCTATCTATTTGACTGTAGCTATGCACTTTACAGTGTGATAATTATGCTGTGTTTTTCCTCCCATGTGCTCTTCTCCGTCATCACGCTGATGTCTTCCCTGCTGCTGGATAACTCTATCAATAGAAGGTAAATTAGTCGCTTGTTTGTGCTTTTGTTTTTCTAGGAATTGTAGCACTCAGGATGAGTGAGCAGCTCTGTCCTTGTAGTTAGGTGCAGTGTGCACTAGTCACAGAAGGACTTGGCCAGGGTGTTACCTCCTTGTAGGAGAAGCTAGCACAGCCAATTGACGTTCTAGATTTTGTACCCACTTGGCTTTTTTTTTTTTTTTTCCTCCATTTGACTTTTTTTTTTTTTTTTCCTCCACTTGGCTTTTAGTAACTGCTTTTTGTTGAAAGTTATTTTTAGCATTCAGTGTGTTTCAAAGTAGAATTATTTTTTAATGGCTTTTTTATACTCATTTTTCTTTTTGTTTTTTGAGACAGTACTCAATTTATTTTTAACACTATGTAAATTAACATTGCTAGTTTTGAAAAACAAGGGCTTAAGATACATTTTTTTTTTTAAACATAGCAAGGAGAAGGAAGAAAACATGCACAGGTGAACCCTAGCACTCACAGTCCAGTGACAAATGTAATAATAGGTATCTGTCCAGTTTTGATACCTTTTTCAGTGTTAAGATTAGTAAATGTTTAGTAAATGTTCTATCTCGTGAAGTTATCATTTTTAGCCTTCTATCTAGTTGGGTATTTAAACATTATGCTAACTCCATTTGATGGCTTTTTTTCTTTGTAATGAAATCCGTAGCTGAGACTCATCCATTCCCTTTCACAAGAAAGAAAATCAAATTGTGGGTAGAAAATATTAGAAAATATTTAAGTGCAAAAATAAAGTATAGGCATATCATCAGGATTCAGTGCCATTTAGTCTGGTGTTTTCATAAAGCTATGTGGCAGTGTTTGGGCTGATAGTATATATTGCAGTGTAGATACTAGAAAACCTGTTTTTGTTTTTGTTTTGTTTTTTTCGAGACAGGGTTTTTCTGTATATCCCTGGTTGCTCTGGATCTCACTTTGCAGACCAGGCTGGCCTCAAACTCAGAAATCTGCCTGCCTCTGCCTCCTAAGTGCTGGGATTAAAGGCGTGTGCCACCACCGCCCAGCTCTGTTTTTGTTTTTTATTCAAAATGTTTATTACATTTTACTTAGTGTTTGTGAATATTGGGGAGGGGGCATATAGAGGTAAGAGAACAACTTACAGGAGTTGGTTCAGGTCTTCAGGACTGGTGGCAGGTAATGTGTTTTTCGGGTTGGGATGTTAACTCATGGCTGCCAGAACAAAGCATCAGATGCTAAAGGTACTGATAACTGTTGTAAGCAGCCGAATGTGGGTGCTAGAAACTGAGCTCCAGGCCTGTTAACTGCTGACTTCTCTCTCCAGCCCCAAGAACCAAAATAGTTACTTTTTATTTTTATTTTTTATATATTTATTTTTTTGATATGGGGACTTATATTAAGTAGTTCTGACTGCTCTGGAACTTACTATGTAGATCAGGCTAAACTTAAATTCATAGAGATCAGTCTGCCCCTACCTATGTCTCTCGTGCTGAAAGTAAAGGCATGTGCCAAAAGTTTTGTGGGGTTTTTGTTTTTGTTTTTTTGACAAAGGGTTTTCCTGTGTATCTCTGGCTGACATGGAATTAACTCTATAGACCCGGCTGGCCTCAGACTCAAAAATCTGCCTGCCTCTGCCTCCTGAGTTTTGGGATTAAAGGCATGTGCCTAATGTAAAATTTCATTACAGTGTATTATGTTTCTGTTTTTGAGCAGATTCTCATAATATAGACCAATATGGCCTGGAACTGACTATGAATCCAGACTTTGGCTTCTTACTCAGCTTTTTGAGGGCTGAGGTTATATGAATGAATTAGCACACCAGGCTAAGATGCTAAGATATGTGCTTTAAAACTTGTTAACATAGCACTTGGAAATGTTTTAATTTTCAGTTTGTGTGTATGGCATATATACTTGGTTACACTCGGAGGCCAAAAGAGGGCATAAGTATCCCCCGTAGCTAACAGTGTTAATAGGTTGTGA
U3_D5 153619518 153620191 674 TCGACTCTTGTTTTTGTTTCTTCAAGGTAGGAGACAAGTTTCTTCACTCTGTAGGTCAGGCTGGCCTCAAATTCAGAGATCTCTGCCTCCTGGGTGCTAGAATTAGAGGTATGTGCCACCACACCTGGTCTCTACATTTTTTAGAGCTTGGTTCGTATTGTCAGGAAACACTAAAGATGTGCTTGGTGTGTATTGTGAATTGTTATGCTCCACAACCTAGACTCTGAGTGGGACTTCTATGAATTGCAGTTGTTTATCTTCACTGCTTTCACAATAGGTTTGTGAAAACATTGCTTCTGTTTTTGCTTTACTTCCTGGTTTGGAAATGAATTAGAGGAGCTGGATATTTGGTAAGTAGACGCCAACTTTTGTGATCTATTTCTGTTTTTTCACTCTTTGCAGTGGGACATCCCCTCTTGCGTGCCTCAATGCCATGCTACATTCCAACTCAAGAGGAGGAGAAGGGCTGTTTTATAAATTACCTGGCCGCATTAGTCTTTTCACACTCAAGGTAAAATGATTTCTCAGTGCAGTGGTCCTCAAGACTTTGTGCATAAGAGAAACCTGGTGGGTTTGGAATGGTGCTAATGGATTGATTGTCTTTCCTAATACCAGTCAGGTATCACTAATGTCTTGGTCCTCAATGGTACTCTGAGATGCTGTAGTCTTTTTTT
D3_G3 153620316 153625274 4959 CTGGGATTAGAGATGCTGTCTCTTAACAGACTATTAGGAGTTACTAAGTTCTATCAACTGTTGTTTCTGTTCAGCTTTGCTTGTCTGTACCTTAGTAGATACATGCAATTGAAAGATAAGCATGTGTAGTGATGATTACAGATTTGCCTTAGTAAGGATTTTGTTTGTAATAATATTGTCAGGGATAATTACTGTGCAACTCTAATGAACCTACTCTATGGGAAGTAACCGAAATGTGAGTATCAGCATTTACTAAGTGACACTAATTACAAGGAGGAGGAGTTCAGAATAAACCTTATTTACTGAAGGAATAATTATTTTTCTACCATTTCTGATATATTTGACTGTCATTTAGGGCTGATATAAATAATTTAGATTTTGTGGACCTAGTGGCTCTGTCAAAACTACTCAGCTCTGTTATGGTATCAGGAAAACAGCTATCTCCTCTGACTCCCGCTCGCTCTCCCTTACTCCCCCCACCTCGCTCTCTCACTTTCTTGCTCTCTCGCTCCTTGCTCTCACACACATCTTTTCTAAAAACAGTTTTAATGTATACCAGCTTTTATTGCTTTTTCTTCTTATTTCATAGAATATTCTTGTTTTAGAGACTGACTTTCTTTGTAGTATATTCTGGCCTTGAGCTCACTTGATTGCTCACACTGGCCTGAAGCATGTGTATGACTTTTGTCATACAAGTACTCGAATTGCATGGGATTGTCACCATTGCCTGCCTTTACAGTGTTGCAAATATGGAAAAACACCTTGGTAACAAAGAAGGGTTGGAGGGATGGCGGGATGGCTTCAGTGGTTAAGAACACTGGCTGCTCTTACAAAGGACCAGCACTTGATTCTGAGCGCCTATTTGGTCCCTCACAACCTTCTGTAACTCAGTTCCAGGGGTTCTAGTACCTTTTTCTGACCTCCATGGGTATCAAGCGTGCATGTGGTATACAGACATATAAAGGGAATAAATAATAAAACAACAGTAAAAGAAAGCAAATGGTAAAAAGTACCCTTTTTGGTTTGTTTTTTTTTTTTTTTTTTGTAAAAGGTACCGTTTTGGGGAATTGGGGAGATTCAATAGGCAAAAGCAGTTGTTTACTCATGAAGTCTGGAGTTCACTCAGGTAAACAGCTAGATATGCATGTGGTGGTATGGGTGATGGGTGATGGGAGTGATGTACCACTCCTCACTACCTGTGGCAGGGAAAGCAGACACAGAGGGAATGAAAGCTGGCCCCAGTGGATGGTCCTGTTCCTCCCCTGGTGGCACAGGGTACAGGAATGCGGGTGGGCTGATCAAAGTAGCTACCACCTAGGCTTAGATCCTGGGCTTTGAGTTGGCCCACCCCTATATCTATCCAATCTTGGAAATGGTGGAACTTGTGAAGGGGTTGGTCCTGCAGAACCAAAGCAGCAGGATCTCTATGACACAGGGCAAGGACAATAACAGGATAGCCTAGAGGAGTCCTGGTGGTGAGGGACCAATGACTCATTGTAATGAACATTTACAAGTAAGGATGTGTGGACAAAAGGATATATTATGCGATACACTATAGCTTCCACAAGATGTTTTTTGTTTTGTTTTTTATATTTGTTTTCTTTGGGGGGTACACTGAAAGGCCAGAGGGTGGGTACGAAGGGACAACAGATGAATGGGATTGGGGTACATGATGTGAAATTCACAAAGAATCAAAATAAAAAGTTTTAAAAAGGGGAATGGGGAATACAGAGATGGCTCAGTGGTTAAGAATACTGACTGGGGGGCTGGTGAGATGGCTCAGTGGGTAGGAGTACCCGACTGCTCTTCCGAAGGTCCAGAGTTCGAATCCCAGCAACCACATGGTGGCTCACAACCATCCGTAACAAGATCTGACTCCCTCTTCTGGTGTGTCTGAGGACAGCTACAGTGTACTTACATATAATAATAAATAAATCTTTAAAAAAAAAAAAAAAAAAAAAAGAATACTGACTGCTCTTCCTGAGGTCCTGAGTTCAATTCCCAGCAACCACATGGTGGCTCACAACCATCTGTAATGGGATCTGACGCCCTCTTCTGGTGTGTCTGAAAAGAATGGCAGTGTACTCATACACATAAAATAATAAATCTTAAAAAAAAAAAAAAGCTAGGCATGACTTAAATGCCTGTCAGTAACCCTAACACATTGTTGGCTTAGAGACAGGAAGATGGTTGGGGCTTGTGGCTACAAAATTAGTGAGACACTGGACCTGAAGGGAATGACATAGAAAGTGATAAAGCAGAACAAGTGTTGTTCTTCTTTGGCCTCTCCGAGGGCACACCTGAACACATGTGTGTTTATAGTTGTATACAAACATAACACACAATGAGCAGTTTAGGATGGAGATGCAGATAATTGTAGAGTATGTCTGAGGTGGTATGTTAATCCCCTTGCATTTTTCATTAGTGGAAAAAGCAGAGGGGGATAAATTGAAAGAGATAATTGTTACATTCTTTTTGGGTTTGGGTTTGGGTTTTTGTTTTTTTGTTTTTGTTTTTTGAGACAGTGTTTCTCAGTATAGCCCTGGCTGTCCTGTAATTCACTCTGTAGATCAGGCTGGCCTCGAACTCAGAAATCTGCCTGCCTCTGCCTCCCGAGTGCTGGGATTAAAGGCGTGCACCACCATGCCCGGCTCATTTTAATTATTTTTAAAAATAATACTGCTCCTTTGTAGATTAATACTGTAATCATTTTGTTTGTTGGGGTGTAAAAATCTCATTTAAAATTCAACAACCTATTTAGACAATACCTTTTGTAGTTCTGTAACCTTTAGGGGGAAAAGACATTCTTTCTAATGCTTAAAATCCTAAAGGTTTTTTTTTTTTTAAAGATTTATTTATTTATTATATGTAAGTACACTGTAGCTGTCTTCAGACACACCAGAAGAGGGCGTCAGATCTTGTTACGGATGGTTGTGAGCCACCATGTGGTTGCTGGGACTTGAACACTGGACCTTTGAAAGAGCAGTCGGGTACTCTTACCCACTGAACCATCTCACCAGCCCAATCCTAAAGTTTTTAAGGAAGGAAAAAATGTCAAGTCATCCAGCCTGTTTTCACTCTGGCACATAGAGTGCTGGATCTGTACTCCTCTGTCTGTATGGCAGTACTTGCAGCTGGGTTAGGAACTGGGTCCCAGGTCTCAGTGTGCCAGGTTAAAAAAAGTGTTTCTTCAGGTTTGCAGCCATTGGCCACTTTGTCTTTCAAAACATCTTTTTTGTTTGTTTTTTGTTTTTTCGAGACAGGGTTTCTCTGTGTAGCCCTAGCTGTCCTGGAACTCACTCTGTAGACCAGGCTGGCCTTGAATTCAGAAATCTGCCTGCCTCTGCCTCCCAAGTGCTGGGATTAAAGGCATGTGCCACCACACCTGGCACTTTTCTTTTTTTAAGCTTTGGTTTTATTGTATTGGTGTTTGCCTATATATTTGTAAGGAAACCACTCAATACCTAGAGCTTACAGGAGTTTGAAGAGGGCAGGATCCCCAAGAACTAGAGTTACAGATGGTTGTGAGCTAGCTGCCATGTAATCCCTGAGAACCAAACTTGAGTCCTCTGTAAGACCAAGTTGTGCTCTTAACTACTGAGCCATTTTCTTAGCTCCAACAAAGACTTAGTTTGTATTTTATTTTATTTTATTTTACTTTATGTGTATAGTGTTTTATATGCATGCACATCTGTGTATCATGCTTATACTTACCTGATGCAGAGGCTAGAGGAGGACATTGGATCCCCTAGAACTAGAATGACTCTTAGGAGTTGCCATGTAGGTGTTGGGAATTGAACTGGAGTCCTTTCTAAGATCACTAAGTACTTACAACTGCTGAGTCATCTCTCTCCAGCTGCAAGATTGGTGTCTAATGTCAGCAGATTCTTTCATAGCTATAGGTAGAACTGCTCCAATGGGGGCAAGAAAAAAAAATTAGACATTAACTTGCTGAACAAGAAGAAAAAAATAATCTAAAAGCTATACATTTTGTTTATAACAGAAATGGAAATAAGCAAGAGGAAATAGACAAATCAGCTGACTTGAGTGGGGTACCATTATCTTAACAATTTTCAGATCCTGAGATGAGCACTTTTGTTATGCCTGGTTGGTTTGAATTTATAGTTTAGATTGTCTTTACATTTTACTGACATTTCTTACTGTTTGCTTTTGTTTCATGTTGGAAAAGTGGTTAGTATGTGTCCGTGCTACTGCCCTGGAGGTGTAGGACAGGGTGGTGATGCACATGCCTTCTAGTCTTAGACCTAAAGTGTGGGGGTGGCGGGATGGAGAACTCAAGGTCATCTTTGGCTACAGAAGGTTTGAGGCTCTCAAGACCGTGTCTCAAAAACAAAGGATTGGATGAGAAGTTCATCAAGGTCAGGGTTTTAGCCAGGCATGTGGTATGTTACTTGCAGTGTAACACTGAAGAGTTCAAATTGATCACACAAAAATATGTAAAGCCCTTTTATGTCATAAAATGGGTATATAAATGGAGATTTCAATTGCTGTGAATTGAAACAATAACGAGGGACTGGAGTGTTTTCTCTTGTGGTTTCTGTCATTACCACTTAAGCAGTGACTTAAACTCCTAAGCCATCTTCTGTGACCCTTCGGTCTCTTTTGAGTGCTTTCTGGGTTAGACATCAATAAGACTGACTACCATTATAGCATCTTTCTGTATGAAAAGTAAGCTAGCTATGCGTATTTTTTTTCCTCTTATTTATGATGTGTTTGCATTATTGGCTACTCACTTCTTTCAATTGTTTTTATTAGTAGTATTATTGTTTGAGAGAGAGAGAGAGATACTTGAGGTAAGAGAACCATTATGTGAAGTTGTTTTTCTCTTTCTACTTTTATGTGTGTTCTGGGGAACAAACCTAGGCAGTTGGTATCTTAGTTAATTTTCTATAAAGAATTTATAAAAGACAGACTATTTGGGGCCTTCAGTTTCAGAAG
U5_15 153604421 153619469 15049 TATGGATGGTTGTGAGCCACCATGTGGTTGCTGGGATTTGAACTTCAGACCTTCAGAAGAGCAGTTGGGTGCTCTTACCCACTGAGCCATCTCACCAGCCCAATGCAATTTTTTTGTACAGAAAAATTACCAGTAAACTAACTAGTCTTATAAAACCTAGAGAACTATTGTTAAACATTTTGGCAATTTAAATACCTTCTCCAGAGCATGGGAGACTAAAGAGTAGAATTTAAAAAACTGTGACTGGCCCAGGATTTATGAGTTAAGTCATGCATTGTGAGGGTAGATTTGGCAACACAACGAGACTGGGAATGTCCTGAAGTCTCTACTTTGCACTTGTGGAGACCTTCCTGGGTAAAATCTTATCTTAGTTTTTTCCCTACATGAGCGCTTTCCAAAACTGTTATGAGACCATTCAATAGGGGATAATTCCTCAGAGACTGTCTACAACAAAAGAATTACTGAGAATGGTTCATACACCAACAGTTTGACTGCCTACTATATGCCCAAGACTATGGCTGGCATTTGGGGTATACAGAAAAAAAATCCAAACAGATGCCAAATGTATAGTTACCAACCAAAAGCCATGCAAAGAAATGCAATGTGCAAAGGGGCTGGAGAGTTCCACATTAGCTGATCATCTGCAATGCTGAAGCTGAGAAATAGTGATCTCATCTATTCTTCTGAGATGGGGTCTTCCTGTGTTATCGAGGCTGTTTGTAAACTTCAGGGTTCAAGTGCTTCTCGAACTGTGTCATCCAAGTATGCAAGCATGTGCCACTTGTTCAGATCGCCCGTTGACTTTTGTCATATTCTCTGCTGTCCAATGACAGTGCTTGGTTGATGAAGTTGCATAACTTATTCAAGGCCACACAACTGGAGAACAGCTACGGTTTCAAACTCAGACCCACTGGAGTCCAGAACCAATTTTTTTTTTTTTTCAATTCTTAAAAAAAAAAGTATGTGTATCGGTGTTCTGCCCCACATGTATGAAATAGGCAGTTGTGAGGTACCATGTGGGTTCTGGGAATTGAACTCATGTTCTCTGTAAGAGCACTTGCCCTGAGCATCTCTCTCTCCAGCCCTAGAACTAGTGTTACCAGATCACAGTGAGGATCAGGGATTCTATGTCCTTTTGTGTCTCTCTGCTGTTTCTTGCTTGTATTATTCTTAATTTGTGTGCTTTGTTCATAAATTTGAAAACAATGACTCATCCCCAGACTGGGCGGGGTTGAACAGCAGTTCCGTTTATCTTACTCAGCCCATGGCACCCCTGTTAACTTTCAAAGGTCACCTGTAATAAAAGCACAGTGATAAAAACAACGTTAAATCACACTAAAAGCATGTATATGCTTGCTGCTTCTGACAAACTTGTGATTCTTGTTAATTAGGAAAAAAAAAAAAACACCACCAAAACCTCTTAAGGCTTAATAACCAAATCTAATTTTCAAATATTTCCCTCTCCTTTCTTTGGTAGAGTCTCTTAGATTGGCTTCAAAATATGGAGCCCAGGCTGCCTTTGAGCTTAAAATCTTCCTGCTTTCATCTCCCAAGTGATGAAATTAGACATGAGCTGTCTCACCCATTTCCAACACGTACCTTATACAGACCTCTGGAAGTACTACTTTCTCTTCATGCTTAATGAGGCTATTGTCACTAATTTGATTCTCCAAGGGTAGAGATCTTGAAATATTCATGTGATCTTCCCACAGCCTGTACCACTTGTGAAAACTAGGCAACTGCTTGCTGATACAAACTGAAAAGGTCTGACACAATGTTTGCATTGGGCTTTATTGGCTGTAACAAGTTAAAGCAATAGGAGCTTAAAGCACACTGAGAAAAGCCTGTTGCTTCCTGGGCCAGGAGTCCACATACTGAGTGGGTTTCAGTGGTTCCCTGCTCTAATCTGAGGCTGAAGTCAAGGTATGTATTTTCTTTTCTGGAAACTCTTGTTTCTGAGTTCATCTGCACTGTCAGAGTTCAGCTCCACTGGGTTGAATGACTAAGGTCCCTAATTCCTCACTGCTGTTGGCAGGTTTAGTCCTGATGCTGCTTACATTCCTTTGCTTTCTGCTACTTCAAAGCCAGTAACAGCAAACTGAATTGCTTCACATTTCCAAAACACCTATACTTTCTGGGACCCACGTGGCCCACTCAGAAGTCTAGGATGATCTTCCTAAGGTCTAAAATTGATCTGCAAAGCTCCTTTTTCCAATGAGTGTAATGGAGTTCTGGGTCCCCACCCATGGGTCAAGCCAACCTGCAATACTTAATAAGAACTTGTCCCAAAACATAAAGGGCTTGAAAGGTAGGACAGTGGTAAAGCATCTACCATGCATCTTGAGCCCAAGTCCCAACACAACAAAACACAAAGCCTGCATTTTACAGTCTTCCCTATTCAACCCTTCCAAGTGTGTGGCTTTGTTGGAGCTATGGATCAATTCAAAACATCTGAACCACTATCCTCTCAGAGGTGATTGTCTCAGCTGCAGATTGAAAAACTATAAGCAAAACTACCAAAGGCCAGGGTTAGTGGGGCATGCATTTTAATCTCACATGTATTAATGGGAGGCAGAGGTAAGACAATAGAAGCCCATTGACGCCAGCCTGTCCATATTGTGAGTTTTTGTTTCAAAATAAAAAAATAGTGAAATGGTGTTAGGATATGCTCAGGGATTGTGGGAGGTCCTCAGTTCAACTCTCTCCCCACCAACAGAGTCCTAATATACACCTAATTTAATCCCAGCACTTGGAAGGCAGTGGCAGGTGGATCTGAGTCCAGAGCTAACCTGGTCTACACAGTGAGTTCCAGGCCAGTCAGGTGTCTGTCTCAAAAACAAAACCTAAAATGTCAAAAACAATAACAATAAAATAATTTTAGATGTAGTTCTCCCCTCGCTTTTGGGATGAAATGAGAAGAGTGTTTCTGTTTATTGAATTTGAGTCTTGGGTGAGCACTAATAAGGACCGCTGAGTCCTTTAGGTACAAGGGTTGGACTGCTGGGTGATTTCTTCGTCTCAGCACTGGCTGCCTGTGTACTAACACCACAAGAGTACAGGGTGTTTTTTTACCCACATAAACCTTTCAAAAACTGTAAAACCTGGCCATCAATCCAGTTCAAGACTGTAGAGATGTTTCTGTACTTTGGGCCAACAAACACAGAAAAATAATGTTCTGGGTGCTTCAAACCTTATCATCCTGTCACTGCAATCAAGGAACAGAGGCTCCATTGCCCACTGTGTAGTAATAACAGCTCTCATTTATTCTACAGCAGAAGCCAAATTACATGAGCCTAATATCAGGATCTTCCACATTCTCTCCCATCTTCTAGATACTTCATGCTAATTTGTACCCCATCAAGGTTGTGGGATACTATGCTAACATTGATCAAACAGGCTCAGCGGGGTTAGGAGTAGTCAAGGAGTCACAACTAGGATTCTAAATCTAGGTTGGCTGACATTAGGACTTGACCTCTCTCCGGGCAACTGCGTCTAAATATACACTCAGGTGCATTTAGATTTCTGTGGATGGACCTTCAGTGTTTACCTACTATCGGATCATCAAATTCACCTGGCGGCAACGCTGCTGGAAACTGCAGGTGCATTCTCTGCAAACACACAGAGGTATTACAAGAGGAAATGGGTTAATCACCTAAGTCGGTCAATCGTGCAATAACCGTTTTACTGATATGAGTGTCTCTTTGCTTATTACTATGCGCCAGTTGACTCATTTAAGGGTGGGCCAAAAAGAAAAGTCCTGCTTTTTGTCACCCACCAGAAGTCCAGAAGAGAACTGTGTATGCGGTGGGGGATGGTGCAGTGGAAGCAGGGTAGCAGACTACCAACTCCAGATCCGAAACCGCACTGGACCCGCCACCAGAATCAAAAAAAAGCTTTGAACGGGTTAACCGCGCGCGCGGCCAGGGGGGAGTCCAGCCACCGCCCCTTCCCAGCACCACCTCCCAGAAACCCTCAGGCCTCCGCTAGTTCCCGAACCTCGCGAGACCCCGCCCCATCTTTTTCTGACCGACTTCCCGCCCCCTTCTTTACCGTGCTTGGAGCGCAGCGGGGTACGGAAGAAAGTGGGCGGAAAACAGGAGCCCGGGGCACTCCGGGAAATGTGGTCCAAGCACTTGAGGCAGCCATTTTCTTCCGGAGAGGGGTAGGCCAGGAAGCCAGTGAGGACTACAAATCCCAGCCACCCTTTCGGTTTGTTTTTGTTCAAAAAAAAAAAAAAAAAACCCACACTCCCCCTCCTCACTCTTCTCTCTCACACACACGCGGGCACACACATACACACACATACCCACGGCAGACACGCACGCATCCGAGCGTCGAAAGGAAAGCCGCGTCTCGCCATCCGGGCCCGCCCGCCACTAGTTCGCTCTTGGGTTTCCCAGCAGCGCGGGAACGCGGAGGCCGGAGCCGTGACCTCTGACCCCGTGGTTATGCGGAGCCGCCGCATTCCTTAGCCATCGCGGGGCTGCCGCTGCCGCTGCCACCGTGGGCGACTGACGCAGCGCGGGCGCGTGGAGCCGCCGCCGCCCCTCCCCCCAGCGCCACCCTCGCGCCGGGGTCTCGCTCTAGCCAGTCCCGGTGCGCCCGCCCTCTCCGGCCGCACCCGAGCCCTCGCACGCGCCGCCGCCGCCACGCGCCCCCCGCCGCTGCCGCCGCCTCCGCCCCAGCCCCGCGCCGCCACCGCCCCAGTCCGCCCCGCCCGAAGGACCCGCGTGGAGCCGCCACCGCCGCCGCGGAGGAGGAGGATGAAGGACAAACAGAAGAGGAAGAAGGAGCGCACGTGGGCCGAGGCCGCGCGCCTGGTGAGCCGAGCTGCCCGGGGGGCCGCGGCGGGGGGCGTAGGGGGTGGGCTCCGCGCGGCTCCCCGGGCGGGGGAGGGGCGAGGCCCTGCCCACCGCAGCAGGGGGCGGGGCCGCCCGGGTGTGGAGCTCCCGAGGTCCCGGGCCCGAGGAGGCTGGGACGCCTTTTCTCTGCATCCCCCCACCCCTTGAATTCCTGCGGAGGGGCGAGCTGGCAAGCGGCTCCTCCCCCCTCCGAGCGCCCGGGCGCCAGTCTCCCCTCCCCCCACGTTGGCAGCAGCAGCGGGGGGTCCCGGGGAAAGCGCCCGTTTATTCTTCTGCGGGGAGTTAGGTTTCCGGGAAAGGTCGGAAGTGCTTCCCCGGACTTCTTCGTGGGCAGAGGTGTGTGGGTCACTAAGACACCGTAGGGGTGGGAAAAGTGCCCCTGGTTTCAAGGACGCGAGAAGCATTTAGAGCGTTGGCAATTTAAACCAGGTGTGTGTCGGAAAGCAGTCGCTAAGGACCGATGTGAACCCTGAGTAGTGGTTCTCAAACTACTAGAGTGCCCGGTGGGAGCATACCTGGGGACTTTGTTTCAAACATTGGCACTAGGGCTCATTTTAAACACACTGAACTCGAGATTCCTCTGAGAAACAGTACTTTAGGCAGCTGCTTAAGCGATTGTTATGCCGGTGACCCTCGAATATTTAAATCACACTGAGCCCTGTGACTACAATGGGGGGTAGGCAGTTTGCAGAGGAGCAGAATACACTTTGCCAAGAATGTGTATCTGTTTGAGGCTTCCCTTCTGAGGGTTTAGTTAAAAAAAAAAAAAAGTAAATAGGTTTTTGAGCTCGCTACCTGCCCAGAGGATTTGTGGCTTTTCTGTTTCCCAAGCTTCAGTAGACTTGTGCGATAGCTTTCTTTTGGACTCAAAATACAAAGCCAAAAGACCGGAGGCATGTTCTTATGAAATGTTGCTGGTGACAATTCTAATGGTTTATACTTTTCTCGGAGATGTCACTTCCTCAGACTGCCACAGTGCAGGGTTATGGGTGCATCCTGCTTTTGTGTTGACGCCCTGTATTTTATATGTAATTGTTATAATTTAGTTTTAATGGTGGAGTGAAGCTCAGCTTTCTTCTAGCCGTTCCTTTTACTGGAAAGTGAGTTCTGTCTGCCTCAAAAGTGTTGGAGGTTGATAAAGATCTAGAGTGAACCCTTTTTTTTTTTAGAGTCTGTGAAAGCCGGTTATTCATTTACCCATGGCTGTTTGAGCTACCAGAGAATTTCCACTGGTATTCCTGATCATCGCTCTTCTCCTGTTACCCTGGGAACAGAAACAGGGATTGTTTGTGTGAAAGATGTAGTTTATTTTTTGCTTGGCATATGAAAATTGAAACTCCGAGGTGGTGTATTTTTCCTTCTGTGATTCAATCAAAACTAGAACTTTGCCTAGTATTTATGATTTTTGGAACTTAATGATTTCTTCATGCTTCTCTTAATAAATTTAAGTCTGAAGGAGCTTAGGAGAAAGCTAAAATGTAGGTTTTTTTATTTTATCATGGAAGTTGTTGGATCTTGACCATTGAAGTTCTAAGTTTCTGTGTGCAGGTGTTTATGACTCTGGGCACCCAAGGAATATTTGCTTGCCAGAACCCTACTTGTTAGAGGTAGGTGAAAGTACCTTCAGATCCTGTGTTATTTATGTCCTGACAGCTCTGAAATCTTCTCCTCTCAAAGCTCTTTGGGCTCTTATTAATTGAAAGGCTCTGGCAGTTTGGAATCCACTGTTATTTTAAGCCTCTTTAAGTTCTTAAATTTACTGTGGTTTGAATTCCAAGGTTAAGGTTGCTATTTCTATTTTATCATTGGCTCACCTTCAAGCTCAATTATCTGAAGTTATTTCTCTTTTTCTACTGTGGCTCTTCAGTTAAAAATAGTAATCTGAACAGGAATTTCTTTGTGGTGTAGTTGTACATTTGAAAGAGGACTTGTGGGAACATGGTATGCAATTTTGCATATCTTTTATGTGCTTTGTATTTTAGAATTTTCTGTGCTTTTTGTGGGGGTGGATGGGGGAGTGCAAAGTCGTCTTCCCATTAAAAAGAAAAAGTCCCGCTACACTGAGTGCTGGGAGTTTTTGCTTTTACTTCATAAAGGAACACCTGGCAAGCAGTGAGCTACAATGGCAATGCAGTCAGTTTTGCCACAAGGTTACTATTGGTAACTGCTTTTGGACAGTTGAAATTAGATCACATGTTATGGCGACTCATGTGCTTGTCAGGTGGGGGTTTCTAATCGCTCTTGGCCTTGCTCAAATTGGGGAGTAGATAATAACCTTATATATGCCATTTTGACGTAGGAAAGCTTACAGGATTCTGGAGAATTCTAGCAGAGTAGCCGACTCCTGCAGATGGGTTTTTGCAGTTGTTAGATTTAAGAAGTGGACATTCTTCTCTCAGATGCCTTACAGAGTGCATGGCATTTCTAGCTATCGGAAGTAGAGATGTGGAATAAATATGCCATCTTGTTAGGAACAATTTGGGAGAAACAGCCAAGGAGATTTTCTTTTAAATTGTGTACTACACTTAAATAGATTTCTCTGGCTTTTGAGAAATGCTACATTGCATGCTTTGTTTTTGCTCTGATTCATGTCTGAACATTCTTTTTTTTTTTTAAGATGTATTTATATTTATTTATTTATTTATTTATAAGTACCTAAGTACACTGTAGCTGTCTTCAGATGCACCAGAAGAGGACGGCAGATCTCGTTACGGTTGGTTGTGAGCCACCATGTGGTTGCTGGGATTTGAACTCAGGACCTTCGGAAGAGCAGTCGGTGCTCTTAACCGCTGAGCCATCTCTCCAGCCCATGACTGAACATTCTTATATCAAACATTTTTTTCCTTTCAAGTAGAGAGTTTTTTCTTTCCTTCAAAAAAATATGTGGTCTAGAAAGACTAGCAATAGAGCACTGCTGGATTGTTCTGAAAACTAGTGGTTTATATACAATTTTAATGAAAATGAGTACTTTATATCTTCATACGTAATATCTCTTTAGAAGTTTTTTTTCTTCTGTTTTAAGATTCTCAGGGTCTTTCTGGCTACTGTTTAAATAATTGGTAGGTATTTTTTTCAGTCATGCTCTTTTTTTCCCTTGTAGGAGATTTGTTAGATTTGTGTGTGTGTGTGTGTGTGTGTGTCAGTGTCAGGAGAGGCCCAGAGTTAAACAGGTATTTTGGTTTCTGTCTTTTGTTTAGGAATAAATATGCTTAGTTCCTCACTTCCCTTTGAAGTATCCTGGCTTGGGAGATTACTTTTACTGTGGAACAATGGGTTCACTGAAAAAGAGATTTGACTCTGCTGATATAGATTAGGGAGTGCTTCCAGAGGGAAGGTAGTTTCTGATCTGAGCCTTGAACAGTTAGTGAGATGTAGGTAGGCCTGTCACAGAGGCAGAAGCTGATGAAAAAAACATGGCTGAAGGAGGAGAGAAAAACTACATGGGTGTGAATATATTTGCAAAGTGTGCAAATGGGGTGAAACAAAGAGGAATTGCAGGTATGAAGATGTGTGGGTCGGTGAGGCAGTCTTGCTGGGGGGCAGATAGGTTATTGAGAGGCTTTGTGTGCCCAGCTTCTGGGCACCTACGGGTGCTTACTCAAGTTCTTTTCAATTTGAAAAATGACCCTGAGAGGAAAGTCTTAATACTTGAAGAGTGAGAGATTCCCCCTTTGGCTCAGGTTGGATAGGTACATAGGTACTTGCTTCAGTTTGGAAGAATAGAATTGAAATCTTATCCTGTCTTATTCTAAAGCCTGCACTTTAGTGGCTGGCTGGGTTCTGGAAACATACTTTCTGCTGCTTATGGAGAGACAGAGTTGCTGAAGATGATTTTGAAATAGGAACATGAAGGTAGACTGTGTGGTCTGCTACAAGGCAGGTTCCGTGTGGTTTTAAGTGAGGGATAATCACAAACAGGAATGGATTTGAGAACAGGGCTGGACTCAAGGATATAATTGAAAAAGCTGTTGTGTTGGGTCACTGGCTGTGGTAGTGAGCCAGGTAGATGAGAGCGAAGGGTGCTACATGTGTGTTGTTAAATTAGGTGCCAATTAAGGTAAGGAATGTAGGGAGAAAGGGTAGGGATGGAGGGGGAGATAAAGGAGAGTTGCTCAGGTGAATTAGAGTTGAATGAGTTAAGAATGGACAGTTAGACTGATGAGTCATACAGAACTACTTGACTCTGAAGCTTGGGAGAAGTCGGGTAGAGGTAGATAGGGTCGGAGTCATCAGGGTTAGAAGCAGCACTAGTAACTGACAAGAGCAGTGTCAAAATGAACAGAGAGGCTAAGGAGGAAAAAGGGGAGGTTTGCTTTAGTATTTCCTTCTCCAAACTCTGACTTCCTTTAGTGATAAGGTCTGTTGTAGCCTTCCTTTGGAACTTCCTGCCTGCCCACCCCACCCCCATCCCCCTTTAATAAGTGACAGAACTTGGGTGTTACACTTGTTAGCTTGGAGTGCCTGCAGCAGCTGCTCAGGTGTCGAAAGTGAGATAATGAAATGACAACGTTCTTTTCCTGTTAGAGGAGCATTTCTGAAACAGCTCAACTTTGTGAAGATTGCTGAGGAAGTACATTAGTTACAGACCTAGTTACTGATGGACTAACACAGGCAGGAAATTAGGTTCCTCATTGTTATGTGAGTCACAGAGAAAACTTACAGCATCGTGTTGTCGAGTGACAAAATGTACTGTGGCAGTTAACCCCAGAATTTCATGGTTTAATGGGAAAGAACTGAAGCTGGGCATGGCTCACACTTGTAATCCCAGCACTTGGTAGACAAAGGCAAGCGGGTCTTTGTAAATTTGAGACTGACCTAGTCTACATAGTCAGTTGCATGTCAGATGGGACTGCATAGTGAGACTGTATTTTAGAAAAACTTCATATATACACACATACCCAGATGAGATAAGGGAATTAGTCAAAACTTTTTTTTGGAGGCTAGTTTTTATTATGTAGCCTGGCTGGTCTTGAAGCCACAGAAACCTGCTTCTGCTGGGATTAAAGGCATGCGCCACCACACATGGCCTTGGAAGGTCCTTGAGTAAATTTCAATCTTGTCATGTATTTTGCAGAAGTTTTTTGTTGTTTGTTTTGTTTTGTTTTGAGACAGGCCTCATAAGAGGTTGCCCTGCCTTCTGAGTGCTGGGATTAAGGGCATGTGCCACTGTTGCTCAGTTACAGTCTATATTTAACGACATTAAACTATGCAGTTTCCAGAGCTGCTAAGGTCTTATATATTATTACACATTGATGTTAAAGTAGCTGTCCTTAGAATTGAGAATTAGAATATTTTCATGTAATTGTGGCTTTTTTTCCCCCTAATTGCAGTGAACTTTCAGTGTACTGCTAAGAGTGTGATTTGAATCTGAAGTAATTGTTTTAATGCCATGTTGGGGCTTTGCACTTCTGCCATCGAGCCATATCTATAGCTCCAGAGTCATTTTGATAGTGGTAAATCTCTGGGGCTGGAGAGATGGCTCAGCGGTTAAGAGCACTGACTGCTCTTCCAGAGGTCCTGAGTTCAAATTCCAGCAACCACATGGTGGCCAACAACCACCCATAATGAGATCTGATACCCTCTTCTGGAGTGTCTGAAGACAGCTACAGTGTACTTACATATAATAATAAATAAATCTTTTAAAAAAGAAAAAGATAGTGGTAAATCTCACCTGTCACTGACAGCTCCTCATAGCAGGCCATGCTACAGACTAATGAACGTTTCACACTGAAATCAGAACGTTTCTGTTTTCTCAGGTGTTAGAAAACTACTCAGATGCTCCAATGACACCAAAACAGATTCTGCAGGTCATAGAGGCAGAAGGACTGAAGGAAATGAGGTTTGTATTGCTCTTACTGTTTAAATGACATATGTGCCTGTGAGAGTCATCTGTTGGTCTATCTGTGGTTGTGTATGTAATGGTAGTGTATCTGGTGTGTATTTTGAGGGTGGGAGTGGAGTGGGTAAACATCTGTTTGTTTACATCAGAAATACAGTCTTTCACAAGACCTTACCTAGGTCTTGACTTACAGCTAGAACTGGGTTCTTCTTTTCTTTTCTTTTCTTTCCTTTTTTTTATTTACATGAGTACGCTGTAGCTGTCTTCAGACACACCAGAAGAGGGCATCAGATCCCATTGCAGATGGTTGTGAGCCACTATGTGGTTGCTGGGAATTGAACTCAGGACCTCTATCAGTGCTCTTAACCGCTGAGCCATCTCTCCAGTCCGGAGTTCTAACTTTCTAATACAGTTTTGTTTTTTTGTTTTTGTCTTTTTTTATTTTTATTTTTATTTTTTTATTTTATTTTATTTTTGGTTTTTTGAGACAGGGTTTCTCTGTGTAGCCCTGGCTGTCCTGGCACTCACTCTGTAGACCAGGCTGGCCTCAAACTCAGAAATCCGCCTGCCTCTGCCTCCCAAGTGCTGGGACTAAAGGCGTGCGCCACCACGCCCGGCTCGTTATTTTGTTTTTTAAGGTAAGGTCTCATTGCAGCTTTACCTTCTCGTAGACTCTTGTTTTCAAGTTTTGGTAATAGAGAAGGAACAAATATATATATTCTTTTCTCTATACTCTTTATACACAGGCCTGAAGTCTTTTCCTTTCTGATCCAAGAAAAATGGTCTCGGTGCCATTACACCCTCTATCTATCTACTCACTAATTTAGTCATTCACTCCTGTTTCTAAGTCTCTTGCAGCCCAGGTGGCTTCCAAATTGCTGCTCAGCTGAGGGCTTGCCTTGAATTCTGATCCTCATGTTTCTACCTTGCCATCCACAAGTAGCTAATTTAGCCAGTTGTGATGCAAATATACTAAGGAGTAATTTGTGGAATTTGATACAATGTAGTTTTCCTGGAGAACAAAAAAATACAGAAGTAATTGGAGGCATAAAAACCAGGGGTGCCTTTAATTCGGTTCTTTTCTCATCATTATACCAATTTCTCCTTTTTTACTTTTTTTTATTCATCTATATCTGTCTATCCATTTATTTTTTTTGAGACAGGATTTCCCTGTGTAGCACTGACTATCTTGGAATTTATTCTGTAGACCAAGTTGACCTCAACTCAGATCTACTTGCCTCTGCCTCCCAAATGCTTGAGTTAAAGTCATGTGCCACCTCTACCCAGTGAAAAAAACCTTTTTATTGTTATTGTGTGTGTTTTACACTAGTGTATGTCTAAATGGTGTGCATTTACTGCCTATGGAGGCCAGAAGAGGGCATTGGGACAACTGGAACTGAAATTACATACAGTTGTGAACTGCTAATGGGTACTGGAAATTTGAACCCAGGTCCTCTGGAAGAGCAGTTAATATTGTTCTTTTTTTTTTTTTTTTTTGGTTTTTCGAGACAGGGTTTCTCTGTGTAGCCCAGGCTGCCCTGGAATTCACTGTAGACCAGGCTGGTCTCGAACTCAGAAATCCACCTGCCTCTGCCTCCCGAGTGCTGGGATTAAAGGCGTGTACCACCACGCCTGGCCAGTTAATGCTTTTAACACCACTGAGCCACTACCTCAGCTATTTCCCCACCCACCTTTCTTTTTAATGTGAGCGAGGAAGGGGGAGTCCATAGAGTAGCAGTCCTTTTTTGGGGCTTGGAACAAACAGCATTTTGTCTGTGGTGGATATTGCATACATGCTTATGTATGTGCAGGGGCGTGGCGTGTGTTAGATCAGAGGACAACTTTGGATGTCATTCTTCCTTGCTTTTTGAGAAAAAGGGTCTCTTATGGGACCTACTGCTTGCAAATTGGGCTGTGCTGGTTTGCTACCAAGCCTGTCTCTGTCTCCCCAGCACCAGGACTGCAGGCGCCTGGCTACCATGCCTGCTCTAGGTTTTTTTTTTTGTTTGTTTGTTTGTTTGTTTTGTTTTGTTTTTTTAACATGTGGTTTTTGGGGTGTGAAGTCTGGTCTAAGTGTTTGCTTGAGAAGCACTTTATTGAAGGAGCCCTAAGCCCTAATTTCTCCTCAGCCCTAAGCAGTTAGTGTATTATATTGCTAATCACATTGTAGGCATTTAAAGTGAGAAGTTATTTCTCAGGTTGCATATTCTTTAGCTAATGTATTGTGGGATGGGATGCTTGGGGTTGCCTCCAGCCTATCTATTTGACTGTAGCTATGCACTTTACAGTGTGATAATTATGCTGTGTTTTTCCTCCCATGTGCTCTTCTCCGTCATCACGCTGATGTCTTCCCTGCTGCTGGATAACTCTATCAATAGAAGGTAAATTAGTCGCTTGTTTGTGCTTTTGTTTTTCTAGGAATTGTAGCACTCAGGATGAGTGAGCAGCTCTGTCCTTGTAGTTAGGTGCAGTGTGCACTAGTCACAGAAGGACTTGGCCAGGGTGTTACCTCCTTGTAGGAGAAGCTAGCACAGCCAATTGACGTTCTAGATTTTGTACCCACTTGGCTTTTTTTTTTTTTTTTCCTCCATTTGACTTTTTTTTTTTTTTTTCCTCCACTTGGCTTTTAGTAACTGCTTTTTGTTGAAAGTTATTTTTAGCATTCAGTGTGTTTCAAAGTAGAATTATTTTTTAATGGCTTTTTTATACTCATTTTTCTTTTTGTTTTTTGAGACAGTACTCAATTTATTTTTAACACTATGTAAATTAACATTGCTAGTTTTGAAAAACAAGGGCTTAAGATACATTTTTTTTTTTAAACATAGCAAGGAGAAGGAAGAAAACATGCACAGGTGAACCCTAGCACTCACAGTCCAGTGACAAATGTAATAATAGGTATCTGTCCAGTTTTGATACCTTTTTCAGTGTTAAGATTAGTAAATGTTTAGTAAATGTTCTATCTCGTGAAGTTATCATTTTTAGCCTTCTATCTAGTTGGGTATTTAAACATTATGCTAACTCCATTTGATGGCTTTTTTTCTTTGTAATGAAATCCGTAGCTGAGACTCATCCATTCCCTTTCACAAGAAAGAAAATCAAATTGTGGGTAGAAAATATTAGAAAATATTTAAGTGCAAAAATAAAGTATAGGCATATCATCAGGATTCAGTGCCATTTAGTCTGGTGTTTTCATAAAGCTATGTGGCAGTGTTTGGGCTGATAGTATATATTGCAGTGTAGATACTAGAAAACCTGTTTTTGTTTTTGTTTTGTTTTTTTCGAGACAGGGTTTTTCTGTATATCCCTGGTTGCTCTGGATCTCACTTTGCAGACCAGGCTGGCCTCAAACTCAGAAATCTGCCTGCCTCTGCCTCCTAAGTGCTGGGATTAAAGGCGTGTGCCACCACCGCCCAGCTCTGTTTTTGTTTTTTATTCAAAATGTTTATTACATTTTACTTAGTGTTTGTGAATATTGGGGAGGGGGCATATAGAGGTAAGAGAACAACTTACAGGAGTTGGTTCAGGTCTTCAGGACTGGTGGCAGGTAATGTGTTTTTCGGGTTGGGATGTTAACTCATGGCTGCCAGAACAAAGCATCAGATGCTAAAGGTACTGATAACTGTTGTAAGCAGCCGAATGTGGGTGCTAGAAACTGAGCTCCAGGCCTGTTAACTGCTGACTTCTCTCTCCAGCCCCAAGAACCAAAATAGTTACTTTTTATTTTTATTTTTTATATATTTATTTTTTTGATATGGGGACTTATATTAAGTAGTTCTGACTGCTCTGGAACTTACTATGTAGATCAGGCTAAACTTAAATTCATAGAGATCAGTCTGCCCCTACCTATGTCTCTCGTGCTGAAAGTAAAGGCATGTGCCAAAAGTTTTGTGGGGTTTTTGTTTTTGTTTTTTTGACAAAGGGTTTTCCTGTGTATCTCTGGCTGACATGGAATTAACTCTATAGACCCGGCTGGCCTCAGACTCAAAAATCTGCCTGCCTCTGCCTCCTGAGTTTTGGGATTAAAGGCATGTGCCTAATGTAAAATTTCATTACAGTGTATTATGTTTCTGTTTTTGAGCAGATTCTCATAATATAGACCAATATGGCCTGGAACTGACTATGAATCCAGACTTTGGCTTCTTACTCAGCTTTTTGAGGGCTGAGGTTATATGAATGAATTAGCACACCAGGCTAAGATGCTAAGATATGTGCTTTAAAACTTGTTAACATAGCACTTGGAAATGTTTTAATTTTCAGTTTGTGTGTATGGCATATATACTTGGTTACACTCGGAGGCCAAAAGAGGGCATAAGTATCCCCCGTAGCTAACAGTGTTAATAGGTTGTGA
D3_15 153620316 153635366 15051 CTGGGATTAGAGATGCTGTCTCTTAACAGACTATTAGGAGTTACTAAGTTCTATCAACTGTTGTTTCTGTTCAGCTTTGCTTGTCTGTACCTTAGTAGATACATGCAATTGAAAGATAAGCATGTGTAGTGATGATTACAGATTTGCCTTAGTAAGGATTTTGTTTGTAATAATATTGTCAGGGATAATTACTGTGCAACTCTAATGAACCTACTCTATGGGAAGTAACCGAAATGTGAGTATCAGCATTTACTAAGTGACACTAATTACAAGGAGGAGGAGTTCAGAATAAACCTTATTTACTGAAGGAATAATTATTTTTCTACCATTTCTGATATATTTGACTGTCATTTAGGGCTGATATAAATAATTTAGATTTTGTGGACCTAGTGGCTCTGTCAAAACTACTCAGCTCTGTTATGGTATCAGGAAAACAGCTATCTCCTCTGACTCCCGCTCGCTCTCCCTTACTCCCCCCACCTCGCTCTCTCACTTTCTTGCTCTCTCGCTCCTTGCTCTCACACACATCTTTTCTAAAAACAGTTTTAATGTATACCAGCTTTTATTGCTTTTTCTTCTTATTTCATAGAATATTCTTGTTTTAGAGACTGACTTTCTTTGTAGTATATTCTGGCCTTGAGCTCACTTGATTGCTCACACTGGCCTGAAGCATGTGTATGACTTTTGTCATACAAGTACTCGAATTGCATGGGATTGTCACCATTGCCTGCCTTTACAGTGTTGCAAATATGGAAAAACACCTTGGTAACAAAGAAGGGTTGGAGGGATGGCGGGATGGCTTCAGTGGTTAAGAACACTGGCTGCTCTTACAAAGGACCAGCACTTGATTCTGAGCGCCTATTTGGTCCCTCACAACCTTCTGTAACTCAGTTCCAGGGGTTCTAGTACCTTTTTCTGACCTCCATGGGTATCAAGCGTGCATGTGGTATACAGACATATAAAGGGAATAAATAATAAAACAACAGTAAAAGAAAGCAAATGGTAAAAAGTACCCTTTTTGGTTTGTTTTTTTTTTTTTTTTTTGTAAAAGGTACCGTTTTGGGGAATTGGGGAGATTCAATAGGCAAAAGCAGTTGTTTACTCATGAAGTCTGGAGTTCACTCAGGTAAACAGCTAGATATGCATGTGGTGGTATGGGTGATGGGTGATGGGAGTGATGTACCACTCCTCACTACCTGTGGCAGGGAAAGCAGACACAGAGGGAATGAAAGCTGGCCCCAGTGGATGGTCCTGTTCCTCCCCTGGTGGCACAGGGTACAGGAATGCGGGTGGGCTGATCAAAGTAGCTACCACCTAGGCTTAGATCCTGGGCTTTGAGTTGGCCCACCCCTATATCTATCCAATCTTGGAAATGGTGGAACTTGTGAAGGGGTTGGTCCTGCAGAACCAAAGCAGCAGGATCTCTATGACACAGGGCAAGGACAATAACAGGATAGCCTAGAGGAGTCCTGGTGGTGAGGGACCAATGACTCATTGTAATGAACATTTACAAGTAAGGATGTGTGGACAAAAGGATATATTATGCGATACACTATAGCTTCCACAAGATGTTTTTTGTTTTGTTTTTTATATTTGTTTTCTTTGGGGGGTACACTGAAAGGCCAGAGGGTGGGTACGAAGGGACAACAGATGAATGGGATTGGGGTACATGATGTGAAATTCACAAAGAATCAAAATAAAAAGTTTTAAAAAGGGGAATGGGGAATACAGAGATGGCTCAGTGGTTAAGAATACTGACTGGGGGGCTGGTGAGATGGCTCAGTGGGTAGGAGTACCCGACTGCTCTTCCGAAGGTCCAGAGTTCGAATCCCAGCAACCACATGGTGGCTCACAACCATCCGTAACAAGATCTGACTCCCTCTTCTGGTGTGTCTGAGGACAGCTACAGTGTACTTACATATAATAATAAATAAATCTTTAAAAAAAAAAAAAAAAAAAAAAGAATACTGACTGCTCTTCCTGAGGTCCTGAGTTCAATTCCCAGCAACCACATGGTGGCTCACAACCATCTGTAATGGGATCTGACGCCCTCTTCTGGTGTGTCTGAAAAGAATGGCAGTGTACTCATACACATAAAATAATAAATCTTAAAAAAAAAAAAAAGCTAGGCATGACTTAAATGCCTGTCAGTAACCCTAACACATTGTTGGCTTAGAGACAGGAAGATGGTTGGGGCTTGTGGCTACAAAATTAGTGAGACACTGGACCTGAAGGGAATGACATAGAAAGTGATAAAGCAGAACAAGTGTTGTTCTTCTTTGGCCTCTCCGAGGGCACACCTGAACACATGTGTGTTTATAGTTGTATACAAACATAACACACAATGAGCAGTTTAGGATGGAGATGCAGATAATTGTAGAGTATGTCTGAGGTGGTATGTTAATCCCCTTGCATTTTTCATTAGTGGAAAAAGCAGAGGGGGATAAATTGAAAGAGATAATTGTTACATTCTTTTTGGGTTTGGGTTTGGGTTTTTGTTTTTTTGTTTTTGTTTTTTGAGACAGTGTTTCTCAGTATAGCCCTGGCTGTCCTGTAATTCACTCTGTAGATCAGGCTGGCCTCGAACTCAGAAATCTGCCTGCCTCTGCCTCCCGAGTGCTGGGATTAAAGGCGTGCACCACCATGCCCGGCTCATTTTAATTATTTTTAAAAATAATACTGCTCCTTTGTAGATTAATACTGTAATCATTTTGTTTGTTGGGGTGTAAAAATCTCATTTAAAATTCAACAACCTATTTAGACAATACCTTTTGTAGTTCTGTAACCTTTAGGGGGAAAAGACATTCTTTCTAATGCTTAAAATCCTAAAGGTTTTTTTTTTTTTAAAGATTTATTTATTTATTATATGTAAGTACACTGTAGCTGTCTTCAGACACACCAGAAGAGGGCGTCAGATCTTGTTACGGATGGTTGTGAGCCACCATGTGGTTGCTGGGACTTGAACACTGGACCTTTGAAAGAGCAGTCGGGTACTCTTACCCACTGAACCATCTCACCAGCCCAATCCTAAAGTTTTTAAGGAAGGAAAAAATGTCAAGTCATCCAGCCTGTTTTCACTCTGGCACATAGAGTGCTGGATCTGTACTCCTCTGTCTGTATGGCAGTACTTGCAGCTGGGTTAGGAACTGGGTCCCAGGTCTCAGTGTGCCAGGTTAAAAAAAGTGTTTCTTCAGGTTTGCAGCCATTGGCCACTTTGTCTTTCAAAACATCTTTTTTGTTTGTTTTTTGTTTTTTCGAGACAGGGTTTCTCTGTGTAGCCCTAGCTGTCCTGGAACTCACTCTGTAGACCAGGCTGGCCTTGAATTCAGAAATCTGCCTGCCTCTGCCTCCCAAGTGCTGGGATTAAAGGCATGTGCCACCACACCTGGCACTTTTCTTTTTTTAAGCTTTGGTTTTATTGTATTGGTGTTTGCCTATATATTTGTAAGGAAACCACTCAATACCTAGAGCTTACAGGAGTTTGAAGAGGGCAGGATCCCCAAGAACTAGAGTTACAGATGGTTGTGAGCTAGCTGCCATGTAATCCCTGAGAACCAAACTTGAGTCCTCTGTAAGACCAAGTTGTGCTCTTAACTACTGAGCCATTTTCTTAGCTCCAACAAAGACTTAGTTTGTATTTTATTTTATTTTATTTTACTTTATGTGTATAGTGTTTTATATGCATGCACATCTGTGTATCATGCTTATACTTACCTGATGCAGAGGCTAGAGGAGGACATTGGATCCCCTAGAACTAGAATGACTCTTAGGAGTTGCCATGTAGGTGTTGGGAATTGAACTGGAGTCCTTTCTAAGATCACTAAGTACTTACAACTGCTGAGTCATCTCTCTCCAGCTGCAAGATTGGTGTCTAATGTCAGCAGATTCTTTCATAGCTATAGGTAGAACTGCTCCAATGGGGGCAAGAAAAAAAAATTAGACATTAACTTGCTGAACAAGAAGAAAAAAATAATCTAAAAGCTATACATTTTGTTTATAACAGAAATGGAAATAAGCAAGAGGAAATAGACAAATCAGCTGACTTGAGTGGGGTACCATTATCTTAACAATTTTCAGATCCTGAGATGAGCACTTTTGTTATGCCTGGTTGGTTTGAATTTATAGTTTAGATTGTCTTTACATTTTACTGACATTTCTTACTGTTTGCTTTTGTTTCATGTTGGAAAAGTGGTTAGTATGTGTCCGTGCTACTGCCCTGGAGGTGTAGGACAGGGTGGTGATGCACATGCCTTCTAGTCTTAGACCTAAAGTGTGGGGGTGGCGGGATGGAGAACTCAAGGTCATCTTTGGCTACAGAAGGTTTGAGGCTCTCAAGACCGTGTCTCAAAAACAAAGGATTGGATGAGAAGTTCATCAAGGTCAGGGTTTTAGCCAGGCATGTGGTATGTTACTTGCAGTGTAACACTGAAGAGTTCAAATTGATCACACAAAAATATGTAAAGCCCTTTTATGTCATAAAATGGGTATATAAATGGAGATTTCAATTGCTGTGAATTGAAACAATAACGAGGGACTGGAGTGTTTTCTCTTGTGGTTTCTGTCATTACCACTTAAGCAGTGACTTAAACTCCTAAGCCATCTTCTGTGACCCTTCGGTCTCTTTTGAGTGCTTTCTGGGTTAGACATCAATAAGACTGACTACCATTATAGCATCTTTCTGTATGAAAAGTAAGCTAGCTATGCGTATTTTTTTTCCTCTTATTTATGATGTGTTTGCATTATTGGCTACTCACTTCTTTCAATTGTTTTTATTAGTAGTATTATTGTTTGAGAGAGAGAGAGAGATACTTGAGGTAAGAGAACCATTATGTGAAGTTGTTTTTCTCTTTCTACTTTTATGTGTGTTCTGGGGAACAAACCTAGGCAGTTGGTATCTTAGTTAATTTTCTATAAAGAATTTATAAAAGACAGACTATTTGGGGCCTTCAGTTTCAGAAGGTTAGAGTCCGTTACCATCATTGGCAGTGAGCTTTGCAGCGGGTAGGCAGCATGGTGCTGGAACAGTAGCTAAAAGCTCACATCTTTATTCACAAATAAGGGAGACACATTCTGATAAAAAATATGGATCTTTTAAAACTCAGAACCTATCCAGTGATTCACCTCCTCCAACAAGGCATAGCTCCTAATCCTTTAGGTCTACCAACTGTGGGCCAAGTATGGAGATAACTGAGCCTGTGGGGATCGTTCTCACTCAGACTGCTACAGTTGGCTTGTGCCAGTAAACACTTGACTTGCTCAGCCGTCTCACTGGCCCTGCTGACACTTGTTATCGCAATACTCTGCTGTTCAGAATGGTACCATTTGCTCTGGTTAGCTGATGTAACAGCTCAGTCCTGATGGAGGTCTTGACCTCTCGCCTTAGTTGGTGAAACATTGGAGTACTTGAACATACCTGTCTGAAAGGGGTGTATACAATTGTCTGGATTTCCAGCAAGAGGGAAGTTGACTGTTTTCAGAGTCTGTTCTAAGTCTTCCTTAGAATCTGTTTTATGCTTTGGTGAGATGAACTGCTTTTTTTAAATATAAGATTTTATTGTTCTATTTTAATTCTGCATGTGTATCTGTCTGTATATGCCTCAGGAGTTCATGTGCCCACAAGACCAGAGTTGATAGGCTCTGTGAAAATAGATTTATAAGTGGTTATGAATTGATCAGTGTGGGTGCTGGGAACTCAGTTGAGTCCTCAGCAAGAATAGTCTGAGCTTTTTAACATCTGGGCCATTACTGCAGCCCCTGTGTCTACCTAACTACTCATCTGCATAACATTTATTTACTTACTTAGTTACTGGTGTATGTGTTTGGGAGTGTGCATGCCACAGGACACATGTGTGGATGTCAGAGGAGAACCTACAGGTATTGATTTTGGGGAATTCTGGGACTCAAATTCATGTTGTTAGGCTTGGTGGCAGGTGCCTTTAAGTGCTGAACCATCTCACTGGGCACCTTTCTCTCCCCCCCCCTTTTTTTTTTAATCTTAAATTTTTACGTTGAGTCCTGTGTTTTGTAGGATGGTTCCTGCCTCCACCTCCAGAATGCTGAGATTATAGACATACTGCCATATCACATTTCTGCTATCCCCGGGGTAGAACTCAGGACCCCATTCATGCCAAGCCAGCACTGTGTATACTGAACCCAGAAAAGAACTGAGTTTTGTTGGAACATGAGATGATAAGGTCACAGTAAAGGCAGTGGTGAGGAAAACATTGACCATAGAGTGCTTTTGTGGTAGCTTGAGGTAGAAATGAATTGGTATTGTCCAAGTTGCTAAAGTGATGCTTATTTGTAAAACATAAAAGACTATAGTTCTCTTGTGATTATTATTTTTTTAAAGCACCAGGTTCTGGAAGAAAGATTCTGTATAATATTTCCTAAGGTTGTGTTTGGGAAAATGTTTGATTTTTTTCCTGTGGTCAGCCAGCATAGAGACTAGATTCAGCATCTCTTCAGATCGGACATTAGGTAGAAGGATTTGTTTATTCTGAGAAAATTGGTGCTTTTTACTTAGCTAAACCTGGAAGGAAGGATAGTGACTGGTGTTTGAGTGTCAACCATATTCCAGATGAGTAGCATGTTCTTTAGAGTAGTTCTTTTGACACACAAGTACTCAGATTGAACAGCCAGTTTGAGGACCACAGTCAAATGTTTCTGTTAATTCAGAGGTTTCATTTTAACAGTAACAGGTAATGTTGCCAACTTGATAGTTTTGAGAAATGTTGAGGAAGGATTTCAGTAAAGGACACTTTGGGGAAACGTCTGTTATGGAATTTCTAGAGGTAGTTAGATCATGAGACCTTGACCAGATTAATCATTTGATGTATTCATAATATGGCCACATTATTAGGATATGGTCAGTGGTAGACATAAGGAAGTAATTGGAGAAAATCAGTTAGTGGGGTGTTGTTGGTCCTCCGAGCCAGTGGCGACACAAAGGACACAGACACCGAGTCGGGTTCACGCAGCAACATCTTTACTTCGGGCTTTTTCTTTTACAGCTCTCTTCCCCAGCAGCTTCTTCTTAGGACAAGGGCTAAACTACTCCTATTACAACAGCTTCTCTTACTCTACTTCTACTCACGGCAAGGGCTAAAACTACTCTTATTCTACTTCTGGCTTCTACCTAGGGCAAGGGCTAAACAACAACTCACTACTCGCGCCGACTCACCTCCTTCTAGCTCCACCTCACCTCATCCAATCAGAATTCACACACGCTCCAGGCACTAGCTTAGGTCGTTCACAGATAGGCCGACAGGTCTGGATCACGAGGAACTGTCCAGCCTGGCAGGCAGCCCACGCATGCAGCCTCACTGCCCGGGCAAAGTAGCAAACCAGTGGGTTTCACGGGGCCTGCGGCCCGCAGGGTGTCGTCTTTGTGGGGCTGTATCTTGCCCTGGCCTCTTCCTGTGCCTCCTCTCTTAGCTTCTGACATGAAGTGAAGAGTGTTCCTTTACCACCTGCTCTCAGCACTTCACTGCTCTGCCCAAATGCACAGGCCATGCAACCATGCAACAGGCCCTCCGAAACTTGAACCAAAATCTTGCCTTAAGTTGTTTGTGTCAGAAACTGGTCACAATGATGAAATGCTAACTCATAGAAAATTGATACTGGGCTGGAGAGATGGCTCAGCAGTTAAGAGCAGTGACTGTTCTTCCAAAGGTCCTGAGTTCAAATCCCAGCAACCGTATGGTGTTTTACAACCATCCGTAATGACATCTGACACTCTCTACTGGTGTATCTGAAGACAGCTACAGTGTACTTAAATATAATTAATAAATAAATCTTTAAAAAAAAAAAAAAGCTGGGTGTGGTGGCGCACGCCTTTAATCCCAGCATTTGGGAGGCAGAGGCAGGTGGATTTCTGAGTTCAAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTCGAAAAACCAAAAAAAAAAAAAAAAAAGAAAAAAGAAAGAAAGAAAAATAAAATAAAATTGGTACCAAAGAACTAAAGTATGGTGGTTAGTGTTGTTAATTTGACAGGGTCTGGAACTTCTGGAACTTCTCAGGGACAAGCTTCGAGACACATCTGAACATGTTTATGAGGGATTCCATTTATTGGGTTAATTGAGGTGGGAAGTGTCACTTTAAAAGTAGATCCCACCATTTCCTGGGTCTGCCAGGACAGTGGCTCTGTGAGTAAAGACCCTTGTTACTAAGCTCAATGACTTGAGTTTGCTCCCCAGAAAACTATGTGGTAGAAGGTGAGGTGAGAACCAGATCCTTTTGAAGGAGATGGGTGAGAAGGGAAAAGGGAGAGAGAAAGCTGGCTTAGCACTAACATTCTTTGTTCTCTTCAGACTGGATGTATGTGACCAGCTACTTTATATATCTGCCTTATGTTCCACTGCCATGATCAACTGTGGGCCAAAATAAGAGTAAATCTTAAGGAAAAGAGAAGAAGGAAGGAAAATGCAACTACATTCAGTGTAAATGCAGCCACCTTTTACTCTGCTGTGTCCTTCCTTCTCCAGGAATCCCACTGTCCCTTTTATATTCTCCGAGCTTCTGTGGTCCTACCCTCTTACTTAAAGCATGTTCTAGGCTGGCAAAGAATATATCTTACTGTTTTACAGTGTCCTGAGACTTTGACATTGAATATAAAAGTAATGATCTGATTAATTTGGCAAAGGAATTTTCAAGTGTTCGGGAATTGGTATGGTTCTTGTTAGCAGTTTTTAGCTAGATTTATAGTGAAAATTAGTATAAAGATTTGAGAAATACGTAGACAAAAAGTGCTCATATTTAAAGCTCTAGACAAGAATGGTATTATTAGAGAAATTAGTGGCATTAAAAAGATGCTTTGTGGCCAGGGGAAATGGCTCAGCAAGGTTGCTGCCAAGCCTCACAACCTTTTTGATTCCCAGCACCCACACAGTAGAAGGAGAACAAGTTATCTCCCTGCAGATCATCCTCATGCATCTGTGTGCACTGTGGCATGCAAGCACGCACAGACATTGTATGTGATTTGTTTTAAGAGAAAAGACCAGCAGTTTATACTGGGACAACAGGGAAGATGTCTCTGAGGGGAAACTCCGATCTTACCTTTGACAGGCTCCAGAGTATAAAATTTTATTTTATTTTTTTGAAGGATCATCTCTCCAGGCATTCAGAGTTTGAAGGGTCCCAGATGCTAATTGAACTGACAATAAGCTTTTACATTTTTCACAGGATGCTGGTTTTGCAGACTTGCAGATGGAAAAGTTATAGACTCATGGAGGCTTCCAGTGAGATTTCAGAGGGAGGACTGATAATGCATCAGCATCCATGCTGGCAGTCTGAGAGAGTGATGCATGAAACTGTGGTAGACTCCTGAGTGTGAAGTATGAAGCTTTACCTGATCGTGGTGGTGCTCAGATGCTCGAGAGAAACAGTTTCAAATTATTTGGGCATTATGGGGCAGTAGAAGCTTGAGCATTAAAGGATATTTTGTTTAGAAAGATACTATCTAGTGAACCAGTGGCTTTAGAAATTTATGCCTTAATATCAGCTGATTGTTTTAAACTTCTCTTTTATCTACATGCTAGTTTCTCTCATGAAGGTATGGCCTAAAAAAATGCTGTTTTAAAAACTTAGCCAGGTGTGATGTTGTATACCTTTAATCAGATGCAGAGGCAGGAGGATCTCTACATTCAGTACCAGCCTTGTCTGTATAATGAATTCAAGGCCTGCCAGAGCTACATAGTGAAACTCAGTCTCAAAAAAAGCCCTTCAAAAACTAAAACTTACCATCACAAGTATAAAGTGGCTCCTGTCCAGGCTGCTGCTTTCATTTCACCCTTTGAGAAACAACTGCTTTGTACCTTTTAAACCACGTAACAGTCAAATTGTTGGGTTTTTTTCCCAAAAAACACCTTGTGATCGTGATGTGTTTTTGTTTGACACTTCTCAGTGGTTCTCAAGGCATTGATAAAGATCCAAACCCCACTCAACGATCCCTGGCTTTCTTTCAGTTCTCTGGATGTCTCAAACTTCTAGTTTTAGGCTTTCCTATTTCAAACTCTTCATTTTGCTTGACTATATAGTTTAAGAACTAATAATATGGGGGTTGGTGAGATGGCTCAGCGGTTAAGAGCACTGACTGCTCTTCCAAAGGTCCTGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCTGTAACAAGATCTGATGCCCTCTTCTGGTGTGTCTGAAGACAACTACAGTGTACTTACATATAATAAATAAATAAATCTTTAAAAAAAAAAAAAGAACTAATAATATATGTTGTTTCTCAGAACTTTCTCTGGCCCCTAAATTGAGTTTCTTTTCTAGGGTCAAAGCTCTTTTTATTTTATGCATAAATCTTTTTCTGAATATTCGTGTGTGCAACACGTGTGTGCAACACATATATGCTTGGTGCACTCGGAGATCAAAAGTGGGCATTACATTCCCTGGAACTGGAGTTATGGATGGATGTGAACTACCATGTTTGTGCAAGAGCAACAAGTGACCTTAATCTCTGAGTCATTTCTTCAGTTCCCTGGTCTAAACTTTTTATCACAAGTATCCAATTTCTGTGTGTGTGTTTAATTTGAGTACCTGATAATTCTCTTCTGATTATGTCTTAGATGCAAAGATGCTATACTATTTTGCTTTTGGCTATATCTCATAATTTCAGTAAAAAGTAACAGATTATTATACAGATAAGCCCTGTCTCGGAAAAAAAAAAAAAAAAAGAAGAAGATATAACCCATTCCTCTTCTTACCTTGTACTGTTCCTTTGATGTCACAGTCTTACTCAAATGTCAGTGGCTTTTGGTTGAGACTTTGGTGATAATTCATTGCTTTGTGATTTTTTTTTTTGTTTGTTTGTTTTTAAATCTCACTTGTCTCTTGCAGAAGCAGAGAAGTGGTTCCTCTCTATATACTTGGTGCTAGAGTGGGAGTATATGTCTCTTCTCAGTTTTTGGTATATTCTTTGCATATTCAGGTACATATTCTGTATCTGTTTGCATGTGTGAGAGCAACTCAGAATTAACATGTACAAAACTAATGTCATGATTATTTTTCCCACCACTGTCTTGGCTATACATTAATGGAATTTCATCCTTAAAGTGGCCAGTTATGAAACTAACCATGAGGATTTGAGGCCTGCAGTGATGCACAGATTCTCCCTCTGTGGAGCCATGGAGTTGCACTGTCTATTCTCTAGTGTCTGAGTGTTTCCTTTGGTGCACTTCATGGCAGATACTGAAAGAGAAAGGGTAGAGAGAGACGTGCCCCCTTTTTTTTTTTTTTTTTTTTTTTAAAACAGGAGTACACAGAATAGTGCATGCAAAAGGCGTGGGACTCTAGAACCCCATCTTTGAAGTTGCTCAGATAGAAACCTTCCTTTGGAGTAGCTCTTCACTGCTTGTCCAAGGAATCAGCAATTCTTGGTGCATCTACCTTCAGAAGACAGCATTTAGCATTCCGACTGCCATGACCCTGGTAATGGCCCCCATAGGCTCATATTGTTAGAGTACTTAGTCACCAGCGAGTGGAACTGTTTGGGAAGGATGTTAAGAGGTGAGACTCATTGGAAGAGATGTATCCTTGGGAGTCAGCTTTGAGGTTTAACAATCCTCCACAAAGCCCCAGTGGATTGCTTCCTGCTACCTGCAGATCAGGATGTAAAGCTCAGATGCTGCTCCAGCTCCAGCTCCAGCCTGTTTCCTGACTGATGGCCATGGACCAACCCTCTAAAACATATGCCTTAGTCATGGTGTCTCCTCACAGCCATAGAACACTAAGACACCGATATTAAAGATTCTTTAAGGCCAAATAGTTGAATCCATTGATTATGGGCAATTAAAATGTTGCTACAGACCAGAGCAGAAAGATGTCTTGGATACTTAGTCCGTTTGTAAGTCAGTGATGGGCTCCTCCTGTGTGATGAGCATCCTTGTGACTGTATAAACCAGCAGTTCTCAACTTGTAGGCTTTGGGCCCTCAAAAGACCATTGGAAAACAAAAACACTTATGATTCATTATAGTGCAAAACTACAGTTATAAAGTAGCAAGAAAAATAATTTTATGGTTGGAAATCACCACAACATGAACGTACTAAAAGGTTACAGCATTAACAAGATTGAGAACCACTGGTCTAAACTTTTAAAAAGTTGTATTATCAGACTACTAGGTTCTTTCAGTCCAAGAGCTAGGACATCATTAGATAACATCTGAATCCTTAACTGGGTTCCCCTGTTTGCTGTAACCTGTCTATCTGTGGTACCTACCAGTAGCGTTGGCTCATATAGGTGCGTAACTAATACAGTCTCATGTAACCATTTTCAGAGTGGAACGTGTGTCCTCCAGGGAAATTTGAATCTGCATTTCGGGGCATAGTCATTCATATTTACCTTAAGAGTGAACTGTCTTCTTCCCTTTGAGATAATAACTGTTTTGGTTTTTGGTTTTTGTTGTTGTTTGTTTCTTGCGTTGATACAAGGAACCTCTATAGGGGGAAATTTTTGTTGTTTTAAGCCAAATCTAAGCCTAAAATCTAAAGAGATTTTACAACACTGTTGGTCAGATTACACCATTCCTCTACTCAAAATCTTCCCGTCCTATTTTCTGTCTTCACTCATAATAAAGGTCAGATTCCCTAATGTGGCTTACAGTACCCTAATTTCATCAGCTCACTCGCTCACTGTTCCCTAAATGCCCTAGGCTTCATGGGGATCCTTGACCATGCTGGCATTCTTCCTCCCAGGACCGTTTTCTCTGCTCTTTCATCTCAAACACTATCCTCTTTCGCTATGTCTTATTTTTCTTTCATATATTACATCTTCAGTTTCCTCGCCTTCCTCTCCTCCTTGTCCCTCCTCTCCCATTTCCCCTCCCCAGGGATACCCACCAAACATCCTGCCTGCCTTTTTTTCCCCTAGATATTCATCACAGTCTGACTGTATGTTATGCATAGATCTCCTTTGGTTAGGGTATAAACGTCCATAAGGGAGTGTCTTCTACTTCAGTGAAAGAGACCAAGACAAATCTTGTAAGAGAGAGAGAACATTTAATTGGGGGCTGGCTTGCAGTTTGAGAGGTTTTAGTTCATTATCATCACGTCAGGGAACATTGTTGCAGGCATTTGAGTAGTAGCTGAGAGCTTTATATCTCCTTACGGATAGCTTATTAATTGTAGTTCTACATTTCTCAGGGCTTGCGTGATTTTATAACTTGAGTTATCAAACAAAAAATGCACCTTATGTCATTTCATGTAAAAATGCAAGATCCATGTAATATTCTTGCATTTAACCCCTTTATAGTTGTGTGTGTTTATTCATGTATTACAAGCTTGCTATAGCATGCACATTTAGGTTAGTAAACAACTTGCAGGGCTTGAGACAGTTAGGATAGGCTCAGGAGTGGTAGAAATGGTAATTTCAGGACCAGGTCCCAACTAGCTAGGTTAGCATCTGTGCTTAACAGAGGCAGGCAGATCTCTGAATTCTTTTGCAAAGTTGAAAGTAAATGTGTGCAGCTCTCACTTAAGAAGGGGCTGGAGTCACAGGATTCTGATGTAAATGAGTGGATTGATATGTAAAATAAAAGACTAGGTTTGTAATCTGTAGGAGTTGAGCTACCCCCAGGAAAGTTTTTATAGAACAGCAAGAGACCTGTTTGGAGAACTGTCTAAAGCAGAAAATACAGAGAGAGCTGTCCAGAAATCTCCAGAAAGAGCAGATCAGAGAGAGAGAGAAAGCAGAACAGAGAAAAAACAGGCTGAGAGCTGTCTCCAGCAGAACATAGGTCCACCTTGAACCCATGATTTGACTTCAAGTCATTTAAATGTTTGATCACTCCCAGACACCCCTTCCTCAGAAGGCTGGTCCTTGGCATTTTCTCAGTTTATTAGGGTCATGAGCTGTAGGTGGCAGCGCATGTAATGTTACATCAATGGTATTATTCATATGTTTATCAGGTTTCTCTCATACTCAACGTATAAAGACAAAATGCTATGACTTAGCAGGTAATGTATGAGAATCTAGGAATTTAGTGAAAAGACAGTAAGGCATATGTACAATGATCATGGGAGATAAGTGTGGTGATATGTGCCTATACACTCAGGGTTCCGATGGGCCAGCATTGGTTATTCCCATTCTTTGGGCCTATGATGAGGCACATCTTTGCATTTTGGCAGAGCAGAACCATTTAGCTCATGTCTTGTATACAAAAGAAATAAAATGTGGCTTCCATAGTCTCCAGGGCATGTCTCCAGTGTTCTCAAACCTCTTACTAGAACATAGTTTTGTTTCCTTCCCAATAGCACCAACACAAGGGGATCAACCCTTTAACACTGCTGTTAGAGGGAGTCTTAAGTTCTCAACTGTGATATGTAGCAATCCTGATTTTCTAATGTTTCTATGACACTATCAGGGTGATAAATTGCAGATCAAAATCAGTTTATACTATTTCTCTTACTTGTATATGTCTGTTTCGTCTGCTTGGTTCAAACTAAGGTACCGTCCTATTTCCCACCCCACCTTTTTTTCAGGGTCTTGCTCAGGCTGGTCTTAACTTGTGGTTCCTCTTTTTCAGCCTTCTAAATGCTGAGATTACTATGCTCACTTCCACCCTCAATTTTTGGTGAAAATTCACAAATTATACTGTTTTTGAGTTTTTAAAAGTTACATCTACTTACTTATTAGTATTATCACATGTGATAATCACAGCAGTTTTTGAAAATCACTTTTTTCCTTTTATCCTGTGGGTCCTGGAGATTGAACTTGGGTCTTCAGACTTCGCAGCAGGCGCTCTTATTAAGCCAACACTTGTGTGTCTCTATCTTCATGTGATTTTTTTGTTGTGTGTGAGTGTTTTTTTATTAGACACACCTTGGAAGAGAACCAGAAGTGTATTTGCTATTTGGTTCTGTTTTAAATGGAACTGTTATTAAATTACATTTGTTGTGGCTCTATAGAGTCTTTGTTTAGTCAAAAATTGACAGAATGGTTGGGCAGTAGTGGT
GF1 -1 -1 1 GACAAGAGCAGTGTCAAAATGAAC
GF2 -1 -1 1 GTTCCTCATTGTTATGTGAGTCAC
GF3 -1 -1 1 GCTGCTTATGGAGAGACAGAGTTGCTG
GF4 -1 -1 1 CTGCTGCTTATGGAGAGACAGAGTTGC
EX5 -1 -1 1 GATATTTGGTAAGTAGACGCCAAC
EX52 -1 -1 1 GTGGGACATCCCCTCTTGCGTGCCTCAATG
EX3 -1 -1 1 GTTGGCGTCTACTTACCAAATATC
EX32 -1 -1 1 CCTTGAGTGTGAAAAGACTAATGCGGCCAG
GR1 -1 -1 1 CTAATGTCCGATCTGAAGAGATGC
GR2 -1 -1 1 GCAGATGAGTAGTTAGGTAGACAC
GR3 -1 -1 1 GAACATGCTACTCATCTGGAATATGGTTG
GR4 -1 -1 1 GAGCCTATCAACTCTGGTCTTGTG
Comments:
critical exon
OTTMUST00000040633 OTTMUSE00000199019 Likely KO
created candidate regions
critical exon
OTTMUST00000040633 OTTMUSE00000199019 Likely KO
created candidate regions
run oligo design
Best BAC found is: bMQ429l08
sequences unchanged by blasting
run alignment to bacs
REJECT OTTMUST00000040633:OTTMUSE00000199019:VF:2:153614420:153615419_109
REJECT OTTMUST00000040633:OTTMUSE00000199019:VF:2:153614420:153615419_109
REJECT OTTMUST00000040633:OTTMUSE00000199019:VF:2:153614420:153615419_109
REJECT OTTMUST00000040633:OTTMUSE00000199019:VF:2:153614420:153615419_103
REJECT OTTMUST00000040633:OTTMUSE00000199019:VF:2:153614420:153615419_103
REJECT OTTMUST00000040633:OTTMUSE00000199019:VF:2:153614420:153615419_103
REJECT OTTMUST00000040633:OTTMUSE00000199019:VF:2:153614420:153615419_76
ACCEPTED COMBS: 2
REJECTED COMBS: 7
run self-alignment tests
DESIGN COMPLETE
U-type: U1
D-type: D1
inserted validations for oligos
written report
created candidate regions

webmaster@sanger.ac.uk

Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SA, UK  Tel:+44 (0)1223 834244