High Throughput Gene Targeting: Create Design

This custom vector design tool is provided by the EUCOMM consortium as a service to the research community. When using this tool, the user agrees not to submit more than five designs per day for creation without prior discussion with the High Throughput Gene Targeting Group at the Sanger Institute.

Design Type Oligo Select Method Artificial Intron Design
 
       
Gene Build Gene
Start Exon End Exon
Target Start Target End
Primer Length Design Comment
Created by wy1
Valid After Annotation
not done
oligos on fwd strand oligos as ordered View gene and design in Ensembl UCSC BLAT recombineering primers
Design ID: 301338
Chr: 7
Strand: 1
Status: Ordered
BACs:
Oligos on GRCm38:
Type Start End Length Seq
G5 101395196 101395245 50 CTAGTGGAGCTATCTGCTCTAGGAAGAACCTTGGAGCTGCCTAGGTTCTC
U5 101398146 101398195 50 GGCTGCAGCTGGGGGAATACTCAGGTAAGTGGTGAGTTAAAATGAAGAGC
D3 101398532 101398581 50 CAGGTCCACACAACAAAGAGACTGTAAACATTGACCTTAGCTCATGAGGC
G3 101404985 101405031 47 CTGCCAGCTGCCTTCCTTACACTACCTGGGGCCAGGCGAGCAGGGTA
Oligos:
Type Start End Length Seq
U5_D3 108546660 108547095 436 GGCTGCAGCTGGGGGAATACTCAGGTAAGTGGTGAGTTAAAATGAAGAGCTTATAGGTTGGGTAGGAGCAGAGACCCAGGGAAATGGCAGGAGTGCTTTTCAGCCAGCCTGGGGTTTTCTTCATGGTTCCTCTGTCTAACTTCTCCACAGAGTTCAGCCGGCGCTGGTGTGTCCTGAGTGATGGGGTCCTGAGCTACTATGAAAACGAACGGGCAGTGACACCCAATGGGGAGATTCGGGCCAGCGAGATAGTATGCCTAGCAGTTTCCCCTCTGGACACCCATGGGTGAGTACCCCTAGGCATAACCACAAACTACCAGTGCTAGGAAGTCCAGTGTCTGATTGAGAAGACAGGGACATAGGCCCAGAGAAGGACAGGACCTTCTCAGGTCCACACAACAAAGAGACTGTAAACATTGACCTTAGCTCATGAGGC
15_E_15 108531660 108562095 30436 AAATGCTTTCTTTCCCCCCTGCAAAGAGACTCAGGGAGACAGCCTGGTGTTGTGCTCATGAAAGATTGTTATGCTCTCTGTACCACCACCCCTTAGAATCAGTTCCCAGAGAAGGTAGGCAGGGTATAGAGAGCAGCTTTCTCCCAGGGTAGAGATGGGTCATGACAGCCATCCCAGCTGTCACCATCCACACAGCTGTCTAGCAGCCATTCCTTTTGACAACTCAGAGGTGAGAGGCTGAGGATCAGAGTAAGCAGGTGACCCTCTGGGAGCCAGCCTGGCTTAGTAACTTCTATTCCATTCCAAAGGGCCAGTGAGCCTTCTAGTGGCCCTGCAAGTGTGTGTGTGTTCTCAGTTGCCAGTCACTACAGAGTTTGCTGGCGGTTTCTCCTGCAGTTGTCATGCAGGCTGCTGTAGCACCTTGTGCAGGACGTGACTCCACAGGGAAGTTCCCTCCCTGTCTGCATGGCCGTAGTACAAGCTATTTGGAAACAGACACATTCTAAGAAGGATGAGGTATTAGAGCTCTCAGCTCTGTTAGCTTAGATGCTGATGGAGCCTGGGCAGGAGAGATGTACTTTGAAGAGTTTTATTTGGAAGACCTTTCACATACAGGGGAGAGCAGCAGGGTTTAGGGAAACAGAAAGGTATAGCTGGAGAGATGTGATGTAGAGGCAGGGATGCTTCTACAAGGAACAGGGAGAGGGGAACTGGTAGATTCAGGAGTGACCCAGTCATATCCTCCCAGGCCTCCTTGCGTTTCTGGCAGTCACATGCTGCTACCCACTGCTGGGAACACTGGGGAACAGACCAACCCGAAAGTGACCAAAGAGGAGGAAGCTGCTCACTCTGATGCCCCTCCTTAGCCCTTGGCAGATGTGGACAGAGATAGCTGGTGGGGCCAGGCCACCAGGACTCAGCCGCCATTCTAACTGCTGGGTGCTGAGGATCCTGTGTGTTGGTATGTGACCTACTCTTTTTCTGTCTGTGAAAGCAGATCCTACTCTACAGAAGAGGAGACCCAGGCCTGGAGAGGCTAGGCATTTATTTAGTCCAGGGCACACAGAAGTGAAGATACCAAGGTGGGGCTCAAACCTATGTCCTGGCTGACAAAGCCCTTTAGGAGACTTTTATCACCAGAATAGGACAATAGGAAAACTATGGGGATGGGGAAGAGCTGGGTAGTTACCTGAAGCAGCCCCTAGAGACTGACATCATAGATGAATAAAGGTGTGTGGGGGTGTGTGTAAAGAGAGCTTGGGGGAATGAGGTCACCATTTCTGAATGTGGACAGAAAAAAGAGGAGAGGTCCTTGTCCCAGAGACTACAATCTGGGCTTTAGGAACCAGTTTCTGGGATTCTGGCTTATGACTTCAGCGCTAGCCTTGGTGCCTGTTTCAATCCCATCCTGTCTGCTAGCATATGCCCTGTATCCTCCATGGTACATGTCAAGACTTACCTCCCTCTTGCTCCATTCCGGTCTTTTCTCTGTGTCAGCATGGAGGTTCCATGGGTGTGTTGCTAGAAGCAGAAGCACTAAGACTGGGCGACCAGCACATACATATGGGCCCAAGAGGTGCTGGCCTGAGAATGGTGAGGGCTGTGTGAGGCAGGCTGGTGTCTGGGTCGGGACGATGCTTGCCTAGTGAGCAGGGCCTCAGTGGGTCAGAACCCTGGCTGGTGCCTACTGACACCCGGCTCTGGTTCTGTTCTCAGCCTTCTTGCTAAGGAGGAGTTACTGCTGCCATCAGTGTCACCCCGGTCCCAACCAGAGCCTGCAGAGACTCCGTCCACCCTCCTGCCTGCCTTTCCCCAGGGGCCCCTGCAGCCTCCGTCTCCTCCTCCCTGTCCTCCTGTGATCCCTCCCAAGCCTCCTCGCCTGCTCCCTGAGTTTGGTGAGTGCTACTGGGGAACTGGGCTCTGGGTGGTCTCCTGAGATCAGCCATGGAGAGCAGGTCATGGGGCTTATTCCCTCTCTCCTGGTGGCCAGCAGTCCCCTGGGTGTCGTAAGCCTTCTCAAAGAGCACGTCCTTTCTCTCTCCTCTGTCTCCTGCTTGCCAAGTGTGAGCGTGGCCAATCTTTGAGGTATCGAAGTTCTTGGGCTGAGTAACCCTTGGGGCCACCGCTCCATCTTGATTCTCATTAACCTTGTGTGTCTCGTTTGGACAGTCCCCACCCCGACTCCCAGGCTGCTGCTTGGTCAGCCTTGGCCCTTCCTTTCCTTCAGTATAAATAGTACTTCCTGTCTCCTGTGCCTTTCTTTTCAAACTCAAGCCTGGGTGTGTGTGTGCGCGTGTGCGGTGGGGAGTTTATTCTAGCCTGGGAGTGGCCTTTGTGAAGCCAAGCCCTAGCCCCTTAGAGGAGGTCAAGCTCCTAGCTTCTGAGCCATTCCCTCTCTTTTACCAGACGACTCTGACTATGATGATGTCCCGGAGGAGGGGCCAGGGGCCCCAGCCAGTGTGATGACCAAGGTAGGCAGGGCAAATGCTTGCGGTTGCATTGGCTGCCTGTGTTGTGGAGGGAGGGCTGCTCATTGGCCTTAGAGACCCCAGGATCTCCTCCCCTAGCAGAGTGGATGCTAAGCCTGCTTTACTGTCTGCCCTTATAGGAGTCACCCTGGGGTCTGCAGCTCTCTGGTCTATGGCTTCTATTCCAGGCTTGAGTGTATGTAGTCTGTTGCTGTGTGAGTCTTGGAGTGGCTTCACTTTCTCTGTCCCCAGGTCACCTTCTCTCTTGAATGTGTCACTCTAGCTCTGAGTCTTTCTCTGCTTTCCTGCCTTTCTATCTTTCTCCTTGCCCTAGATCCATGTTTGCCAACAGTTCTCCTGACCCTGTCACCCTGGTCCCTGTGTGGTCTCAGCTGCTGGGGGAGGGGTGCACAAACAGAAGTAAAAGTGCTGAGTTGTGGGTGTGGAGTAGAGGGGTGGGTGTGGCGGCTGGGGGTGTGGTCTGGGATTTGAGGGAGAAATGTGACACTGGGTGATCCTTGGGGGGGGGGGGCAGGAGGAGCCCCTGCCGAGCCGAGTCCCACGGGCTGTGCGTGTGGCTAGTCTGCTGAGCGAGGGGGAGGAGCTGTCTGGGGATGATTCGGAAGATGACGATGACCATGCCTATGAGGGTATCCCCAAGTGAGTATTACCCCACTCAGTTGCCTAAAGCCCAACCTAGCCCACCACTCTACCCCAGTCCCAGCCTGAGCAAACCCTCAGCCTCCCTCCCTGCCTTCCTTCCCTTCTCTTGTTCTAGTGGTGGGTGGCCAACGAGTGGCCTGAATCCACCCTTACGCAGCCTGATCCCTGATCTCCCACTGCACCCCATGGATGAGTTGCCTGGGGGTCCCACCCCCATCACACCTGTCATCAAGGCTGGCTGGCTGGACAAGAACCCACCACAGGGGTGAGTGAAGCCTGCCAGGTCCTTCTAATGTCTGCAGGGGGACAAGCCATACTCCAGGATACTGGTGTCATGGATCCAAAAATCAGAGGGTCCAAGACTGTTTGATCAATTTTCCCTCCCCACACACTGTAACCATTGGTAACCACTGGATGATCTTAACTGTGATAGGAAAGGGGGACTGGGTATGATGGTGGGACCTCTCCCACCTCGTTCCCAGTCTTTGCTGAGCCCTGCCTCTGCCTGTTTAGGTCTTATATCTATCAGAAGCGATGGGTGAGACTGGACGCTGATTACCTGCGATACTTTGACAGTAACAAGGTGAGGGCTCCATCAGTCCCTCACTTGACCCTTGCTCCTACCCAGGCCTAGGCTGAACCCCAACATTGCTTTAGGCAGAGTCCTTAGCTGATCTTCAGTGGGGATCCTGGTCTGTGGGCTGGTGAGGGTAGTGATCAGAGCCAGCACAAAGTCGACCTGCAGAAGACAGGCCTGCAGTCATCATTTCAGCCAACTGGCAAGAGGCTCTAGGGTACCCACTCTAAAATGCAGCTCTTCTCTCCCCAGGACGCCTACTCTAAGCGCTTTGTTCCTGTGGCCTGCATCTGCCGAGTAGCTCCTATTGGAGACCAGAAGTTTGAAGTGATCACAAATAATCGGACCTTCGCCTTCCGGGCAGAGAGTGATGGTGGGAGTTCAGGAGTGTATATGTTTGTGTGTGTAAGTGTGTGTATGAGTGTGTAAGTGTGAGTGTATGAATGAGTATATGAGTGTGAGTGTATGTGTGTGTAAGTGTGAGTGTGAGTATGAATTGTGTAAGTGTGTGAGTGTATGTGAGTGTGTGTGTAAATGTATGTATGTGTAAGTGTGTATATGAGTGTATACATATGAGTGTATGAGTGTGTGAGTATATGAGTGTGAGTGTATGAGTATGTAAATGTATGTGTGTGAGTGTATGAGTGTGTGTAAGTGTATGTGTGTGAAAGTATATGTGAGTATGTAAGTATGTATAAGTGTGTGTGAGTGAGTGTGTGTGTGTGTATGTGTGTGTGTGTAGGGGAGAAGGACCTGTAAGTTGGAAGAGTAGGAAGGGAACAGTGTCCCAGGGAGGCATCGTCCCTGTATGGGGTCTGGGAGGAGAAGGAAGGAGATACTGACCATTGAGCATAGCCAGTGCTCCTTTCCAGATACTCCACAGTGCCACAGAGGCACACATCAGTGTGCACAAGGGATACAGTTTCCAACAGTTGGGGTGACTTGCCCAGTGTAGGCCACAGTAGGTGGCATTGTAAGCATTGTGGCATTGTAGCCTAGGTTGTCCAAGACAGAGAAGTCTAGCGATGGGACAGACCACACCAGTAGGATTCCTAGCAGAGGTGACCTCTGAGCCCCCTAGAGCCAGGAGGCGCCAGGGGCTGAGTTCATGTGTTACCTTCACCCTTTTGCAGTGGAGCGGAACGAGTGGATGCAGGCCCTGCAGCAGGCAGTAGTTGAGCATCGAGCCCGTTTTCGGCTTTCTAGTGCTTCTGTGTTGGGAGTCCGAGGCTCCGAGCAGCCTGACCGTGCTGGCAGCCTGGAGCTACGAGGCTTCAAGAATAAGCTTTACGTGGCTGTGACTGGGGACAAAGTACAGCTCTATAAGAATCTGGAGGTATGAAGGGCTCTACCAGGCCACTGAGGTCTCCCTGTCCCGTACTCATCCGTCCTCTTACCTGCCCTGCTCCTGTCCACCTGGTCTCTCCCTGGTCCTGCTTAGGATCTAAGTCCAGTACTTTCCCTTCCAGCCTTTTCTGCACTGGGACAGCATCTCCCCTCTTCTCTCCTGCCTGCCTGTGCCTCATCTCCATCCTGTCCCTGAACAGCACCCCCCCCCCACGTCCTGTTTCACTCACTCCTATGCCTCCCCTACTGTCATCCCCGTTGCTCTAGTCCAGACTGCTGTCCTGGCTCAGATTCCCGCCCTTCCTCCTTCTTAGGCTCTTTCCACTCCCTAGGGACGACTTCCCTATCCCTTGTCCTGCACCTGAAGCCCTGTTGTCAGCCTTTGCCTTCCTCCCTTCCCACCCACCCATCAGGAATTCCATCTGGGCATTGGTATCACCTTTATCGACATGAATGTGGGCAATGTCAAGGAAGTGGATCGGCGCAGCTTTGACCTCACTACCCCCTACCGCATCTTCAGGTGAGCCCCTGCTCCACCTTCAGCTCATGGGCAGTCAATCCTCTTGGTATTTTTTTCTCCCTTCCATTGCTCACCCACCTGCCTTAGTCTGCCAGACGTCTTCATCCCTCTCCATCTGTTCTGGCCAGCTCTGTTCTCTTTGCCCACCACGCTGTTTATGAGGTGTCCCACCAGCACCTGCAACCCTCCATGGCCTGGGACCCAGGGAACGTCTGCAGTGCCACCCTGCCATCCCCGACTCCGAGCTGTGGGTTCTCCAGCAGAACTTGCTTGTGCTCAAAGCACGTGGGCCTGTTGTCCCTTGAACATCTCCCCATGGCCCTTCTCTGCCTCATGTGGCTTGACACAGTTTACCTCCTTTGCACTCTGCCTTGTCTGTTTCTTCTCTGTGTCTGTCGCCATTCAGGCCCTCTGGTCTCCGTCTCAGTACTCTGGTTGCCAGTCTCAGGGCCTTCACTCTATCCATACTTATATCAGGGTAGTGACCTTTGATCTCAAGAGCTAAGTGGGTGTTTGTCCATCCTCCCATTCGAAATATCCTATGACTTTGGCCCTATAGTTCTTTGCCATAGTCCTTAGTGACCACAAATGCTGCAGCCAGACACTTTAGGGTTTCCCTTTCTGTCAGCTGCAGAAGCCACTGTGCTTCCTGATTACTGTCATTGTCACCAACTTGAAGGAGGCTGATAGAGGTTCAGCAGAAAGGGCTTCCACCGCTTGGGACCACGGGTTTACTGCAGCGGGGTGAGCGTGCTTGTTGCTTATCTGAGGCCCTGGCAGCTTTCGAGTTCCTCTCCTGGCTGTCCTGGTGGAGGCCATCTTCAGCCCCTCTCTTACTCATGGCCGTTACCTCTTGGTCACTCCCATGTGACTTGCAGTTGGTGGTGACAGCAGCAGACAAAGAGCCAGGGGAGTTTTGTAGGAAGGAAGACAATTCTGCATTTGCTGTCTAGATGGAGCTTCCCACTTGAAGAGTCTTTCTGCCTCTGCTGCTGAGTGCTGTTAAAGGCATGTGCTGCTACACTGGGTGCTCACTAATGGACTTCTTTCCGGGATGGAGTAAGGAGGTTGAGGGTGGAGATGGCACACACCTTTATACTCTCTCTCTTCCGTCTGTATATACCCTTGACTGGTGCCCCACTGTCCTAAGGGTGCCCTGTGCCTGCTCTGCCTCTCAGGCCTGTCCCTGCCTGTCTCTCATCATCTCCTCTGCCAGTCTGTTTTCTCTCTAGTTTTCTTGCTCCCTTTGTTGGTTGTTTCCCAACAGTCTTAGGATGACACCTCCTCCCGACCCTCAAATCCCTCCAAACCCTTTCCCACCGGTTCTACTTATGTGTCCCTAGCTTCTCGGCTGATTCAGAGTTAGAGAAGGAACAGTGGCTGGAGGCCATGCAGGGAGCCATCGCAGAGGCCCTATCTACCTCAGAGGTGGCTGAGCGCATCTGGGCCGCAGCCCCCAACAGGTTCTGTGCCGACTGTGGGGCCGCCCAGCCTGACTGGGCCTCCATCAACCTCTGCGTTGTCATCTGCAAGCGCTGTGCAGGTGGGTATGTGTGCAGCAGGTTGGCCGTTGGGCAGCAGGCAGTCTGCTGGGCAGATCCTACAGCCCTTATATCTAACGGTGTGTCAGCATTATTGGCTGTTCTCTTGGGAGAACCTTAGGTCCTCAATTCATGGTTATACTCTCTCCACAGGGATGGGGACACACAAAGAGGGAAAATGCATTTTATTCAGGGCTATCTGGCAAGTAAGTGAGCTCAGATCAGAGCCCAGGCTGTTGGAATCTGATGTCCCTGTCACATCAGAACCATGCAGGAGGCCAGGCCCACCAGGGCTCTTCATGCTGAGAGAAGAGCCAGTGTTTTGTCCAGAGGGGATATAAGACAAGGGACCCAGGGACATACTCAGCGCTGTGGGCCAGACTCTGGCTTATGGGCAGAAGCTGGGATTGGAGACTCCCATCCAGGAATGGGAGTGGAAGCACTGAACCTTCCAGATGGTCTGAAAGTCACACATATGAAAGCCTCCATGGTAACATGGCTGAGGAGCATGGGAATGGAAAACCATGGGGCCCAAGGTGCAGTCATCTATTGACTCAAGCCCTAAGGGCCCAGCATGTGCCATCTGCTGACTGCAGGCTGGGCATTCGATTATCTGAGAGCTGACAGTGCGCAGGTGGTGGTTTGCACGGCCGCAGGGGAGAGGTGGGATTTGATGTGGGAATCCAGGGGAAAGGACAGATCTGAGTGAGTCACTGAGCTTGGAGAATAACCCCTGGGCCTGTGGGACTCTAAGGCAGATGTCAGGCTCTGGGGCCATGAGGTGTGTGCAGACAAGTGGCAGCTTCACCGGCGACCAGATAAGGAAAGTGTCAACTCTCAGAGCTAACACAGGACGACTGTGGCTCTCTGTGGAAGATGGGTGCATGAATGCAGGGCCAGGGCTTCAGTCAGGCAGTGGCGGGTGTTCCTTGTGTCTCTAGCTCCCTTCTCTAGTCATGGGGTCCCTGCTGGGACCTGTGGCTGAGCAAGCTTCATCCTCTGTCTCCAACCTTAGCCTTTCCTTTCCTTCCAGTGACCTTTATTAAATGCTTGTTCTGGGCTCTGAGGATGAAACCTAAAGCCAGGTGGTCAGGATCCTGTTCTTATGCAGTTGCATTGCAACGGGAACAGCAAAAATAACACAGGAGCCTATCAAAATGGAATGATGAGAGGTGGGAAGAGAAAGTGCTGTTTGTTTGGGACATTTTCTCTGAGGAGGTGACATGTCAGCTGAGACCTGAATGACAGGAAGGCATGGCCATGGAGGTAGGGAGGTTGGGAAGAGAGTTGAGGCAGGAAGTTGAAGATGACAGGGGAGAGATAAGGTATTTATATCTACACTGGAACAGCTGATGTGGCTGGAGCAGGGATTGGCACATCAAAGCGGTCTCTTGGTAGGGAAGATGGTCTGGAGGGTCTGTTGTGGCTGGAGCGTAGTGAGCAATGTGAACAGGTTCTGGACCATGCCAAAGTGGAGATGCAGGCTAGCTCCAGGCCTGCCTGAGGAGCAGGAGGGATGAGCCAGTGCTCACAAGGAGGGCTGTACCAGAGTAACTGTATCCGCCTCACCTCAGGGGAGCACCGCGGCCTGGGTGCAGGAGTGTCCAAGGTGCGGAGTTTGAAGATGGACAGGAAGGTGTGGACAGAAGCACTCATCCAGGTGGGGGTGACCTGTGGTTTGTCCATGCCTGGGGTGGGGGTACCCTGCGGTTTGTCCATGCCTGGGGTGGGGGTACCCTGCAGATCATCCATGCCTGGGGTGGGCATGCCCTGAGGTTTGTCCATGCCTGGGGTGAGAGGGCCCTTCGTTCGGATCGTCCATGTCTGAGGTTGCCTCTCTCAGCTGCTCCCCTCCACCCCCACCTCACTGGCCTCAGAACTTTGGAGCTGAGGGAGCTCTGTGATAATCTAGTGGGTGGGGATTTTGGAAAAGCCTGCTTTTAGCAATGTCAGCAAACTGGCTGGTGTACTGAGAATGTTTTTACAGTTTTAAAGGGTTGTTTAAAAAAAGAGGTTTGACAGATTGTATGTGTTCCATAAAACCTAAACTATTTATTATTTGACCTTTTAGAGAATTGCTGACCCCTGATATAGTTCAGCTGTTGTCCTGATGTGGAGACTGGAGCCCTGGGTTGGGCTGTAATGGGCCTGAGGTTACCTAGCCTCTGCATATTAACCACTCAGCCTGCTCCTTCCCACCCCATATCCTAGCTGGGCTGGGAGTTCGCCACTGTGCACACCACTCAGAGCCTCTGAGCTCTCACTGCACCCGAATTCATGTGCACAGGGTATATAATGCATGGCTTGAGGCACACATATGTACATCTGTTTATACCTATGCTTTAAACTTCTCTGGTACCCGTGTGTGATTGTTGTTATGGGAAACCTGCAGCAGGAGGCCGGACCAAGGGACCTGGCACTCAGAGCTTAGCTGCTAAGTTGGGAACTTCATAGCATATCCAGTTCATGTGCCCACACTGTGTTCAGTATAGCACTGCTGGGAACACTGCTTTTGTTAATGAATTGTCTTTTAGAATAATCCTGAGATAGGATTAGAATACCCAGGATACAGTTGAGAACATTGAGGCTGAGGCCCAGGGAGGAAAACAAAACAAAGCAAAACAAAGCCAACTCTGATCGGGTGCCTAGTGGCAAGGAAAGTTTCTGCTTTGTCCTCTGCTGAGACTCCAGCACTCTAAATGATTGGGTGGGAAGCCCAGGAAGTGCCTGTGACAGCCTGATCAGCAGAAGGGAAAAGTGAGCTTGCCCTTAATGCTGCCCATCCCCCATCTTCTAGAAACTGCCACCCCTCTCTCATCCAGAGAGGAATGTTAGGAACAGATAGACCCCAAATCTCTGCCTGCCTAGCCTATTGGCTGAAAGGTTAGACACCACTCCTCGCTGGGACAGTTTCAGGAATGCAGAGTTCCAGATGTGGGCCTGGGTGAGACAACAGAGAGGGCCCCAGAGACCAGGCCTCAAACGTTCACCTATCAGACTGTCGGAGACAATCTGGGCTCAGAGCCCAGGCCTTGAACAAGAGTACGGTGGCCATCAGCAGACCCAGCTGCTCCTGACCTCCCCTTGGGGAAAATGGGTGTGTGGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTCAGGAGTTGCTGCCCCTCTCACCTCTTGCCCGTACCCACAGCTCTTCTTACATCTGGGCAATGGCCCCGGGAACCACTTCTGGGCTGCTAATGTGCCTCCTAGTGAGGCCCTGGAGCCCAGCAGCAGCCCTGGTGCCCGGCGGTATCACCTGGAGGCCAAGTACAGAGAGGGCAAGTACCGCCGCTACCATCCGCTCTTTGGCAACCAAGAGGAACTGGACAAGGTCAGCACACAGAGCCTCTGGGATTCTTGAGCCTTCTTGTCCCTGCATTATCCCTTGAACCCATCTCTTTCTTCCTGTGGCCCCATTCCTCCCTCTCAACCCATGTCTTCCATCCGCTTAGAGGGCTGTGCATGTGTGGGGAGATTGAGGCCCACAGGGCAGTAGGGCCTGCCTAAGGAAAGCTGGAACAATGTAGGGAGGAGTCAGGCTTGGTTCTTGGTCCAGTGCCATGTCTTCAGCATCTGGCTGCCTCCTCCTGATTCCTCTGTCTCCCGCACCCTGTCCTGTTCTTTCAGAATCCTGCCAAAGGAGTGAACTTGGTGGGGATGCTATTTCCTGTCAGGCTCATGAAAAACAGCTGGACCACTCTGACCCACCCCATCCACGCCCCATTCTAGATGAGGCCCCATATGGGCCCCAGGCCCCAGAAGATTGGGAGCCAAGTCTTAGACCCTGATCTGGCTCAGACCGCTTGCTTAGAGGCAGCAGGGTAACATTTGTAACCTGTGGGCGGCAGTCCTCAGCTCTTCCTCCAAGCTGTCCTATCCAGGCAGGCTGAGTCTAGCCCCAGAGTTGTCTAGAAACCAGGCCTCCACCTCCCCAGGACCCAGGCGTCCAGCCCCCAGTTCAGCCCAGCCCAGTCTGGCCTAAAAGCCAGAAGGGTGGTGGCTCCCATTGGTCGGGAGGGCTGGGCCGGCAGTGAGGAATTCAAATGTGGGAGGAATTAGCTACAACCCCTCAGCTCCTCCCTCTGCCCCTGCTACAAGGCAGAGGGAGCCTGAGATCCTCCAGGGGCTCCTTGTGCCCTGACCAGCAGCTGTGCCTCAGGACCCACAGGGTGAGGGCCTGTGGCTAGGACCCCAGCCTCAGCTGGGTAGCCTCTGCCCAGCCTCCCTGGCTTGCCCTCCCCTCTTCTTTTTCTGACTCTCATGCCTTTCTTTTCTTCTCTTCTGGCTTCTTTAAGCCCTGCTCTCTTTCAGTCTGAGGATGGTCCATGCAGGTTTGAGTGACTCCTTCCCCTTCCCTCCTCCACCTCCTCCTCCCATCCCTACCCCTCCACCTCCCACTCTTTCTTGGATTGATCTCCCCCACCCCCTCCTCTAGGCCCTGTGTGCTGCAGTTACTACCACTGACCTGGCTGAGACCCAGGCACTCCTGGGCTGTGGGGCTGGGGTCAGCTGCTTCTCAGGGGACCCAGCAGCTCCCACACCCCTGGCTCTTGCTGAGCAGGCCGGACAGACTCTGCAGATGGAGTTTCTACGGAATAATCAGAGTACAGGTGAGTGACCGGTGGCTCTGTCCTCTGTAGCTGGAGGTCCCTGCTGGCAGGGTCTGGTCTTTTGGAGAGTTTTATAGGGGTGTCAACAGGAACCATGAATCAGCTGAGAACCTGGATTTGTAGGCCACTCCCAAGCTGTGATTCAAGTTCTTGGTGGTCCCTGGGGCAGTAAGCAGCATGATACTTGGGACAAGTGTGGCTTATGGGTCAGTGCTTCGTGTGAGTGGCCTTTTTTGTCTGTATCTCTGTGACTGTTGTGTGCTCTGTCCTGACTTAAATGTGGGTTCCTAGTGGAGCTATCTGCTCTAGGAAGAACCTTGGAGCTGCCTAGGTTCTCTTTCCTCATGTTGGTGATGCTGAGGCTTTGGGGTTTGTGTATGTGTAGTGGGTCTGTGTTGCTGTGGAGGAGGGTGTTGCCATGTGTGTGTGTGAACTACACAGCAGCCTTGTCGTCTGTTTGCTCAGTCTGGGTGGAGTTCCATCATAGACCTGGGTTGGATCCCATTTGGCTCCTATTCTTGGGATGGGTGAGGAGGGGGTCGCTAGGGTGAATGCGTCGGTTATGGCCCAGGCCAGGTCTCTTGAGGCCACATCCTAAGGCAGAGGGTGGGGCTCAGCGGCTGGGGCTCTGGGCCTTGGGCCATGGGTGGGTGGGGTGTGCTGGGCTGGAGAGAACCCAGGTGTCTAAGGGAGGTGCAAGAGACCACCCAGCTGGCTTGGACTACGGGGGCAGGACCCCTCAGTGCTGAGCACTGAATCCAGCCTACTTCACTGGGCTTTGTGCTATCTGGGACAAACCTCTCTCTAGGGACTACTATTGAGTTGGCCCAGAGCCCCCCTCATTCTAACATGCTTGGCTCTATGCCTCCAACAAGCAGTGTGGGGTGGGCTTGGGAGTCATGGAGCCTTCTTAAGATGGGTAGGGCTGGAGCTGGGCCCTGAGAATGGAGTGACATTTCCACTGGTGAGCAGAGGTTGAGATGTGGCTTTTCAAAACCCTGAAGGTAGCAGTAGGAGCCTGACGGTGCTGGTAGGGAGCTGAGGAAACAGGGCTGTGACCATGAACCTAGGTACTTTGCCCCAGGGGGCATCTGGAGAGGGCACCACCTGGACACCCAGTGTGCCACTACCATTCTTTCTTCCACTCCAAAGAGGTCCCTCGGTTGGACTCAGTGAAGCCCTTGGAAAAGCACTACTCCGTTACCCTGCCAACTGTGAGCCACAGCGGCTTCCTGTACAAAACTGCTTCTGCCGGCAAACCTCTGCAGGACCGCCGTGCCCGGGAAGGTGAGTACAGCATCTTACCCATCCAGGCCTATGGTGTGTGTTAGCCTGGCTGCAGGGCCAGCAAACTAGGGCTGGTCCTGCTGGAGGACCTGAGGGTGCCAAGTGGACTCTAGCAGAGCCACTTGGAAAGTCTTGGATACGGTCTCTTGAATACAATGAGTGCTTGAGAAATAGGCTAATCGGGGTGGGACATGGAGATGGCACCACCGGGGAGCGTGAAGTCCATATGGAGCCCCCGTTGGGTGTGGCCTTGTGCTGAGCAGCTGGCATATTCCAGATGTGGATGGAAGGCGGTTTGAGGACTTGAACTTGAGTGCCATCCCTCTCAGATCTCAGTTGCCTTCCATTTACTCCCTGCCTCCAAGTTCAGCCTATAGTCCTTGCACATCACCCAAGAGCTACCTACCTTCCTATCCGGCAGACTCCCCTCCCTGGATTCTGCCCCAGCTCTGTGGCTTTGTCACACAAGCCAGATTTACCTACCCCCACCAGGAATCTGCATATGCTACTGTCTGCCCCAAAGGCTTTCCCCAAATATCCCTTAAAACCTCATGTCTTTGGGGATATCATGTCTTTCCCAGCCACTCAATACTGTGCCCCCTGTCACCCCCAATACTATTTTTTCTCTTACTGTTCCATCTGATTTTTATTCTTATTTTTTTCCTCCAAGATAAAGTCTTTTTGCTACCCAGAGCCTGACATTGAACTCCTGGGATCAAGTTTCCATCTTGTCTCAGCCTTTCCAAGTAGCTGAAATTATTATAGTAGATAGTGCCACTATAGCCAGCTCAGTTGTCCTTTATTGTATACCTCTGTATACATGGTACCTGGTACCTATTGTAGCCCTAGCACCTGGGGCGCACTGGTACCCACTGGTAACGTAGCATACATCTGCAGAATGAAGAAGACCTCAGCAGGCTAGTGTGCTTCTCAGAGCACATCCTTGAGGACAGCCTTGGAGTCACATGGTTCTCACGGACAGGATGAGGGACAGCAAGCTGGAGGAGCAGAATGCCCACTGCTTACAGCCTCTCTCGGAACCCCTTCTTGGAGTCCCCCAGATACTCTCTCTGACAGTACTCTCTAACTCCTAGATGGTGTAGCCCTCTGCTGCTCCTGGTCAGTTCCCTCTGCCTGATGATGTCATTTATGGAACCCCTCTGAGTCATCCTTTTCACCCTGAGTGCCAGGAAGCTCTGAGCCACTGTGAGGCTGGTGCCGTAAGCTACAGTCGCCTGCCTGCCTGGCTTTGGTGCTCTGCTCTCTTACCTTTCATGGTCCAGGTTCCCATTTCTGGTTCTACTGGGGATCTCGTGTATCTTCAGAGCCATTGTAGGAGGAGGCAGACTATAGAGTGAGGAGTGTATCTGGCAAAGGAGACGGGGCACAGGGTGGGTCTTAGGGTTTTACTGCCGGGAAGAGACACCATGACTAAGGCAACTCTTATAAGGACAACATTTAATTGGGGCTGGCTTATAGGTTCAGAGGTTCAGTCCATTATCATCAAGGTGGGAACATGGCAGCCTGCAGTCAGGCATGGTGCAGGAGGAGCTGAGCGCTCTACATCTGCATCTGAAGGCTGCTAGCAGAAGCAGCTAGGATGAAGGTCTTAAAGCCCACACCCACAGTGACACACCCACTCCAACAAGGCCACACCTCCTAATAGTGCCACTCCCTGGGCCAAGCATATTCAAACCACCACAGCTCCCAAGGCTTCCTGTACAATTGAAGCTGTAGGTAGAAGGAGCAGCAGGGAAAGAAGCTAAGAGTAGCCAAAGAGACAGACAGAGGCAGACCTAGGCTGAGAGACACAGGTTGCCCTGATGATTGACAGCTTGGGACCTAACATTTAAAGAGAAGTGGGGTCAAGACTCAGTCGTTCCTGGTCTCCAAGCTGGAGACCAAAAGTTCATATCGGCTATAGGGGAGAGTTGGGGACTAGGTATAGAGGGCTGCAGCTGGGGGAATACTCAGGTAAGTGGTGAGTTAAAATGAAGAGCTTATAGGTTGGGTAGGAGCAGAGACCCAGGGAAATGGCAGGAGTGCTTTTCAGCCAGCCTGGGGTTTTCTTCATGGTTCCTCTGTCTAACTTCTCCACAGAGTTCAGCCGGCGCTGGTGTGTCCTGAGTGATGGGGTCCTGAGCTACTATGAAAACGAACGGGCAGTGACACCCAATGGGGAGATTCGGGCCAGCGAGATAGTATGCCTAGCAGTTTCCCCTCTGGACACCCATGGGTGAGTACCCCTAGGCATAACCACAAACTACCAGTGCTAGGAAGTCCAGTGTCTGATTGAGAAGACAGGGACATAGGCCCAGAGAAGGACAGGACCTTCTCAGGTCCACACAACAAAGAGACTGTAAACATTGACCTTAGCTCATGAGGCTGCAGCCCAAAGCTGCTCGTCCACCTCTTGGGAATCAGGGCAAGGAATAGAGAATTAATGGGGGAGGAGGGCAGGCTGTGCTGGATGAGTGAATCCTGATTTGTATATTTGTAGCTTTGAGCACACCTTTGAGGTGTACACAGAGGGAGAACGGCTGTACCTGTTTGGGCTGGAGAATGCAGAGCTGGCTCATGAGTGGGTCAAGTGCATTGCCAAGGTAGGCCTGGGTTAGGAGGGCAGGCGTGTGATGGAGGCAGGGCGGGCCCTCTGGCTGAACCCCATGAACTCCAGTTCTTCCATCTCTGATGGAGAAGGAGCCAGGCGTGGGTATAACAGACTCAGGACAGACCTCTCAGATCAACGGCAATGCAGATGTAGCCCTCTGGTACCTAATGGATATTTGTTATGAGGAACATGTTTGGGAGGGTCATTGTTTGCAGGTGTGCAATTAGGCTAGATGGGAAGGCAGGGAGGCTACAGAAGAGAGGGCTGCCTTAGAGACAAGAGTCAAGAGCCAGCCCTCTTGTGCTTTGAGAGCCTGGGGCTTCATTCCTCATTGGCTCATTTGATGAGCTCTCAATACCTTCTGAGGATCAGTGCCCAGGGCCCGGAGGACCCGAGTGTACCAGTGCTCTGTTGTTCCAGTGGGAGTGCGGCAGACAGGCTGAGTCTAGACACTATGGTAGCAGATGGTGAAGTATATGGACACTGGGAACACAGAGAAGGACACATCCAAATGGGTACAGAGGACATGGTCCCAAAGTCCTCTGTCACTGTGCTATGCTCTGCCTTGGGAAGGAGGAAGTAGTTAGAGGGAAAAGAGCCCTTGCCCACAGGGTGTCTCCAGCAGGCTGTGCTGTGCTTACATGCTCTCTCCACTATTTCCCCCCCGACTAGGCGTTCGTGCCTCCCCTGGCTGAGGACCTGCTAGCCCGGGACTTTGAACGTCTTGGGCGCCTACCCTGTAAAGCTGGCCTGAGCCTTCAGCAGGCTCAGGAAGGCTGGTTTGCCTTGACTGGCTCTGAGCTCCGGGCTGTCTTCCCAGAGGGGCCCTGGGAAGAGCCGCTGCAGCTCCGGAAACTGCAAGAGCTTTGTATGTGGACCTTTGCTTAGTTCCCCAATCTCTAGGATCCCTTGTCCCAGCCCTGCCCCACCCCCACCCCCCACCCCCACCCCCTACCCCCCAATCCCCTAGTCCTTGTCTGGAAGTCTGAGTTCTATTATGGCCTGAGCAGATGATCCAGCCTCCCCTCCATATCCTCTCCTGTCCTTGAAGTACATCTCAGCAGCCCTTTAGGTTGGTGGGTGGAATCTAAGGGTGAGACCCAGACAGCCTCAGGAGGGAGCAGTGTATGGGTCATGAATAAGGCCTGGGCCTCACCTTGGCTGGCCCCTCCATAGCTATCCAAGGAGACAGCGAGAACCAAGTGCTGGTGCTGGTGGAGCGGAGGAGGTGAGCCTTGGCTTCCCTGAGGATCCTGGAGAAGCCTGAGGGCAGGTGGGATACAGGGGCAGGCAGGTGGGACAGTGACTATCTCTGCTCCAGGACACTGTACATCCAGGGTGAGCGGCGGCTGGACTTCATGGCTTGGCTAGGGGTCATCCAGAAAGCAGCAGCCAGCTTGGGAGACACACTATCAGAACAACAGCTTGGGGACTCGGACATCCCAGTGATTGTGTACCGCTGTGTGGACTACATCACGCAGTGTGGTGAGCCCAGCCTCCAAGTCCCAGCCACCCCTCTTCTCTAGTGATACCCAGACCCCAGTGCCCAGGATCCCTCTAAAGAGTGGTTTAACTCCCTCCCCAGGCTTGACCTCAGAGGGTATCTATCGAAAGTGTGGTCAGACCTCCAAGACTCAGAGACTGCTAGACAGCCTCCGGCAGGACGCACGCTCTGTGCACCTAAAGGAGGGAGAACAGCACGTGGACGACGTCTCCTCTGCACTCAAACGCTTCCTCAGGGACCTGCCCGATGGGCTCTTCACGCGTGCGCAGCGCCTGGCCTGGCTGGAGGCCTCTGGTGGGTCCTGCTGCCTGCATCCAGCCCCATCCACCCTACCTACCTCAGGATGTCCCCATCGTACCCTGGGCAAGGCTTGCCCCAGCTCCTCCACCTATTCTGCTTCTAGGTCCTCTAGTCACTATAGAGAGGGAGATGCTCAGAGGTGGAGAGTAGAGCACTCCCTGTCCTGATAGGTGTCTGTGAATGATGCCTCCATCCTGAGAGGCAAAGCTGTTGGGAGGGGGCATTGGTGGCCAGTTTCTAACCCAGTCCATCTCTCCCCCACACACACCCAGAGATCGAGGATGAGGAAGAAAAGATCTCCAGGTATCGAGAGCTCTTGGTGCATCTGCCCCCTGTCAACCGGGCCACTGTGAAGGCCCTTATCAGCCATCTGTACTGGTGAGGGCCGTGCCAGAGTGAGGCTCTGGGGAGATGGGGGTCGGGGGAGGTTCTTCTACTCCCAACCTGGCTCACTGCCCTCTCCTGGGAAACAGGTGGGTCTGGGGACCACCCAATGATTGCCCTGATCTTGGACGTTGTATCTTAGCTTACGTCCTTCAGGGTAAAGGGGAGAATGAGGTATTTGTCAGTTTTGGGCCAGGTTACTGAGGCCAAATCTTGCTCCCCAGCTCTGTGCCTTGCCAGGATGTGAAATGTTTCCCTTTCACTCCTTAAAGTGCGGTCTACTCTGACCTCTTTGACCTCAGTCCCTTGGCTAGTCTTGCGCCTGATGGGAACTAGGGAGGTGGCTGGGAAGCTCTGGACCAGGCTCTTTAATTATCAGTTACCTGTCTTTCCAGTGTACAGTGCTTCTCAGACACAAACCAAATGAACACACACAACCTGGCTATCGTGTTTGGGCCTACACTCTTCCAGACAGACGGGCAGGACTACAAGGCCGGCAAGGTGGTGGAAGACCTCATCAACCACTACGTGGTGGTGTTCAGTGTGCGTCCCAGCTGGGATTGGGGGTGAGGGGAGGGGTGGGCAAGGCTAAGCCTCTCAGATGGCAGTGACAGCTGACCCTCCCCAGGTGGACGAGGAGGAGCTGAGGAAGCAGAGGGAGGAAGTCACGGCCATCGTGAAGATGCGAGTGGCTGGCACTGCCAGTGGGACCCAGGTGCAGGCCAGGGTTTGGGAAGGCTTGGGCTGGTTGCCAGCTCTGCTCCCAGACCTGTAGCTGAGCCCCATCTCTCCTGCAGCATGCTGGCGACTTCATCTGCACAGTCTACCTGGAGGAGAAGAAGGTGGAGACTGAACAGCATGTTAAGGTGGGGGCTGTTGAGCCAGGCTGTACCAGGGCAGACATAGTCACTTAGAGATGTGTGAGGTTCCCCAAAGACCTCTTTGCATCTCGGGGCTCAGAGGACCTGATGAGGAATGGGTTTGGGGGCCAAATTACAGGAGATTGTGGCCACATAGAAGCTGGAGATGCATTTGGGACTGGCTGATCTTGTGGGTCTGTGCAGATCCCAGCATCCATGACTGCAGAGGAGCTTACTCTGGAGATTCTGGACCGCCGCAATGTGAGCATCAGGGAGAAGGACTACTGGACTTGCTTTGAGGTCAACGAGAAGGAGGAGGCAGGTAGGTGGCCATGGGCTGCCTTTAGCCCAACCATCATTTCTCCCGCTCCCTGCCGTTTGGGAGCCAGAGGTTCTAGATGACACTTTTTGCTGGCTCACGGATGAAAATTGTGGTCTCCATGCTGGTGGTGACTGGCAGCTGGCAGGTCTGGGTGACAGTGCCATCCAGGTGTCAGAATGGTGTTGCTTGCGGAAGGGACAATGCTGAATTCAATGACAGGATTGTAGAATGATACTATTGGGGTAAAGAGGGTGGTGGATAGTGATCATGCAAGCAGGTGGCTGTGATGGGGGAGCCTGGCTGTGGTGGTGAGTGGCCAGTTGGGGCCTTGTATGGTTGAGGGAGCCATGTTGAGGTGAGAGGTGGGGATGTTGCTGATGCAAGCGTCAGCTGTTTTTGTTGAGTGTCAGTTGCTAGACTGAGGACCCAGGCAGTGGTTAGTCTAGTAAGGGACAGAGATGCTAATACCATGATCACTCTAGGAAATAGACAACTCCCTTGGTGTTAGTTAACTGCTTTAAAGGAAAGGCCCATGTCGTCAGCAGAACCTATGATATGGTCCTGGGTTCTGCCTTTTCTCTCGGAGTATCCAGATACCAACCGTACACTGGCTCGGAGAGGACAGAGTGAAGTTCAGAAGAGGTGGGGTCTGCGGTCTGCCTCTTCCCTTCGGAGTGTCAGATGAGCAGTCTGGGCCGAGCAGGGTGTTGGCCTGGTTGGGAGTGAGTTAGGGCAGAGCTTCTTCAAAGATCTTAGTGTTAAGGCTCTTTTAGATGCAGGCCTTCTCCGACTATCTTTAATGAAGTAGCTCTCTAAGAAGATCTTAGCTTGTTTATATTTTTTATTGGGGGTGCATCTGAACTTTATTTGGGGGTGAACCAAGTGTTATATAGTTTGGGGGGGTGAGAATATCCAAGATGCGAAAAAGTCACTGGCTGAGAGCTAAGATACTAAGATACCTCATTAGCCTGGAGAGGTGGTCTAGGTGCTGTTATATGATTGGCTGACTGCCTGTGACCACCTGATTGGGGGTCGCTTGGTTACAAGCTCTGAGACAGGCACGAAAACAGGGAAGGAGTTAGGCAGTCTCAGGATGAGATTCTAGTATCAGTTTTTTGAGATTTCCGGGGTTTGGACACCCTCTGCCTCACCCAGTCCATGCCAATTCCTCTGGTGGCATGGTCCACATGCCTGCCCTACACTATGCAGGGCTGATGGCTTTGGAGTGCCTTAGCCTGCTGTGAGGAAGAGTAAGGGCTACTTGGTAAAGACAGGACAAGTGATCCCAGAAACAAGACCAGCTCCAGCACCAGGCTGGGCCTTCCACGGCCCGAGGAAACCCAGGGTAGAATTGGAGGTGGAGTCAGCCACCCAGGGCCTGGTGGGGCTGCGGGGCCATGGGAGGGCTAGTAACAGGGCTTTGGGAAGATGATGTTTGCTGCTAGATTGGGAATGTTTGACAGGTAGAGTACATGCTAGAGGCCATTTGACGGTCAGACTGTGCGGGACAAGTACAGATTTGACCCACAAGTGTGGAAGGAGCCGGAGTATTTCTAATCTGAGCACAGGCAGTGTTTGTTGGGGACACCTGGGTGACAGTATAGCGTTGGTTTTGGCTATGAGCAGGTATGACAAGTCAGAAGCTAGCTTATAGGAAGGGTGATCATGATGGTGGTGTGTCACCATGCTAGTGGACGCTGAGCTGTGTAGGTGACATGTGTCCATTTGCTTGCCCTTGGTGGTACTAAGTGGTGTGGACCCAGTGACAGTGGTGTGGCCTCTCCACAGAGCGCCCGCTGCACTTTGCAGAGAAGGTGCTGCCCATTGTCCATGGGCTGGGCATAGACAGCCATCTGGTGGTGAAGAAGTACCAGTCCATGGAGGCCATGCTGTTGTACTTGGGTAAGTGGCGTCTCGGGGAAGGGGATGTGGGGTGGATAGGTACCTCCATCTACAAGCAGGGTGGGAGCTGGTGGCAACAGGACAGAGCAGGTCAGGTGGAGGAAACTGGGGGGCCTCCATGGGGAGGCTGGGACATGAGGTGGGGCACTGGAGTCTGTAGGTTGGGCAGTGTAACCCATGCCCACTCTGGACCTCCCTTAGCCAGCCGTGTGGGTGACACCAAGCATGGTATGATGAAGTTCCGTGAAGACCGCAGCCTCCTGGGTCTGGGGCTACCTTCGGGTGGCTTCCACGATCGCTACTTCATTCTCAACAGCAGCTGCCTACGGCTCTACAAGGAGGTCCGGGTAAGCCCTGTGATGGACATTAGTATCTCCTTTGTGCTCAGACACTCACACGCAAGCATTGTCCTTGGTCTGCAGGAGCGAGGTCCTTGTCTGAGGGTCTCGGCAGCACCATGACTGATGATAACTGTATATTCTCCTGCCGGGACCCTGAGTAGCCACTCAAAGCCTCTATCCACGTGAGGCCTTACGTGAGGCCAGGACATCATACACATGCTCCCATGTTTCCCTGTGCCTGTGGCTTATCACACTCTCATAAGAATGTGTCTGTTCCATGGCATCTATTTTGAGTTGTGCCCAATCCTGCTCCGCCCCTTCCTAGGACACAGCCCTCCTGACCTACTCTACCCCCATGCCCAGTGGTCTCCTAGACCACACTCCTTGGCACTCCATTCTTCTGTACACAGATGCCCTGCCATCCCCCTCTCCCTTGCCCTTCACACCACTACACAATGTCCTGGCTCTAGACTGGGATGATGCCCTCCATAACCCTGCTCCTCTATCAAACAGAGCCAGAGGCCGTGGAGCGGGGCCCCTGAGACCGTGAGTAGCTGTGGGCCAGCTGCCAGCTGCCTTCCTTACACTACCTGGGGCCAGGCGAGCAGGGTAGAGCTTGAAGACACCATCAGGGCTCCCAGTTCTCTCCAAGCATGGCTCCCTGTTTTCCTACCAAGTCACTGGCCCCTACCCTGACCCAAGATCTTTTTCTCAATATAGGGTCCCTTGTTGGTGTGATGCTAGAATTTTTCGTAGTGCTCAGAGAAGTTTTGGAGGCAGTATTAGAGACCCAAGTGTGGGTTAGGACTGGTTCATCTCCTCTTACTGTCAGAGCTCCCCACCTTCCAAACCTAGACAGAGTGCTGGGGCTGTCCTTGACCCTGTTGGGACACAAGGCTGTAAGACATTCTCTCTCACGGGTGGCTGTGCTTTCCCAGCCTCCCTAGCTGGTGGCCCAGCCTTCCTTGGCCACTCCTGAGAGACCCTCCATGTGCCTCTTAGGGCTGCCCAGCCTGGCTCTAATGTCTGGAGGTTGCCTCTGGCTCAGGTTCAGCTGAGAAGCACCGTCTGTGGTATACCGTGGGTACCACTTTTGCCACAGGGCACACAGAGTGTAGATGGTTCTGCAGGAGAGCAGTGGAGGCTCGATGCCAAGCACGGTGTTCTAGCGTGAGGTCCTTCAGTGACCCCGTCGTGGTCTCCAGCCCTTTCTTGCCTCTTGCATCTCCTGAGCATGTCTGAACAGATCTTGCTGGCTGCCATGGAAGATCAGATGGAGGGAGCAGCATCCCCATCTCCGTTTCTTTGTGCATTGTACCTCTGTTAATGCTGCCTGGACTCCTGGCAGGCACTCCCGTTTGTCCTTCCTCCTGTGGATCTCTCACTTCTGAACCTGCTTCTAGAATTTTCTCCCCCCTGGTCCTCCTTCTAGAGGCATTTCCTTAGACTCACGGAGCAGAGTGAGGCCACCTGTATAGGTAGAAGGGAAGGAGGGCACCTGAGGCACCCCAAAAGGCAGGTGCTAGGCATGGAGAGGTGGTCTGATGGTTACTGAGCAGGGCTTGGCATTTGTCCCTACTCCTCTCAGAGCAGGAAGTTACCTTTCCAAGGTGAGAAAGGGCCCAGGGACTTTCCCAAGGCTACTTTGCTCATGGCAGGCTAGGATGTAGGCCAGTGTTAGGGTTTGTCCTCTGTCTGGTGTCCTGGCAGTTTAGAGCTCCAGGGTATAGCAGGAAAGCTGCCAACTGTTAACAGGCAATGCTGTCATCTCGAGGCCACTGAAGTGTTGATGATTCTGACATCAGTTGGCTTATGGGGCCGCAGGAAAGAATATTTGAAATTAGAATAGTCTCATACCAAGGAGACTCTGTGGCCTCTCAGTCCCCATCCCAAGACCTCCTGCTGTTTAAGACTCTGGAGCACGTGAGAAAGGCATATTCTAGAAAAATCATGGTACTAGCATGAGGTACCTGAGTACTGAGCATAAATTTTATTTCTTGGACATCAGGGTACCAGAACCCTGAGCTGCTTGAAAATATAGTTCCTATATAGGAGTTAGTCTCTTCTCTGTGTTTCTGCCTACCCTTCCCCCACACTGTCCACCAGTCTCCTGCCCTGACAGGGACTGCCCAGGACCTTCTGCCTGACTTCTTCCAGCCCTTCCACATTCCATTGTCTTTGCAGGGGCCTCTCTTCTCCCAGCCTGCATCCTGTTCTGTCTATCTCCCATCCCTTCGCCCGTGTCCTAGTGTGCAGGCTGACTTTTTCAGTGCCTCAGCCTTGCCTCTGCCTGATGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGCGCACGCGCATGTGTGCACGTGTGTATATGTGTGTGTATGTGTGTGCACATGTATGTGTGTGTATGTGTGTGTGTGTGTATGGACGTGTGTGTGTGTATGTGTGTGTGTGTGAGGTCTTCCTCTCGGTGTTCTGCCCCCCCCCGTCCTGCCCCCCCCCCCAACCTTAGCTTTATTGTCCGTCCCACATCTTGATCCCCATTCTGCAGCCAGTGGTCTAGGCTGTTTGGGACATGTGATTATTGGGTGAGGTGCTCTATTTGAAGAGTTGGGGCTCCTTCATCCACCAGATCCACCAGGCCTTAGATCTTGACATGTTCTCTGGCCCACATCCCTGAGGTGACACAGAAGGACCCTCTAGTTCTGAGACAGATTATCCATTCTTCTCCTGTTAAGGAGCCATGCCTGGGGTGGCTGGGAGCAATGGTGGGGAGGGCTCGGTTTTGGAGCCTCAGTTGCAGTTGTAAGTACATCTCCCTCCCCTACCATCCTCTCTGGTACCTCTGATGGGTCCAGGGGAGCCTGGTAAGGGGAGGAAGGAAGCTAAGCAAATGGCTCCCACAACTGGAAGAAGTTCATTAACCTTCAAACAGTCTCTTCCTTGAGGGTCATTGCTCGTGTCCCCTCTGCTTTCGAGCCAGCCTGCTCCCACCAAGCCTAGACCCATATATGCAGAGGTGAGGGCCAGGCAAACATGTCAACAGTCTGGTTCCCCACTCTGGTCTATGGGTCTCTTGCTTCCTGCCTTAGACCATTGGGACTTCTCCCTCTGGCCTATCATGCAGAATACCATGCAAGCTTCAGTGTCAGCCATTGGCCTTCTGATGGGGCCAGATGCTAATGATGGCCGGTCCCCGAGCTTCCGTTCACACAGTCAACCCTGGAGCCTCCACAGGCAGGGGAAGGGAGCATGATGAGTGACTGAGACAAATGCAGACCCTAGTGGACAACCTTGAAGGCACTCTCACAGCCTGGGCCTGCCCCCGTGTGCTGTGGGGGGAAGTCAGGCCTGTGACTTCCAACCTGAGTCTCCAGTTTGACAAGCGGCAGGGTCTGGGAATCATTGCCCTGGAGCTCCCAGCTGGAGTGTCATCTTTGGGGACTGAGGGTTGACTGTCTGATGCTACTGTCATCTTTGGCTGGACAATGAACAGGGAGGGCTTTGGTGAGAAGGCTTCCTGGAGGAGGAGCCCTGTTCCAGAATGCCTGGGCGTTGGGGACGGGGGAGGGCAGTATGCCAGTGGAAGAGCTACTTCTGACTCTACCCACCTGACTGATGGAAGTGTCTCCCCCCACCCCCCAGAGTCACCGGCCTGAGAAGGAGTGGCCTGTCAAGAGCCTCAAAGTCTACCTGGGTGTAAAGAAGAAACTGCGGCCACCTACTTGGTAAGCCAGGACTGAGGTGCCAGGCCTATGGCTAGGATCTGTGACATCAAGAACTGACAGGAAGGCACAGCGGGGTTCAGAGCTTTATAGGGGATAGTGTAGTGGTTTTATAGTCGGGGTCCTCTCGGCTAGTAGCATCACCGAGACATACCTTAGAAGTACAGTCTTTCAGGTAACCCCTGAGCTTCCTGAGTTTGGGGTGCTGTAGTAGGGCTTGGGGCTCAGGGCTCAGTGTCTCCTCGAGCTGTCCAGGTAACAGAGTGAGTTTATGATTTGGGGGGTTGGTGTGTTTTATGTGTGTGGTGCAGGCCAGTGAGTGTCTGGGTGCATGTGCCTGTGTGTGCTCATGTGGAAGCCAGAGCAGGATTTAGGGTGTCTTCCTCTGTCACTCTCTGCCTTATTCTCTTGAGGCAGGGTGTCACTGAAGCTCACTGTTTCAGCTATAGGTGTCTGGTCAGTGTGCCCTGGGGGTCCACCTGCCTGTCTCCGCTCTCCAGTGCTGGGGTTACAGGCACCCACGGTTATGCCCAGCTTTTTATGTGGTTGCTAGGGATTTGAACTTAGAACCTCATGCTTGCAGAGCAAGCACTCTTATTAAGCGGTCTCTCTTAGCAAGTCGAAAAGCAATGCGTGCCACTGTGACTGTTAGGCACCGCAGTCGTGTGACTTGATTTGCTAACTTTCTCATCTGCTGGCTGTGCCAGGCTACCTCTGGTTCTTGGGTGGGCTTGGGCAGACATCAGCACAGTTGGATGGTTTTTTTTTTTGTTCTTCAGTGGTGAGGGTAGAACTCAGTAACTCAGGCAATGCTAGACACACGTACCACCCCCAGCTCAGGCCCTGCGTTCAGGTGGGGAGAGAAGGACACGGGCCCTAGTGTGCTGCACTGGGGGAAGCTTTGGCCCTTCCCTGCCCAGGCTTCTGGGCTCTGTCCCACAAATCTTTGCAAGTGCAAAGTGACCCCTTCTCTGGCTCTCCCTGCAGCTGGGGCTTCACGGTGGTGCACGAGACAGAAAAGCACGAGAAGCAGCAGTGGTAAGCCCTGGGCCCGGAGGGAGACAGGCAGGATTGGGGCCTCCCTCTCAGCCTATGAGGAGACAGGGAGGCAGAATGCTCGCTCTCCAAGGCCCTCGGCGGCAACCCGATCTGTGCCTTTTGCAGGTACCTCTGCTGTGACACGCAGATGGAACTTCGAGAGTGGTTTGCCACCTTCCTCTCTGTGCAGGTACCGGCTGCAGGGGGCTTCTCCAGAGGCTCCACCATGGAGAGTGGGGACAGCAGCAGAGAAATGGTGGCAGAGGAATTAGGTCTCTGGGCACAGGGATATTCACCTGGTGCAGAGTGGCTTCCAGGAAGAGGAAACAGCATATCCAAAGAAAAGGAAGGCTGCTTATGAAATACAGAATTTGATTTTTGTGTTCATGGTTCCACAGTGTTAGAGTCCCCATCATGGTGGGGAGCGTGGCAGTAGTCAGGCAGCCATGGTGCTGGAGGAGCTGAGACCTTATACCTCATCCATAAATGGAAAGGAGGGAGGGAGGGAGGGAGAGAGGGAGAGAGAAGAGAGAGAAGGAGGGAGAGAGAGAGAGAGAGGGAGGGGTGGGGAGAGGAAGGAGAGAGGGAGAGAGAGGGGAGGAGGAGAGAGGGAGAGAGAGAGGGAGGGAGAAAAGGAGAGAGAGGAAGGGAGAGAGGGAGGGAGGAATGGGAAGAGGAGGGAGGGAGGGAGGGAGAGGGATAGAAAGAGAGAGAGGGAGGGGGAGAAGGAGAGAGGGAGTGAGAGGGGGAGGGAGGGAGAAGAGAGAGAAAGAGAGGGAAGGAGGGAGAGAAGGAGTGAAAGAGGAAGGGAGCTAGAGGGAGGGAGAGAGGGAGGGAAGAGAAAGAGAGAGGGAGGGAAGGGAGGGAGAGAAGAAGAGAAAGAGAGAGGGAGGAAGGGAGAGAAGGAGAGAGAGAGAGGAGAGAGAACTGGAAATGACAAGAGCTTTTGAAACTTAAAAGCCTCATTCTCCAGTGCCACACCTCCTCCAACAAGGCCACACCTCCTAATCCTTCCCAAACAGTTCCATCAAGTGGGGACCAAGTATTCAAACATATGAGTGTCATTCCCATTCAAGCCACCACATTCACCACTTGCAAGGGGAGAAGCCATCAGTGCCGGAGGTTGGCCCTGATTGTAAGAACCTTGAGACCATGGTCAAGTGGCTGAACTAGACCTTGAGTTTCAAGTGAGTCCAAGCAGCGTGTAGGATTGAGCCTGAAGGGGGTCTCTCAGCTCCCTCAGCACCAGTGTACAGGGAACAGAGCCTGAAGGGCCACACCCACGGAGAAGTCACGCCAGAGACTGGTTAGACATGAAACACATGAGTTAGAACAGATGTTCAGCAGAATTCAGAACTGTGTAGGGAGAAGGAATTCAAAACTACCAGGGCTCTGGGCTCTGTTCCTGCTGCTGTTACATCCTTCTAATGCCGAGCTTCCTGGTGGTCAAGGACGAGATGAAAACGGTGGATTCTGTAGTTCTTGGTTGCTGGGAAGAGGAGGCACAATGCCTTTCGTTTTCTTGATGCTGAGTTCTTAGGGGAGGTTTGTGGATCTTGAGTAATCTAGTTGGCTGGGTTGTGCTGGGCTAGGGTCATCTGTGAACAGCTGCTTCTCATATCAGCCTCGATCAAAGCTGAAGGCGTTAGCTCAGATCCTAGCTGAAGGCTTTTCTGAGAAGGGGTGGGTGGAACTTGATGCTGCAAGCTGAGTTGTGGCCCAGACCCTAGCACTCCTTTCCTGGTTGTTCTCTAGCACGATGGCCTGGTGTGGCCCTCCGAGCCATCTCGAGTGTCCCGGGCAGTGCCTGAGGTCCGGATGGGCAGTGTATCGCTGATCCCTCTACGAGGCAGTGAAAATGAAATGCGCCGGAGTGTGGCAGCCTTCACTGCTGACCCCCTTTCCGTAAGTGTCTCTGGTTCATGTGGGCAAGGCTGGGTGGGACCTGGCTGGATGCCTGCCTGCACTTAACTGATTTCTCTGACAGCCCATCTAGTCTCTTCCCTAGGTTTCTGGGGCCCCTTTTGTCTAGCCTTGGAAACCCCAGCTGCTGATATTTCGGCATCTACTCCATTGCTGGCTGCTCCTTTTTACTTTCACAAAGCACTTATAGGATCTGGGCTTCTGTGCTCCCTACAGCTTCTCCGCCATGTCTGAGCACAGGAGTCGTTCTGACTCTGGGACACCATCACTGCCACCAGGAAGCTTTCCTGTTCAGACGCCCTCGTGCTCTGCGTGTTTGGTGTGAGCCAACAGAACACACGGGGAAGCCATACCCACATCCCATATCCTGACTGCAGCACAGGCTTCTTGGCTGGGCAGGAATGGGCTGGCAATGGGGATTTCCCAGGAGGGACCCTTCCTTTTCCTGCAGGCAAGCAATGCTCTTGACCTGGCTTGCTTACCTAGGGTCATGCTCTTTGAATCCGTGGAATTGGAAAGATGGACAGAAATCAGGAGCTGTGCAGGAGAAGGGTTTGGGGCCCCGCTGGGAGGGAGCCCACCCCCTTCCCACAGGCTCCCAAATGGAAAGGGTGACACTCTGAACGTACTCCCGGGGGTCTACAAGGGAGCTCGTGGGAAGCTTCTGCAGGGTGATTTCTGGACTTGGGGACATCAGCCCTCTTCTGGTGTGTGCTGGCAGGGAGGCCCAGGCTGTGGCTGTCTGCTATCCCTTCCCCACTTTGGATACTTTTTGATAATATAAATATATCTGTATATTTTACCCTATGGTGCTGAGGCCTGTGATGGTTTGTGGGCACTGGTGTCCTAGGCTAAGGGTACAGTTGGCTGTGAAGCCCAGAGGTGAATGCTGGGGCTTTGAAGCCAGGAGCCTGAGTCTACCCTCTGCATGTTTACTGAGCTATTTACCCTCCACTGTCCTGGCAGAGGCCTGGCCTGGCCCTGTACCTACTGTGCCACTGTACAGCCAGGCTATGGAATTTCTGATTCAGGACAAGGCAGACCCCAGCTAGTCTGAGTCCCGGTCCCTGCAACCATCTGAGCTGGGGCCTAGATCTGTGTTAGTGACCCCGGCACAGCTACTCAGAGCCTCGTGCTGGAGACACGAGGCCACAGTGCATACCACAAGCTTTGGAGGACTGTGAAGGGGGCTTTACCCTGGGCACTATGCGTGTGCTTCCAGAGTGGAGTCTGCCTCTCACATCACAGGGCATCGCCTTCAGAGGGAAGTGCTGACCTACAGAGGTCACCAGCTACTCAAAGACAGACTGGAGACTTCTGGGAAAGTGCTAAGCTTCTGCCTTCTCTGGAGTCTCATTGCCACCCTATCTCAAAGGCTTAGTGAGCAGACTTGCTGGTGTCCTGTCCTTAGCCTCGAAAGGGGCAGAGCAGAGCTGGATAAGACTGGGGTACCTGTGCCATCTGTGACCCCCCCATCACCTATAAAGCTCTGAACCCCGGCTGTGCCTTCCTGTCAGTTCTTGATGCCACAGGTCCTAGCCATAGGCCTGGCACCTCAGTCCTGGCTTACCAAGTAGGTGGCCCCAGTGGGGACCTGGATGTACACCTGGACATGTGTCCTGGGTGTTTGCCAGGAGACAGCACACGATCCTTGAGCTCTACTAACCTGTTGCACAAGCTACGGTCCCCATCCCTTTGTCCTATCTTCAGGGAGCTGCTCCAAGCCAAATTATCATGTCCTCCAGGCAGGACATGGCTAGAGGGCTTATGTGCCCAAGAGCTGCTTCCTCCCTGAACTTGATCTACTGTCCACCAACCCCAGAGACCAAGGAAGAGGGTACAACTAGAGGTGCCCTCTGCTGGTCTGGCACTGTCATTACTCTGGTTTAGGGATTAGCCAGAGGGGAGCTGCATTTGGCCACTAGGGGGCAGTCATGGACCACTCATAGTTGCAAATTTTGAGCAGGGTCTGTGTAACACCTCCTAACCCTCCCTACACCTGCAACACTTCCTCCCTCCCTCCTCTCCTTCCCCTCCCAGTGATATTCCTGGATCTGGCTTTGTTCTTCTGCCAGCTGGACCACTCAGCCCTGCCTCTGGCCAGCAACTAGTGATGTGTTGTAAGACAGCACAGTAGAGGTGCTTTGCTTTGATCTCCTGGGCTCTAGGACATGAGAGGAGCCCTTCGCCCAATGCCTACAGAATGCAAACCTAAGCCTGAGCCTCTGCTCTCAGCTTTCCCTGCCTGACATTAGAGTCTCCTCAGCTTTCCTCCTGCTCTTAGCCTGTTCTCCCCTTTTGTGAGCGCTCCCCGTAGCCAGCACTATGTGACACTGTAGAGTGCTTTCCCTTGGCGTGAGGTCACATCCCTGCAGGATTGAGACTCAACCTTCGTGAAAAATACCTGTGACTACAGTGTTGGGGGGGGGGGGCAGAGCAGAAGGTTCTGTTGTCTCAAGGATTCCTAATACTGGAGCCAGTGCCAGAAGGGAGG
G5 108543710 108543759 50 CTAGTGGAGCTATCTGCTCTAGGAAGAACCTTGGAGCTGCCTAGGTTCTC
U5 108546660 108546709 50 GGCTGCAGCTGGGGGAATACTCAGGTAAGTGGTGAGTTAAAATGAAGAGC
D3 108547046 108547095 50 CAGGTCCACACAACAAAGAGACTGTAAACATTGACCTTAGCTCATGAGGC
G3 108553499 108553545 47 CTGCCAGCTGCCTTCCTTACACTACCTGGGGCCAGGCGAGCAGGGTA
G5_U5 108543710 108546709 3000 CTAGTGGAGCTATCTGCTCTAGGAAGAACCTTGGAGCTGCCTAGGTTCTCTTTCCTCATGTTGGTGATGCTGAGGCTTTGGGGTTTGTGTATGTGTAGTGGGTCTGTGTTGCTGTGGAGGAGGGTGTTGCCATGTGTGTGTGTGAACTACACAGCAGCCTTGTCGTCTGTTTGCTCAGTCTGGGTGGAGTTCCATCATAGACCTGGGTTGGATCCCATTTGGCTCCTATTCTTGGGATGGGTGAGGAGGGGGTCGCTAGGGTGAATGCGTCGGTTATGGCCCAGGCCAGGTCTCTTGAGGCCACATCCTAAGGCAGAGGGTGGGGCTCAGCGGCTGGGGCTCTGGGCCTTGGGCCATGGGTGGGTGGGGTGTGCTGGGCTGGAGAGAACCCAGGTGTCTAAGGGAGGTGCAAGAGACCACCCAGCTGGCTTGGACTACGGGGGCAGGACCCCTCAGTGCTGAGCACTGAATCCAGCCTACTTCACTGGGCTTTGTGCTATCTGGGACAAACCTCTCTCTAGGGACTACTATTGAGTTGGCCCAGAGCCCCCCTCATTCTAACATGCTTGGCTCTATGCCTCCAACAAGCAGTGTGGGGTGGGCTTGGGAGTCATGGAGCCTTCTTAAGATGGGTAGGGCTGGAGCTGGGCCCTGAGAATGGAGTGACATTTCCACTGGTGAGCAGAGGTTGAGATGTGGCTTTTCAAAACCCTGAAGGTAGCAGTAGGAGCCTGACGGTGCTGGTAGGGAGCTGAGGAAACAGGGCTGTGACCATGAACCTAGGTACTTTGCCCCAGGGGGCATCTGGAGAGGGCACCACCTGGACACCCAGTGTGCCACTACCATTCTTTCTTCCACTCCAAAGAGGTCCCTCGGTTGGACTCAGTGAAGCCCTTGGAAAAGCACTACTCCGTTACCCTGCCAACTGTGAGCCACAGCGGCTTCCTGTACAAAACTGCTTCTGCCGGCAAACCTCTGCAGGACCGCCGTGCCCGGGAAGGTGAGTACAGCATCTTACCCATCCAGGCCTATGGTGTGTGTTAGCCTGGCTGCAGGGCCAGCAAACTAGGGCTGGTCCTGCTGGAGGACCTGAGGGTGCCAAGTGGACTCTAGCAGAGCCACTTGGAAAGTCTTGGATACGGTCTCTTGAATACAATGAGTGCTTGAGAAATAGGCTAATCGGGGTGGGACATGGAGATGGCACCACCGGGGAGCGTGAAGTCCATATGGAGCCCCCGTTGGGTGTGGCCTTGTGCTGAGCAGCTGGCATATTCCAGATGTGGATGGAAGGCGGTTTGAGGACTTGAACTTGAGTGCCATCCCTCTCAGATCTCAGTTGCCTTCCATTTACTCCCTGCCTCCAAGTTCAGCCTATAGTCCTTGCACATCACCCAAGAGCTACCTACCTTCCTATCCGGCAGACTCCCCTCCCTGGATTCTGCCCCAGCTCTGTGGCTTTGTCACACAAGCCAGATTTACCTACCCCCACCAGGAATCTGCATATGCTACTGTCTGCCCCAAAGGCTTTCCCCAAATATCCCTTAAAACCTCATGTCTTTGGGGATATCATGTCTTTCCCAGCCACTCAATACTGTGCCCCCTGTCACCCCCAATACTATTTTTTCTCTTACTGTTCCATCTGATTTTTATTCTTATTTTTTTCCTCCAAGATAAAGTCTTTTTGCTACCCAGAGCCTGACATTGAACTCCTGGGATCAAGTTTCCATCTTGTCTCAGCCTTTCCAAGTAGCTGAAATTATTATAGTAGATAGTGCCACTATAGCCAGCTCAGTTGTCCTTTATTGTATACCTCTGTATACATGGTACCTGGTACCTATTGTAGCCCTAGCACCTGGGGCGCACTGGTACCCACTGGTAACGTAGCATACATCTGCAGAATGAAGAAGACCTCAGCAGGCTAGTGTGCTTCTCAGAGCACATCCTTGAGGACAGCCTTGGAGTCACATGGTTCTCACGGACAGGATGAGGGACAGCAAGCTGGAGGAGCAGAATGCCCACTGCTTACAGCCTCTCTCGGAACCCCTTCTTGGAGTCCCCCAGATACTCTCTCTGACAGTACTCTCTAACTCCTAGATGGTGTAGCCCTCTGCTGCTCCTGGTCAGTTCCCTCTGCCTGATGATGTCATTTATGGAACCCCTCTGAGTCATCCTTTTCACCCTGAGTGCCAGGAAGCTCTGAGCCACTGTGAGGCTGGTGCCGTAAGCTACAGTCGCCTGCCTGCCTGGCTTTGGTGCTCTGCTCTCTTACCTTTCATGGTCCAGGTTCCCATTTCTGGTTCTACTGGGGATCTCGTGTATCTTCAGAGCCATTGTAGGAGGAGGCAGACTATAGAGTGAGGAGTGTATCTGGCAAAGGAGACGGGGCACAGGGTGGGTCTTAGGGTTTTACTGCCGGGAAGAGACACCATGACTAAGGCAACTCTTATAAGGACAACATTTAATTGGGGCTGGCTTATAGGTTCAGAGGTTCAGTCCATTATCATCAAGGTGGGAACATGGCAGCCTGCAGTCAGGCATGGTGCAGGAGGAGCTGAGCGCTCTACATCTGCATCTGAAGGCTGCTAGCAGAAGCAGCTAGGATGAAGGTCTTAAAGCCCACACCCACAGTGACACACCCACTCCAACAAGGCCACACCTCCTAATAGTGCCACTCCCTGGGCCAAGCATATTCAAACCACCACAGCTCCCAAGGCTTCCTGTACAATTGAAGCTGTAGGTAGAAGGAGCAGCAGGGAAAGAAGCTAAGAGTAGCCAAAGAGACAGACAGAGGCAGACCTAGGCTGAGAGACACAGGTTGCCCTGATGATTGACAGCTTGGGACCTAACATTTAAAGAGAAGTGGGGTCAAGACTCAGTCGTTCCTGGTCTCCAAGCTGGAGACCAAAAGTTCATATCGGCTATAGGGGAGAGTTGGGGACTAGGTATAGAGGGCTGCAGCTGGGGGAATACTCAGGTAAGTGGTGAGTTAAAATGAAGAGC
D3_G3 108547046 108553545 6500 CAGGTCCACACAACAAAGAGACTGTAAACATTGACCTTAGCTCATGAGGCTGCAGCCCAAAGCTGCTCGTCCACCTCTTGGGAATCAGGGCAAGGAATAGAGAATTAATGGGGGAGGAGGGCAGGCTGTGCTGGATGAGTGAATCCTGATTTGTATATTTGTAGCTTTGAGCACACCTTTGAGGTGTACACAGAGGGAGAACGGCTGTACCTGTTTGGGCTGGAGAATGCAGAGCTGGCTCATGAGTGGGTCAAGTGCATTGCCAAGGTAGGCCTGGGTTAGGAGGGCAGGCGTGTGATGGAGGCAGGGCGGGCCCTCTGGCTGAACCCCATGAACTCCAGTTCTTCCATCTCTGATGGAGAAGGAGCCAGGCGTGGGTATAACAGACTCAGGACAGACCTCTCAGATCAACGGCAATGCAGATGTAGCCCTCTGGTACCTAATGGATATTTGTTATGAGGAACATGTTTGGGAGGGTCATTGTTTGCAGGTGTGCAATTAGGCTAGATGGGAAGGCAGGGAGGCTACAGAAGAGAGGGCTGCCTTAGAGACAAGAGTCAAGAGCCAGCCCTCTTGTGCTTTGAGAGCCTGGGGCTTCATTCCTCATTGGCTCATTTGATGAGCTCTCAATACCTTCTGAGGATCAGTGCCCAGGGCCCGGAGGACCCGAGTGTACCAGTGCTCTGTTGTTCCAGTGGGAGTGCGGCAGACAGGCTGAGTCTAGACACTATGGTAGCAGATGGTGAAGTATATGGACACTGGGAACACAGAGAAGGACACATCCAAATGGGTACAGAGGACATGGTCCCAAAGTCCTCTGTCACTGTGCTATGCTCTGCCTTGGGAAGGAGGAAGTAGTTAGAGGGAAAAGAGCCCTTGCCCACAGGGTGTCTCCAGCAGGCTGTGCTGTGCTTACATGCTCTCTCCACTATTTCCCCCCCGACTAGGCGTTCGTGCCTCCCCTGGCTGAGGACCTGCTAGCCCGGGACTTTGAACGTCTTGGGCGCCTACCCTGTAAAGCTGGCCTGAGCCTTCAGCAGGCTCAGGAAGGCTGGTTTGCCTTGACTGGCTCTGAGCTCCGGGCTGTCTTCCCAGAGGGGCCCTGGGAAGAGCCGCTGCAGCTCCGGAAACTGCAAGAGCTTTGTATGTGGACCTTTGCTTAGTTCCCCAATCTCTAGGATCCCTTGTCCCAGCCCTGCCCCACCCCCACCCCCCACCCCCACCCCCTACCCCCCAATCCCCTAGTCCTTGTCTGGAAGTCTGAGTTCTATTATGGCCTGAGCAGATGATCCAGCCTCCCCTCCATATCCTCTCCTGTCCTTGAAGTACATCTCAGCAGCCCTTTAGGTTGGTGGGTGGAATCTAAGGGTGAGACCCAGACAGCCTCAGGAGGGAGCAGTGTATGGGTCATGAATAAGGCCTGGGCCTCACCTTGGCTGGCCCCTCCATAGCTATCCAAGGAGACAGCGAGAACCAAGTGCTGGTGCTGGTGGAGCGGAGGAGGTGAGCCTTGGCTTCCCTGAGGATCCTGGAGAAGCCTGAGGGCAGGTGGGATACAGGGGCAGGCAGGTGGGACAGTGACTATCTCTGCTCCAGGACACTGTACATCCAGGGTGAGCGGCGGCTGGACTTCATGGCTTGGCTAGGGGTCATCCAGAAAGCAGCAGCCAGCTTGGGAGACACACTATCAGAACAACAGCTTGGGGACTCGGACATCCCAGTGATTGTGTACCGCTGTGTGGACTACATCACGCAGTGTGGTGAGCCCAGCCTCCAAGTCCCAGCCACCCCTCTTCTCTAGTGATACCCAGACCCCAGTGCCCAGGATCCCTCTAAAGAGTGGTTTAACTCCCTCCCCAGGCTTGACCTCAGAGGGTATCTATCGAAAGTGTGGTCAGACCTCCAAGACTCAGAGACTGCTAGACAGCCTCCGGCAGGACGCACGCTCTGTGCACCTAAAGGAGGGAGAACAGCACGTGGACGACGTCTCCTCTGCACTCAAACGCTTCCTCAGGGACCTGCCCGATGGGCTCTTCACGCGTGCGCAGCGCCTGGCCTGGCTGGAGGCCTCTGGTGGGTCCTGCTGCCTGCATCCAGCCCCATCCACCCTACCTACCTCAGGATGTCCCCATCGTACCCTGGGCAAGGCTTGCCCCAGCTCCTCCACCTATTCTGCTTCTAGGTCCTCTAGTCACTATAGAGAGGGAGATGCTCAGAGGTGGAGAGTAGAGCACTCCCTGTCCTGATAGGTGTCTGTGAATGATGCCTCCATCCTGAGAGGCAAAGCTGTTGGGAGGGGGCATTGGTGGCCAGTTTCTAACCCAGTCCATCTCTCCCCCACACACACCCAGAGATCGAGGATGAGGAAGAAAAGATCTCCAGGTATCGAGAGCTCTTGGTGCATCTGCCCCCTGTCAACCGGGCCACTGTGAAGGCCCTTATCAGCCATCTGTACTGGTGAGGGCCGTGCCAGAGTGAGGCTCTGGGGAGATGGGGGTCGGGGGAGGTTCTTCTACTCCCAACCTGGCTCACTGCCCTCTCCTGGGAAACAGGTGGGTCTGGGGACCACCCAATGATTGCCCTGATCTTGGACGTTGTATCTTAGCTTACGTCCTTCAGGGTAAAGGGGAGAATGAGGTATTTGTCAGTTTTGGGCCAGGTTACTGAGGCCAAATCTTGCTCCCCAGCTCTGTGCCTTGCCAGGATGTGAAATGTTTCCCTTTCACTCCTTAAAGTGCGGTCTACTCTGACCTCTTTGACCTCAGTCCCTTGGCTAGTCTTGCGCCTGATGGGAACTAGGGAGGTGGCTGGGAAGCTCTGGACCAGGCTCTTTAATTATCAGTTACCTGTCTTTCCAGTGTACAGTGCTTCTCAGACACAAACCAAATGAACACACACAACCTGGCTATCGTGTTTGGGCCTACACTCTTCCAGACAGACGGGCAGGACTACAAGGCCGGCAAGGTGGTGGAAGACCTCATCAACCACTACGTGGTGGTGTTCAGTGTGCGTCCCAGCTGGGATTGGGGGTGAGGGGAGGGGTGGGCAAGGCTAAGCCTCTCAGATGGCAGTGACAGCTGACCCTCCCCAGGTGGACGAGGAGGAGCTGAGGAAGCAGAGGGAGGAAGTCACGGCCATCGTGAAGATGCGAGTGGCTGGCACTGCCAGTGGGACCCAGGTGCAGGCCAGGGTTTGGGAAGGCTTGGGCTGGTTGCCAGCTCTGCTCCCAGACCTGTAGCTGAGCCCCATCTCTCCTGCAGCATGCTGGCGACTTCATCTGCACAGTCTACCTGGAGGAGAAGAAGGTGGAGACTGAACAGCATGTTAAGGTGGGGGCTGTTGAGCCAGGCTGTACCAGGGCAGACATAGTCACTTAGAGATGTGTGAGGTTCCCCAAAGACCTCTTTGCATCTCGGGGCTCAGAGGACCTGATGAGGAATGGGTTTGGGGGCCAAATTACAGGAGATTGTGGCCACATAGAAGCTGGAGATGCATTTGGGACTGGCTGATCTTGTGGGTCTGTGCAGATCCCAGCATCCATGACTGCAGAGGAGCTTACTCTGGAGATTCTGGACCGCCGCAATGTGAGCATCAGGGAGAAGGACTACTGGACTTGCTTTGAGGTCAACGAGAAGGAGGAGGCAGGTAGGTGGCCATGGGCTGCCTTTAGCCCAACCATCATTTCTCCCGCTCCCTGCCGTTTGGGAGCCAGAGGTTCTAGATGACACTTTTTGCTGGCTCACGGATGAAAATTGTGGTCTCCATGCTGGTGGTGACTGGCAGCTGGCAGGTCTGGGTGACAGTGCCATCCAGGTGTCAGAATGGTGTTGCTTGCGGAAGGGACAATGCTGAATTCAATGACAGGATTGTAGAATGATACTATTGGGGTAAAGAGGGTGGTGGATAGTGATCATGCAAGCAGGTGGCTGTGATGGGGGAGCCTGGCTGTGGTGGTGAGTGGCCAGTTGGGGCCTTGTATGGTTGAGGGAGCCATGTTGAGGTGAGAGGTGGGGATGTTGCTGATGCAAGCGTCAGCTGTTTTTGTTGAGTGTCAGTTGCTAGACTGAGGACCCAGGCAGTGGTTAGTCTAGTAAGGGACAGAGATGCTAATACCATGATCACTCTAGGAAATAGACAACTCCCTTGGTGTTAGTTAACTGCTTTAAAGGAAAGGCCCATGTCGTCAGCAGAACCTATGATATGGTCCTGGGTTCTGCCTTTTCTCTCGGAGTATCCAGATACCAACCGTACACTGGCTCGGAGAGGACAGAGTGAAGTTCAGAAGAGGTGGGGTCTGCGGTCTGCCTCTTCCCTTCGGAGTGTCAGATGAGCAGTCTGGGCCGAGCAGGGTGTTGGCCTGGTTGGGAGTGAGTTAGGGCAGAGCTTCTTCAAAGATCTTAGTGTTAAGGCTCTTTTAGATGCAGGCCTTCTCCGACTATCTTTAATGAAGTAGCTCTCTAAGAAGATCTTAGCTTGTTTATATTTTTTATTGGGGGTGCATCTGAACTTTATTTGGGGGTGAACCAAGTGTTATATAGTTTGGGGGGGTGAGAATATCCAAGATGCGAAAAAGTCACTGGCTGAGAGCTAAGATACTAAGATACCTCATTAGCCTGGAGAGGTGGTCTAGGTGCTGTTATATGATTGGCTGACTGCCTGTGACCACCTGATTGGGGGTCGCTTGGTTACAAGCTCTGAGACAGGCACGAAAACAGGGAAGGAGTTAGGCAGTCTCAGGATGAGATTCTAGTATCAGTTTTTTGAGATTTCCGGGGTTTGGACACCCTCTGCCTCACCCAGTCCATGCCAATTCCTCTGGTGGCATGGTCCACATGCCTGCCCTACACTATGCAGGGCTGATGGCTTTGGAGTGCCTTAGCCTGCTGTGAGGAAGAGTAAGGGCTACTTGGTAAAGACAGGACAAGTGATCCCAGAAACAAGACCAGCTCCAGCACCAGGCTGGGCCTTCCACGGCCCGAGGAAACCCAGGGTAGAATTGGAGGTGGAGTCAGCCACCCAGGGCCTGGTGGGGCTGCGGGGCCATGGGAGGGCTAGTAACAGGGCTTTGGGAAGATGATGTTTGCTGCTAGATTGGGAATGTTTGACAGGTAGAGTACATGCTAGAGGCCATTTGACGGTCAGACTGTGCGGGACAAGTACAGATTTGACCCACAAGTGTGGAAGGAGCCGGAGTATTTCTAATCTGAGCACAGGCAGTGTTTGTTGGGGACACCTGGGTGACAGTATAGCGTTGGTTTTGGCTATGAGCAGGTATGACAAGTCAGAAGCTAGCTTATAGGAAGGGTGATCATGATGGTGGTGTGTCACCATGCTAGTGGACGCTGAGCTGTGTAGGTGACATGTGTCCATTTGCTTGCCCTTGGTGGTACTAAGTGGTGTGGACCCAGTGACAGTGGTGTGGCCTCTCCACAGAGCGCCCGCTGCACTTTGCAGAGAAGGTGCTGCCCATTGTCCATGGGCTGGGCATAGACAGCCATCTGGTGGTGAAGAAGTACCAGTCCATGGAGGCCATGCTGTTGTACTTGGGTAAGTGGCGTCTCGGGGAAGGGGATGTGGGGTGGATAGGTACCTCCATCTACAAGCAGGGTGGGAGCTGGTGGCAACAGGACAGAGCAGGTCAGGTGGAGGAAACTGGGGGGCCTCCATGGGGAGGCTGGGACATGAGGTGGGGCACTGGAGTCTGTAGGTTGGGCAGTGTAACCCATGCCCACTCTGGACCTCCCTTAGCCAGCCGTGTGGGTGACACCAAGCATGGTATGATGAAGTTCCGTGAAGACCGCAGCCTCCTGGGTCTGGGGCTACCTTCGGGTGGCTTCCACGATCGCTACTTCATTCTCAACAGCAGCTGCCTACGGCTCTACAAGGAGGTCCGGGTAAGCCCTGTGATGGACATTAGTATCTCCTTTGTGCTCAGACACTCACACGCAAGCATTGTCCTTGGTCTGCAGGAGCGAGGTCCTTGTCTGAGGGTCTCGGCAGCACCATGACTGATGATAACTGTATATTCTCCTGCCGGGACCCTGAGTAGCCACTCAAAGCCTCTATCCACGTGAGGCCTTACGTGAGGCCAGGACATCATACACATGCTCCCATGTTTCCCTGTGCCTGTGGCTTATCACACTCTCATAAGAATGTGTCTGTTCCATGGCATCTATTTTGAGTTGTGCCCAATCCTGCTCCGCCCCTTCCTAGGACACAGCCCTCCTGACCTACTCTACCCCCATGCCCAGTGGTCTCCTAGACCACACTCCTTGGCACTCCATTCTTCTGTACACAGATGCCCTGCCATCCCCCTCTCCCTTGCCCTTCACACCACTACACAATGTCCTGGCTCTAGACTGGGATGATGCCCTCCATAACCCTGCTCCTCTATCAAACAGAGCCAGAGGCCGTGGAGCGGGGCCCCTGAGACCGTGAGTAGCTGTGGGCCAGCTGCCAGCTGCCTTCCTTACACTACCTGGGGCCAGGCGAGCAGGGTA
U5_15 108531660 108546709 15050 AAATGCTTTCTTTCCCCCCTGCAAAGAGACTCAGGGAGACAGCCTGGTGTTGTGCTCATGAAAGATTGTTATGCTCTCTGTACCACCACCCCTTAGAATCAGTTCCCAGAGAAGGTAGGCAGGGTATAGAGAGCAGCTTTCTCCCAGGGTAGAGATGGGTCATGACAGCCATCCCAGCTGTCACCATCCACACAGCTGTCTAGCAGCCATTCCTTTTGACAACTCAGAGGTGAGAGGCTGAGGATCAGAGTAAGCAGGTGACCCTCTGGGAGCCAGCCTGGCTTAGTAACTTCTATTCCATTCCAAAGGGCCAGTGAGCCTTCTAGTGGCCCTGCAAGTGTGTGTGTGTTCTCAGTTGCCAGTCACTACAGAGTTTGCTGGCGGTTTCTCCTGCAGTTGTCATGCAGGCTGCTGTAGCACCTTGTGCAGGACGTGACTCCACAGGGAAGTTCCCTCCCTGTCTGCATGGCCGTAGTACAAGCTATTTGGAAACAGACACATTCTAAGAAGGATGAGGTATTAGAGCTCTCAGCTCTGTTAGCTTAGATGCTGATGGAGCCTGGGCAGGAGAGATGTACTTTGAAGAGTTTTATTTGGAAGACCTTTCACATACAGGGGAGAGCAGCAGGGTTTAGGGAAACAGAAAGGTATAGCTGGAGAGATGTGATGTAGAGGCAGGGATGCTTCTACAAGGAACAGGGAGAGGGGAACTGGTAGATTCAGGAGTGACCCAGTCATATCCTCCCAGGCCTCCTTGCGTTTCTGGCAGTCACATGCTGCTACCCACTGCTGGGAACACTGGGGAACAGACCAACCCGAAAGTGACCAAAGAGGAGGAAGCTGCTCACTCTGATGCCCCTCCTTAGCCCTTGGCAGATGTGGACAGAGATAGCTGGTGGGGCCAGGCCACCAGGACTCAGCCGCCATTCTAACTGCTGGGTGCTGAGGATCCTGTGTGTTGGTATGTGACCTACTCTTTTTCTGTCTGTGAAAGCAGATCCTACTCTACAGAAGAGGAGACCCAGGCCTGGAGAGGCTAGGCATTTATTTAGTCCAGGGCACACAGAAGTGAAGATACCAAGGTGGGGCTCAAACCTATGTCCTGGCTGACAAAGCCCTTTAGGAGACTTTTATCACCAGAATAGGACAATAGGAAAACTATGGGGATGGGGAAGAGCTGGGTAGTTACCTGAAGCAGCCCCTAGAGACTGACATCATAGATGAATAAAGGTGTGTGGGGGTGTGTGTAAAGAGAGCTTGGGGGAATGAGGTCACCATTTCTGAATGTGGACAGAAAAAAGAGGAGAGGTCCTTGTCCCAGAGACTACAATCTGGGCTTTAGGAACCAGTTTCTGGGATTCTGGCTTATGACTTCAGCGCTAGCCTTGGTGCCTGTTTCAATCCCATCCTGTCTGCTAGCATATGCCCTGTATCCTCCATGGTACATGTCAAGACTTACCTCCCTCTTGCTCCATTCCGGTCTTTTCTCTGTGTCAGCATGGAGGTTCCATGGGTGTGTTGCTAGAAGCAGAAGCACTAAGACTGGGCGACCAGCACATACATATGGGCCCAAGAGGTGCTGGCCTGAGAATGGTGAGGGCTGTGTGAGGCAGGCTGGTGTCTGGGTCGGGACGATGCTTGCCTAGTGAGCAGGGCCTCAGTGGGTCAGAACCCTGGCTGGTGCCTACTGACACCCGGCTCTGGTTCTGTTCTCAGCCTTCTTGCTAAGGAGGAGTTACTGCTGCCATCAGTGTCACCCCGGTCCCAACCAGAGCCTGCAGAGACTCCGTCCACCCTCCTGCCTGCCTTTCCCCAGGGGCCCCTGCAGCCTCCGTCTCCTCCTCCCTGTCCTCCTGTGATCCCTCCCAAGCCTCCTCGCCTGCTCCCTGAGTTTGGTGAGTGCTACTGGGGAACTGGGCTCTGGGTGGTCTCCTGAGATCAGCCATGGAGAGCAGGTCATGGGGCTTATTCCCTCTCTCCTGGTGGCCAGCAGTCCCCTGGGTGTCGTAAGCCTTCTCAAAGAGCACGTCCTTTCTCTCTCCTCTGTCTCCTGCTTGCCAAGTGTGAGCGTGGCCAATCTTTGAGGTATCGAAGTTCTTGGGCTGAGTAACCCTTGGGGCCACCGCTCCATCTTGATTCTCATTAACCTTGTGTGTCTCGTTTGGACAGTCCCCACCCCGACTCCCAGGCTGCTGCTTGGTCAGCCTTGGCCCTTCCTTTCCTTCAGTATAAATAGTACTTCCTGTCTCCTGTGCCTTTCTTTTCAAACTCAAGCCTGGGTGTGTGTGTGCGCGTGTGCGGTGGGGAGTTTATTCTAGCCTGGGAGTGGCCTTTGTGAAGCCAAGCCCTAGCCCCTTAGAGGAGGTCAAGCTCCTAGCTTCTGAGCCATTCCCTCTCTTTTACCAGACGACTCTGACTATGATGATGTCCCGGAGGAGGGGCCAGGGGCCCCAGCCAGTGTGATGACCAAGGTAGGCAGGGCAAATGCTTGCGGTTGCATTGGCTGCCTGTGTTGTGGAGGGAGGGCTGCTCATTGGCCTTAGAGACCCCAGGATCTCCTCCCCTAGCAGAGTGGATGCTAAGCCTGCTTTACTGTCTGCCCTTATAGGAGTCACCCTGGGGTCTGCAGCTCTCTGGTCTATGGCTTCTATTCCAGGCTTGAGTGTATGTAGTCTGTTGCTGTGTGAGTCTTGGAGTGGCTTCACTTTCTCTGTCCCCAGGTCACCTTCTCTCTTGAATGTGTCACTCTAGCTCTGAGTCTTTCTCTGCTTTCCTGCCTTTCTATCTTTCTCCTTGCCCTAGATCCATGTTTGCCAACAGTTCTCCTGACCCTGTCACCCTGGTCCCTGTGTGGTCTCAGCTGCTGGGGGAGGGGTGCACAAACAGAAGTAAAAGTGCTGAGTTGTGGGTGTGGAGTAGAGGGGTGGGTGTGGCGGCTGGGGGTGTGGTCTGGGATTTGAGGGAGAAATGTGACACTGGGTGATCCTTGGGGGGGGGGGGCAGGAGGAGCCCCTGCCGAGCCGAGTCCCACGGGCTGTGCGTGTGGCTAGTCTGCTGAGCGAGGGGGAGGAGCTGTCTGGGGATGATTCGGAAGATGACGATGACCATGCCTATGAGGGTATCCCCAAGTGAGTATTACCCCACTCAGTTGCCTAAAGCCCAACCTAGCCCACCACTCTACCCCAGTCCCAGCCTGAGCAAACCCTCAGCCTCCCTCCCTGCCTTCCTTCCCTTCTCTTGTTCTAGTGGTGGGTGGCCAACGAGTGGCCTGAATCCACCCTTACGCAGCCTGATCCCTGATCTCCCACTGCACCCCATGGATGAGTTGCCTGGGGGTCCCACCCCCATCACACCTGTCATCAAGGCTGGCTGGCTGGACAAGAACCCACCACAGGGGTGAGTGAAGCCTGCCAGGTCCTTCTAATGTCTGCAGGGGGACAAGCCATACTCCAGGATACTGGTGTCATGGATCCAAAAATCAGAGGGTCCAAGACTGTTTGATCAATTTTCCCTCCCCACACACTGTAACCATTGGTAACCACTGGATGATCTTAACTGTGATAGGAAAGGGGGACTGGGTATGATGGTGGGACCTCTCCCACCTCGTTCCCAGTCTTTGCTGAGCCCTGCCTCTGCCTGTTTAGGTCTTATATCTATCAGAAGCGATGGGTGAGACTGGACGCTGATTACCTGCGATACTTTGACAGTAACAAGGTGAGGGCTCCATCAGTCCCTCACTTGACCCTTGCTCCTACCCAGGCCTAGGCTGAACCCCAACATTGCTTTAGGCAGAGTCCTTAGCTGATCTTCAGTGGGGATCCTGGTCTGTGGGCTGGTGAGGGTAGTGATCAGAGCCAGCACAAAGTCGACCTGCAGAAGACAGGCCTGCAGTCATCATTTCAGCCAACTGGCAAGAGGCTCTAGGGTACCCACTCTAAAATGCAGCTCTTCTCTCCCCAGGACGCCTACTCTAAGCGCTTTGTTCCTGTGGCCTGCATCTGCCGAGTAGCTCCTATTGGAGACCAGAAGTTTGAAGTGATCACAAATAATCGGACCTTCGCCTTCCGGGCAGAGAGTGATGGTGGGAGTTCAGGAGTGTATATGTTTGTGTGTGTAAGTGTGTGTATGAGTGTGTAAGTGTGAGTGTATGAATGAGTATATGAGTGTGAGTGTATGTGTGTGTAAGTGTGAGTGTGAGTATGAATTGTGTAAGTGTGTGAGTGTATGTGAGTGTGTGTGTAAATGTATGTATGTGTAAGTGTGTATATGAGTGTATACATATGAGTGTATGAGTGTGTGAGTATATGAGTGTGAGTGTATGAGTATGTAAATGTATGTGTGTGAGTGTATGAGTGTGTGTAAGTGTATGTGTGTGAAAGTATATGTGAGTATGTAAGTATGTATAAGTGTGTGTGAGTGAGTGTGTGTGTGTGTATGTGTGTGTGTGTAGGGGAGAAGGACCTGTAAGTTGGAAGAGTAGGAAGGGAACAGTGTCCCAGGGAGGCATCGTCCCTGTATGGGGTCTGGGAGGAGAAGGAAGGAGATACTGACCATTGAGCATAGCCAGTGCTCCTTTCCAGATACTCCACAGTGCCACAGAGGCACACATCAGTGTGCACAAGGGATACAGTTTCCAACAGTTGGGGTGACTTGCCCAGTGTAGGCCACAGTAGGTGGCATTGTAAGCATTGTGGCATTGTAGCCTAGGTTGTCCAAGACAGAGAAGTCTAGCGATGGGACAGACCACACCAGTAGGATTCCTAGCAGAGGTGACCTCTGAGCCCCCTAGAGCCAGGAGGCGCCAGGGGCTGAGTTCATGTGTTACCTTCACCCTTTTGCAGTGGAGCGGAACGAGTGGATGCAGGCCCTGCAGCAGGCAGTAGTTGAGCATCGAGCCCGTTTTCGGCTTTCTAGTGCTTCTGTGTTGGGAGTCCGAGGCTCCGAGCAGCCTGACCGTGCTGGCAGCCTGGAGCTACGAGGCTTCAAGAATAAGCTTTACGTGGCTGTGACTGGGGACAAAGTACAGCTCTATAAGAATCTGGAGGTATGAAGGGCTCTACCAGGCCACTGAGGTCTCCCTGTCCCGTACTCATCCGTCCTCTTACCTGCCCTGCTCCTGTCCACCTGGTCTCTCCCTGGTCCTGCTTAGGATCTAAGTCCAGTACTTTCCCTTCCAGCCTTTTCTGCACTGGGACAGCATCTCCCCTCTTCTCTCCTGCCTGCCTGTGCCTCATCTCCATCCTGTCCCTGAACAGCACCCCCCCCCCACGTCCTGTTTCACTCACTCCTATGCCTCCCCTACTGTCATCCCCGTTGCTCTAGTCCAGACTGCTGTCCTGGCTCAGATTCCCGCCCTTCCTCCTTCTTAGGCTCTTTCCACTCCCTAGGGACGACTTCCCTATCCCTTGTCCTGCACCTGAAGCCCTGTTGTCAGCCTTTGCCTTCCTCCCTTCCCACCCACCCATCAGGAATTCCATCTGGGCATTGGTATCACCTTTATCGACATGAATGTGGGCAATGTCAAGGAAGTGGATCGGCGCAGCTTTGACCTCACTACCCCCTACCGCATCTTCAGGTGAGCCCCTGCTCCACCTTCAGCTCATGGGCAGTCAATCCTCTTGGTATTTTTTTCTCCCTTCCATTGCTCACCCACCTGCCTTAGTCTGCCAGACGTCTTCATCCCTCTCCATCTGTTCTGGCCAGCTCTGTTCTCTTTGCCCACCACGCTGTTTATGAGGTGTCCCACCAGCACCTGCAACCCTCCATGGCCTGGGACCCAGGGAACGTCTGCAGTGCCACCCTGCCATCCCCGACTCCGAGCTGTGGGTTCTCCAGCAGAACTTGCTTGTGCTCAAAGCACGTGGGCCTGTTGTCCCTTGAACATCTCCCCATGGCCCTTCTCTGCCTCATGTGGCTTGACACAGTTTACCTCCTTTGCACTCTGCCTTGTCTGTTTCTTCTCTGTGTCTGTCGCCATTCAGGCCCTCTGGTCTCCGTCTCAGTACTCTGGTTGCCAGTCTCAGGGCCTTCACTCTATCCATACTTATATCAGGGTAGTGACCTTTGATCTCAAGAGCTAAGTGGGTGTTTGTCCATCCTCCCATTCGAAATATCCTATGACTTTGGCCCTATAGTTCTTTGCCATAGTCCTTAGTGACCACAAATGCTGCAGCCAGACACTTTAGGGTTTCCCTTTCTGTCAGCTGCAGAAGCCACTGTGCTTCCTGATTACTGTCATTGTCACCAACTTGAAGGAGGCTGATAGAGGTTCAGCAGAAAGGGCTTCCACCGCTTGGGACCACGGGTTTACTGCAGCGGGGTGAGCGTGCTTGTTGCTTATCTGAGGCCCTGGCAGCTTTCGAGTTCCTCTCCTGGCTGTCCTGGTGGAGGCCATCTTCAGCCCCTCTCTTACTCATGGCCGTTACCTCTTGGTCACTCCCATGTGACTTGCAGTTGGTGGTGACAGCAGCAGACAAAGAGCCAGGGGAGTTTTGTAGGAAGGAAGACAATTCTGCATTTGCTGTCTAGATGGAGCTTCCCACTTGAAGAGTCTTTCTGCCTCTGCTGCTGAGTGCTGTTAAAGGCATGTGCTGCTACACTGGGTGCTCACTAATGGACTTCTTTCCGGGATGGAGTAAGGAGGTTGAGGGTGGAGATGGCACACACCTTTATACTCTCTCTCTTCCGTCTGTATATACCCTTGACTGGTGCCCCACTGTCCTAAGGGTGCCCTGTGCCTGCTCTGCCTCTCAGGCCTGTCCCTGCCTGTCTCTCATCATCTCCTCTGCCAGTCTGTTTTCTCTCTAGTTTTCTTGCTCCCTTTGTTGGTTGTTTCCCAACAGTCTTAGGATGACACCTCCTCCCGACCCTCAAATCCCTCCAAACCCTTTCCCACCGGTTCTACTTATGTGTCCCTAGCTTCTCGGCTGATTCAGAGTTAGAGAAGGAACAGTGGCTGGAGGCCATGCAGGGAGCCATCGCAGAGGCCCTATCTACCTCAGAGGTGGCTGAGCGCATCTGGGCCGCAGCCCCCAACAGGTTCTGTGCCGACTGTGGGGCCGCCCAGCCTGACTGGGCCTCCATCAACCTCTGCGTTGTCATCTGCAAGCGCTGTGCAGGTGGGTATGTGTGCAGCAGGTTGGCCGTTGGGCAGCAGGCAGTCTGCTGGGCAGATCCTACAGCCCTTATATCTAACGGTGTGTCAGCATTATTGGCTGTTCTCTTGGGAGAACCTTAGGTCCTCAATTCATGGTTATACTCTCTCCACAGGGATGGGGACACACAAAGAGGGAAAATGCATTTTATTCAGGGCTATCTGGCAAGTAAGTGAGCTCAGATCAGAGCCCAGGCTGTTGGAATCTGATGTCCCTGTCACATCAGAACCATGCAGGAGGCCAGGCCCACCAGGGCTCTTCATGCTGAGAGAAGAGCCAGTGTTTTGTCCAGAGGGGATATAAGACAAGGGACCCAGGGACATACTCAGCGCTGTGGGCCAGACTCTGGCTTATGGGCAGAAGCTGGGATTGGAGACTCCCATCCAGGAATGGGAGTGGAAGCACTGAACCTTCCAGATGGTCTGAAAGTCACACATATGAAAGCCTCCATGGTAACATGGCTGAGGAGCATGGGAATGGAAAACCATGGGGCCCAAGGTGCAGTCATCTATTGACTCAAGCCCTAAGGGCCCAGCATGTGCCATCTGCTGACTGCAGGCTGGGCATTCGATTATCTGAGAGCTGACAGTGCGCAGGTGGTGGTTTGCACGGCCGCAGGGGAGAGGTGGGATTTGATGTGGGAATCCAGGGGAAAGGACAGATCTGAGTGAGTCACTGAGCTTGGAGAATAACCCCTGGGCCTGTGGGACTCTAAGGCAGATGTCAGGCTCTGGGGCCATGAGGTGTGTGCAGACAAGTGGCAGCTTCACCGGCGACCAGATAAGGAAAGTGTCAACTCTCAGAGCTAACACAGGACGACTGTGGCTCTCTGTGGAAGATGGGTGCATGAATGCAGGGCCAGGGCTTCAGTCAGGCAGTGGCGGGTGTTCCTTGTGTCTCTAGCTCCCTTCTCTAGTCATGGGGTCCCTGCTGGGACCTGTGGCTGAGCAAGCTTCATCCTCTGTCTCCAACCTTAGCCTTTCCTTTCCTTCCAGTGACCTTTATTAAATGCTTGTTCTGGGCTCTGAGGATGAAACCTAAAGCCAGGTGGTCAGGATCCTGTTCTTATGCAGTTGCATTGCAACGGGAACAGCAAAAATAACACAGGAGCCTATCAAAATGGAATGATGAGAGGTGGGAAGAGAAAGTGCTGTTTGTTTGGGACATTTTCTCTGAGGAGGTGACATGTCAGCTGAGACCTGAATGACAGGAAGGCATGGCCATGGAGGTAGGGAGGTTGGGAAGAGAGTTGAGGCAGGAAGTTGAAGATGACAGGGGAGAGATAAGGTATTTATATCTACACTGGAACAGCTGATGTGGCTGGAGCAGGGATTGGCACATCAAAGCGGTCTCTTGGTAGGGAAGATGGTCTGGAGGGTCTGTTGTGGCTGGAGCGTAGTGAGCAATGTGAACAGGTTCTGGACCATGCCAAAGTGGAGATGCAGGCTAGCTCCAGGCCTGCCTGAGGAGCAGGAGGGATGAGCCAGTGCTCACAAGGAGGGCTGTACCAGAGTAACTGTATCCGCCTCACCTCAGGGGAGCACCGCGGCCTGGGTGCAGGAGTGTCCAAGGTGCGGAGTTTGAAGATGGACAGGAAGGTGTGGACAGAAGCACTCATCCAGGTGGGGGTGACCTGTGGTTTGTCCATGCCTGGGGTGGGGGTACCCTGCGGTTTGTCCATGCCTGGGGTGGGGGTACCCTGCAGATCATCCATGCCTGGGGTGGGCATGCCCTGAGGTTTGTCCATGCCTGGGGTGAGAGGGCCCTTCGTTCGGATCGTCCATGTCTGAGGTTGCCTCTCTCAGCTGCTCCCCTCCACCCCCACCTCACTGGCCTCAGAACTTTGGAGCTGAGGGAGCTCTGTGATAATCTAGTGGGTGGGGATTTTGGAAAAGCCTGCTTTTAGCAATGTCAGCAAACTGGCTGGTGTACTGAGAATGTTTTTACAGTTTTAAAGGGTTGTTTAAAAAAAGAGGTTTGACAGATTGTATGTGTTCCATAAAACCTAAACTATTTATTATTTGACCTTTTAGAGAATTGCTGACCCCTGATATAGTTCAGCTGTTGTCCTGATGTGGAGACTGGAGCCCTGGGTTGGGCTGTAATGGGCCTGAGGTTACCTAGCCTCTGCATATTAACCACTCAGCCTGCTCCTTCCCACCCCATATCCTAGCTGGGCTGGGAGTTCGCCACTGTGCACACCACTCAGAGCCTCTGAGCTCTCACTGCACCCGAATTCATGTGCACAGGGTATATAATGCATGGCTTGAGGCACACATATGTACATCTGTTTATACCTATGCTTTAAACTTCTCTGGTACCCGTGTGTGATTGTTGTTATGGGAAACCTGCAGCAGGAGGCCGGACCAAGGGACCTGGCACTCAGAGCTTAGCTGCTAAGTTGGGAACTTCATAGCATATCCAGTTCATGTGCCCACACTGTGTTCAGTATAGCACTGCTGGGAACACTGCTTTTGTTAATGAATTGTCTTTTAGAATAATCCTGAGATAGGATTAGAATACCCAGGATACAGTTGAGAACATTGAGGCTGAGGCCCAGGGAGGAAAACAAAACAAAGCAAAACAAAGCCAACTCTGATCGGGTGCCTAGTGGCAAGGAAAGTTTCTGCTTTGTCCTCTGCTGAGACTCCAGCACTCTAAATGATTGGGTGGGAAGCCCAGGAAGTGCCTGTGACAGCCTGATCAGCAGAAGGGAAAAGTGAGCTTGCCCTTAATGCTGCCCATCCCCCATCTTCTAGAAACTGCCACCCCTCTCTCATCCAGAGAGGAATGTTAGGAACAGATAGACCCCAAATCTCTGCCTGCCTAGCCTATTGGCTGAAAGGTTAGACACCACTCCTCGCTGGGACAGTTTCAGGAATGCAGAGTTCCAGATGTGGGCCTGGGTGAGACAACAGAGAGGGCCCCAGAGACCAGGCCTCAAACGTTCACCTATCAGACTGTCGGAGACAATCTGGGCTCAGAGCCCAGGCCTTGAACAAGAGTACGGTGGCCATCAGCAGACCCAGCTGCTCCTGACCTCCCCTTGGGGAAAATGGGTGTGTGGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTCAGGAGTTGCTGCCCCTCTCACCTCTTGCCCGTACCCACAGCTCTTCTTACATCTGGGCAATGGCCCCGGGAACCACTTCTGGGCTGCTAATGTGCCTCCTAGTGAGGCCCTGGAGCCCAGCAGCAGCCCTGGTGCCCGGCGGTATCACCTGGAGGCCAAGTACAGAGAGGGCAAGTACCGCCGCTACCATCCGCTCTTTGGCAACCAAGAGGAACTGGACAAGGTCAGCACACAGAGCCTCTGGGATTCTTGAGCCTTCTTGTCCCTGCATTATCCCTTGAACCCATCTCTTTCTTCCTGTGGCCCCATTCCTCCCTCTCAACCCATGTCTTCCATCCGCTTAGAGGGCTGTGCATGTGTGGGGAGATTGAGGCCCACAGGGCAGTAGGGCCTGCCTAAGGAAAGCTGGAACAATGTAGGGAGGAGTCAGGCTTGGTTCTTGGTCCAGTGCCATGTCTTCAGCATCTGGCTGCCTCCTCCTGATTCCTCTGTCTCCCGCACCCTGTCCTGTTCTTTCAGAATCCTGCCAAAGGAGTGAACTTGGTGGGGATGCTATTTCCTGTCAGGCTCATGAAAAACAGCTGGACCACTCTGACCCACCCCATCCACGCCCCATTCTAGATGAGGCCCCATATGGGCCCCAGGCCCCAGAAGATTGGGAGCCAAGTCTTAGACCCTGATCTGGCTCAGACCGCTTGCTTAGAGGCAGCAGGGTAACATTTGTAACCTGTGGGCGGCAGTCCTCAGCTCTTCCTCCAAGCTGTCCTATCCAGGCAGGCTGAGTCTAGCCCCAGAGTTGTCTAGAAACCAGGCCTCCACCTCCCCAGGACCCAGGCGTCCAGCCCCCAGTTCAGCCCAGCCCAGTCTGGCCTAAAAGCCAGAAGGGTGGTGGCTCCCATTGGTCGGGAGGGCTGGGCCGGCAGTGAGGAATTCAAATGTGGGAGGAATTAGCTACAACCCCTCAGCTCCTCCCTCTGCCCCTGCTACAAGGCAGAGGGAGCCTGAGATCCTCCAGGGGCTCCTTGTGCCCTGACCAGCAGCTGTGCCTCAGGACCCACAGGGTGAGGGCCTGTGGCTAGGACCCCAGCCTCAGCTGGGTAGCCTCTGCCCAGCCTCCCTGGCTTGCCCTCCCCTCTTCTTTTTCTGACTCTCATGCCTTTCTTTTCTTCTCTTCTGGCTTCTTTAAGCCCTGCTCTCTTTCAGTCTGAGGATGGTCCATGCAGGTTTGAGTGACTCCTTCCCCTTCCCTCCTCCACCTCCTCCTCCCATCCCTACCCCTCCACCTCCCACTCTTTCTTGGATTGATCTCCCCCACCCCCTCCTCTAGGCCCTGTGTGCTGCAGTTACTACCACTGACCTGGCTGAGACCCAGGCACTCCTGGGCTGTGGGGCTGGGGTCAGCTGCTTCTCAGGGGACCCAGCAGCTCCCACACCCCTGGCTCTTGCTGAGCAGGCCGGACAGACTCTGCAGATGGAGTTTCTACGGAATAATCAGAGTACAGGTGAGTGACCGGTGGCTCTGTCCTCTGTAGCTGGAGGTCCCTGCTGGCAGGGTCTGGTCTTTTGGAGAGTTTTATAGGGGTGTCAACAGGAACCATGAATCAGCTGAGAACCTGGATTTGTAGGCCACTCCCAAGCTGTGATTCAAGTTCTTGGTGGTCCCTGGGGCAGTAAGCAGCATGATACTTGGGACAAGTGTGGCTTATGGGTCAGTGCTTCGTGTGAGTGGCCTTTTTTGTCTGTATCTCTGTGACTGTTGTGTGCTCTGTCCTGACTTAAATGTGGGTTCCTAGTGGAGCTATCTGCTCTAGGAAGAACCTTGGAGCTGCCTAGGTTCTCTTTCCTCATGTTGGTGATGCTGAGGCTTTGGGGTTTGTGTATGTGTAGTGGGTCTGTGTTGCTGTGGAGGAGGGTGTTGCCATGTGTGTGTGTGAACTACACAGCAGCCTTGTCGTCTGTTTGCTCAGTCTGGGTGGAGTTCCATCATAGACCTGGGTTGGATCCCATTTGGCTCCTATTCTTGGGATGGGTGAGGAGGGGGTCGCTAGGGTGAATGCGTCGGTTATGGCCCAGGCCAGGTCTCTTGAGGCCACATCCTAAGGCAGAGGGTGGGGCTCAGCGGCTGGGGCTCTGGGCCTTGGGCCATGGGTGGGTGGGGTGTGCTGGGCTGGAGAGAACCCAGGTGTCTAAGGGAGGTGCAAGAGACCACCCAGCTGGCTTGGACTACGGGGGCAGGACCCCTCAGTGCTGAGCACTGAATCCAGCCTACTTCACTGGGCTTTGTGCTATCTGGGACAAACCTCTCTCTAGGGACTACTATTGAGTTGGCCCAGAGCCCCCCTCATTCTAACATGCTTGGCTCTATGCCTCCAACAAGCAGTGTGGGGTGGGCTTGGGAGTCATGGAGCCTTCTTAAGATGGGTAGGGCTGGAGCTGGGCCCTGAGAATGGAGTGACATTTCCACTGGTGAGCAGAGGTTGAGATGTGGCTTTTCAAAACCCTGAAGGTAGCAGTAGGAGCCTGACGGTGCTGGTAGGGAGCTGAGGAAACAGGGCTGTGACCATGAACCTAGGTACTTTGCCCCAGGGGGCATCTGGAGAGGGCACCACCTGGACACCCAGTGTGCCACTACCATTCTTTCTTCCACTCCAAAGAGGTCCCTCGGTTGGACTCAGTGAAGCCCTTGGAAAAGCACTACTCCGTTACCCTGCCAACTGTGAGCCACAGCGGCTTCCTGTACAAAACTGCTTCTGCCGGCAAACCTCTGCAGGACCGCCGTGCCCGGGAAGGTGAGTACAGCATCTTACCCATCCAGGCCTATGGTGTGTGTTAGCCTGGCTGCAGGGCCAGCAAACTAGGGCTGGTCCTGCTGGAGGACCTGAGGGTGCCAAGTGGACTCTAGCAGAGCCACTTGGAAAGTCTTGGATACGGTCTCTTGAATACAATGAGTGCTTGAGAAATAGGCTAATCGGGGTGGGACATGGAGATGGCACCACCGGGGAGCGTGAAGTCCATATGGAGCCCCCGTTGGGTGTGGCCTTGTGCTGAGCAGCTGGCATATTCCAGATGTGGATGGAAGGCGGTTTGAGGACTTGAACTTGAGTGCCATCCCTCTCAGATCTCAGTTGCCTTCCATTTACTCCCTGCCTCCAAGTTCAGCCTATAGTCCTTGCACATCACCCAAGAGCTACCTACCTTCCTATCCGGCAGACTCCCCTCCCTGGATTCTGCCCCAGCTCTGTGGCTTTGTCACACAAGCCAGATTTACCTACCCCCACCAGGAATCTGCATATGCTACTGTCTGCCCCAAAGGCTTTCCCCAAATATCCCTTAAAACCTCATGTCTTTGGGGATATCATGTCTTTCCCAGCCACTCAATACTGTGCCCCCTGTCACCCCCAATACTATTTTTTCTCTTACTGTTCCATCTGATTTTTATTCTTATTTTTTTCCTCCAAGATAAAGTCTTTTTGCTACCCAGAGCCTGACATTGAACTCCTGGGATCAAGTTTCCATCTTGTCTCAGCCTTTCCAAGTAGCTGAAATTATTATAGTAGATAGTGCCACTATAGCCAGCTCAGTTGTCCTTTATTGTATACCTCTGTATACATGGTACCTGGTACCTATTGTAGCCCTAGCACCTGGGGCGCACTGGTACCCACTGGTAACGTAGCATACATCTGCAGAATGAAGAAGACCTCAGCAGGCTAGTGTGCTTCTCAGAGCACATCCTTGAGGACAGCCTTGGAGTCACATGGTTCTCACGGACAGGATGAGGGACAGCAAGCTGGAGGAGCAGAATGCCCACTGCTTACAGCCTCTCTCGGAACCCCTTCTTGGAGTCCCCCAGATACTCTCTCTGACAGTACTCTCTAACTCCTAGATGGTGTAGCCCTCTGCTGCTCCTGGTCAGTTCCCTCTGCCTGATGATGTCATTTATGGAACCCCTCTGAGTCATCCTTTTCACCCTGAGTGCCAGGAAGCTCTGAGCCACTGTGAGGCTGGTGCCGTAAGCTACAGTCGCCTGCCTGCCTGGCTTTGGTGCTCTGCTCTCTTACCTTTCATGGTCCAGGTTCCCATTTCTGGTTCTACTGGGGATCTCGTGTATCTTCAGAGCCATTGTAGGAGGAGGCAGACTATAGAGTGAGGAGTGTATCTGGCAAAGGAGACGGGGCACAGGGTGGGTCTTAGGGTTTTACTGCCGGGAAGAGACACCATGACTAAGGCAACTCTTATAAGGACAACATTTAATTGGGGCTGGCTTATAGGTTCAGAGGTTCAGTCCATTATCATCAAGGTGGGAACATGGCAGCCTGCAGTCAGGCATGGTGCAGGAGGAGCTGAGCGCTCTACATCTGCATCTGAAGGCTGCTAGCAGAAGCAGCTAGGATGAAGGTCTTAAAGCCCACACCCACAGTGACACACCCACTCCAACAAGGCCACACCTCCTAATAGTGCCACTCCCTGGGCCAAGCATATTCAAACCACCACAGCTCCCAAGGCTTCCTGTACAATTGAAGCTGTAGGTAGAAGGAGCAGCAGGGAAAGAAGCTAAGAGTAGCCAAAGAGACAGACAGAGGCAGACCTAGGCTGAGAGACACAGGTTGCCCTGATGATTGACAGCTTGGGACCTAACATTTAAAGAGAAGTGGGGTCAAGACTCAGTCGTTCCTGGTCTCCAAGCTGGAGACCAAAAGTTCATATCGGCTATAGGGGAGAGTTGGGGACTAGGTATAGAGGGCTGCAGCTGGGGGAATACTCAGGTAAGTGGTGAGTTAAAATGAAGAGC
D3_15 108547046 108562095 15050 CAGGTCCACACAACAAAGAGACTGTAAACATTGACCTTAGCTCATGAGGCTGCAGCCCAAAGCTGCTCGTCCACCTCTTGGGAATCAGGGCAAGGAATAGAGAATTAATGGGGGAGGAGGGCAGGCTGTGCTGGATGAGTGAATCCTGATTTGTATATTTGTAGCTTTGAGCACACCTTTGAGGTGTACACAGAGGGAGAACGGCTGTACCTGTTTGGGCTGGAGAATGCAGAGCTGGCTCATGAGTGGGTCAAGTGCATTGCCAAGGTAGGCCTGGGTTAGGAGGGCAGGCGTGTGATGGAGGCAGGGCGGGCCCTCTGGCTGAACCCCATGAACTCCAGTTCTTCCATCTCTGATGGAGAAGGAGCCAGGCGTGGGTATAACAGACTCAGGACAGACCTCTCAGATCAACGGCAATGCAGATGTAGCCCTCTGGTACCTAATGGATATTTGTTATGAGGAACATGTTTGGGAGGGTCATTGTTTGCAGGTGTGCAATTAGGCTAGATGGGAAGGCAGGGAGGCTACAGAAGAGAGGGCTGCCTTAGAGACAAGAGTCAAGAGCCAGCCCTCTTGTGCTTTGAGAGCCTGGGGCTTCATTCCTCATTGGCTCATTTGATGAGCTCTCAATACCTTCTGAGGATCAGTGCCCAGGGCCCGGAGGACCCGAGTGTACCAGTGCTCTGTTGTTCCAGTGGGAGTGCGGCAGACAGGCTGAGTCTAGACACTATGGTAGCAGATGGTGAAGTATATGGACACTGGGAACACAGAGAAGGACACATCCAAATGGGTACAGAGGACATGGTCCCAAAGTCCTCTGTCACTGTGCTATGCTCTGCCTTGGGAAGGAGGAAGTAGTTAGAGGGAAAAGAGCCCTTGCCCACAGGGTGTCTCCAGCAGGCTGTGCTGTGCTTACATGCTCTCTCCACTATTTCCCCCCCGACTAGGCGTTCGTGCCTCCCCTGGCTGAGGACCTGCTAGCCCGGGACTTTGAACGTCTTGGGCGCCTACCCTGTAAAGCTGGCCTGAGCCTTCAGCAGGCTCAGGAAGGCTGGTTTGCCTTGACTGGCTCTGAGCTCCGGGCTGTCTTCCCAGAGGGGCCCTGGGAAGAGCCGCTGCAGCTCCGGAAACTGCAAGAGCTTTGTATGTGGACCTTTGCTTAGTTCCCCAATCTCTAGGATCCCTTGTCCCAGCCCTGCCCCACCCCCACCCCCCACCCCCACCCCCTACCCCCCAATCCCCTAGTCCTTGTCTGGAAGTCTGAGTTCTATTATGGCCTGAGCAGATGATCCAGCCTCCCCTCCATATCCTCTCCTGTCCTTGAAGTACATCTCAGCAGCCCTTTAGGTTGGTGGGTGGAATCTAAGGGTGAGACCCAGACAGCCTCAGGAGGGAGCAGTGTATGGGTCATGAATAAGGCCTGGGCCTCACCTTGGCTGGCCCCTCCATAGCTATCCAAGGAGACAGCGAGAACCAAGTGCTGGTGCTGGTGGAGCGGAGGAGGTGAGCCTTGGCTTCCCTGAGGATCCTGGAGAAGCCTGAGGGCAGGTGGGATACAGGGGCAGGCAGGTGGGACAGTGACTATCTCTGCTCCAGGACACTGTACATCCAGGGTGAGCGGCGGCTGGACTTCATGGCTTGGCTAGGGGTCATCCAGAAAGCAGCAGCCAGCTTGGGAGACACACTATCAGAACAACAGCTTGGGGACTCGGACATCCCAGTGATTGTGTACCGCTGTGTGGACTACATCACGCAGTGTGGTGAGCCCAGCCTCCAAGTCCCAGCCACCCCTCTTCTCTAGTGATACCCAGACCCCAGTGCCCAGGATCCCTCTAAAGAGTGGTTTAACTCCCTCCCCAGGCTTGACCTCAGAGGGTATCTATCGAAAGTGTGGTCAGACCTCCAAGACTCAGAGACTGCTAGACAGCCTCCGGCAGGACGCACGCTCTGTGCACCTAAAGGAGGGAGAACAGCACGTGGACGACGTCTCCTCTGCACTCAAACGCTTCCTCAGGGACCTGCCCGATGGGCTCTTCACGCGTGCGCAGCGCCTGGCCTGGCTGGAGGCCTCTGGTGGGTCCTGCTGCCTGCATCCAGCCCCATCCACCCTACCTACCTCAGGATGTCCCCATCGTACCCTGGGCAAGGCTTGCCCCAGCTCCTCCACCTATTCTGCTTCTAGGTCCTCTAGTCACTATAGAGAGGGAGATGCTCAGAGGTGGAGAGTAGAGCACTCCCTGTCCTGATAGGTGTCTGTGAATGATGCCTCCATCCTGAGAGGCAAAGCTGTTGGGAGGGGGCATTGGTGGCCAGTTTCTAACCCAGTCCATCTCTCCCCCACACACACCCAGAGATCGAGGATGAGGAAGAAAAGATCTCCAGGTATCGAGAGCTCTTGGTGCATCTGCCCCCTGTCAACCGGGCCACTGTGAAGGCCCTTATCAGCCATCTGTACTGGTGAGGGCCGTGCCAGAGTGAGGCTCTGGGGAGATGGGGGTCGGGGGAGGTTCTTCTACTCCCAACCTGGCTCACTGCCCTCTCCTGGGAAACAGGTGGGTCTGGGGACCACCCAATGATTGCCCTGATCTTGGACGTTGTATCTTAGCTTACGTCCTTCAGGGTAAAGGGGAGAATGAGGTATTTGTCAGTTTTGGGCCAGGTTACTGAGGCCAAATCTTGCTCCCCAGCTCTGTGCCTTGCCAGGATGTGAAATGTTTCCCTTTCACTCCTTAAAGTGCGGTCTACTCTGACCTCTTTGACCTCAGTCCCTTGGCTAGTCTTGCGCCTGATGGGAACTAGGGAGGTGGCTGGGAAGCTCTGGACCAGGCTCTTTAATTATCAGTTACCTGTCTTTCCAGTGTACAGTGCTTCTCAGACACAAACCAAATGAACACACACAACCTGGCTATCGTGTTTGGGCCTACACTCTTCCAGACAGACGGGCAGGACTACAAGGCCGGCAAGGTGGTGGAAGACCTCATCAACCACTACGTGGTGGTGTTCAGTGTGCGTCCCAGCTGGGATTGGGGGTGAGGGGAGGGGTGGGCAAGGCTAAGCCTCTCAGATGGCAGTGACAGCTGACCCTCCCCAGGTGGACGAGGAGGAGCTGAGGAAGCAGAGGGAGGAAGTCACGGCCATCGTGAAGATGCGAGTGGCTGGCACTGCCAGTGGGACCCAGGTGCAGGCCAGGGTTTGGGAAGGCTTGGGCTGGTTGCCAGCTCTGCTCCCAGACCTGTAGCTGAGCCCCATCTCTCCTGCAGCATGCTGGCGACTTCATCTGCACAGTCTACCTGGAGGAGAAGAAGGTGGAGACTGAACAGCATGTTAAGGTGGGGGCTGTTGAGCCAGGCTGTACCAGGGCAGACATAGTCACTTAGAGATGTGTGAGGTTCCCCAAAGACCTCTTTGCATCTCGGGGCTCAGAGGACCTGATGAGGAATGGGTTTGGGGGCCAAATTACAGGAGATTGTGGCCACATAGAAGCTGGAGATGCATTTGGGACTGGCTGATCTTGTGGGTCTGTGCAGATCCCAGCATCCATGACTGCAGAGGAGCTTACTCTGGAGATTCTGGACCGCCGCAATGTGAGCATCAGGGAGAAGGACTACTGGACTTGCTTTGAGGTCAACGAGAAGGAGGAGGCAGGTAGGTGGCCATGGGCTGCCTTTAGCCCAACCATCATTTCTCCCGCTCCCTGCCGTTTGGGAGCCAGAGGTTCTAGATGACACTTTTTGCTGGCTCACGGATGAAAATTGTGGTCTCCATGCTGGTGGTGACTGGCAGCTGGCAGGTCTGGGTGACAGTGCCATCCAGGTGTCAGAATGGTGTTGCTTGCGGAAGGGACAATGCTGAATTCAATGACAGGATTGTAGAATGATACTATTGGGGTAAAGAGGGTGGTGGATAGTGATCATGCAAGCAGGTGGCTGTGATGGGGGAGCCTGGCTGTGGTGGTGAGTGGCCAGTTGGGGCCTTGTATGGTTGAGGGAGCCATGTTGAGGTGAGAGGTGGGGATGTTGCTGATGCAAGCGTCAGCTGTTTTTGTTGAGTGTCAGTTGCTAGACTGAGGACCCAGGCAGTGGTTAGTCTAGTAAGGGACAGAGATGCTAATACCATGATCACTCTAGGAAATAGACAACTCCCTTGGTGTTAGTTAACTGCTTTAAAGGAAAGGCCCATGTCGTCAGCAGAACCTATGATATGGTCCTGGGTTCTGCCTTTTCTCTCGGAGTATCCAGATACCAACCGTACACTGGCTCGGAGAGGACAGAGTGAAGTTCAGAAGAGGTGGGGTCTGCGGTCTGCCTCTTCCCTTCGGAGTGTCAGATGAGCAGTCTGGGCCGAGCAGGGTGTTGGCCTGGTTGGGAGTGAGTTAGGGCAGAGCTTCTTCAAAGATCTTAGTGTTAAGGCTCTTTTAGATGCAGGCCTTCTCCGACTATCTTTAATGAAGTAGCTCTCTAAGAAGATCTTAGCTTGTTTATATTTTTTATTGGGGGTGCATCTGAACTTTATTTGGGGGTGAACCAAGTGTTATATAGTTTGGGGGGGTGAGAATATCCAAGATGCGAAAAAGTCACTGGCTGAGAGCTAAGATACTAAGATACCTCATTAGCCTGGAGAGGTGGTCTAGGTGCTGTTATATGATTGGCTGACTGCCTGTGACCACCTGATTGGGGGTCGCTTGGTTACAAGCTCTGAGACAGGCACGAAAACAGGGAAGGAGTTAGGCAGTCTCAGGATGAGATTCTAGTATCAGTTTTTTGAGATTTCCGGGGTTTGGACACCCTCTGCCTCACCCAGTCCATGCCAATTCCTCTGGTGGCATGGTCCACATGCCTGCCCTACACTATGCAGGGCTGATGGCTTTGGAGTGCCTTAGCCTGCTGTGAGGAAGAGTAAGGGCTACTTGGTAAAGACAGGACAAGTGATCCCAGAAACAAGACCAGCTCCAGCACCAGGCTGGGCCTTCCACGGCCCGAGGAAACCCAGGGTAGAATTGGAGGTGGAGTCAGCCACCCAGGGCCTGGTGGGGCTGCGGGGCCATGGGAGGGCTAGTAACAGGGCTTTGGGAAGATGATGTTTGCTGCTAGATTGGGAATGTTTGACAGGTAGAGTACATGCTAGAGGCCATTTGACGGTCAGACTGTGCGGGACAAGTACAGATTTGACCCACAAGTGTGGAAGGAGCCGGAGTATTTCTAATCTGAGCACAGGCAGTGTTTGTTGGGGACACCTGGGTGACAGTATAGCGTTGGTTTTGGCTATGAGCAGGTATGACAAGTCAGAAGCTAGCTTATAGGAAGGGTGATCATGATGGTGGTGTGTCACCATGCTAGTGGACGCTGAGCTGTGTAGGTGACATGTGTCCATTTGCTTGCCCTTGGTGGTACTAAGTGGTGTGGACCCAGTGACAGTGGTGTGGCCTCTCCACAGAGCGCCCGCTGCACTTTGCAGAGAAGGTGCTGCCCATTGTCCATGGGCTGGGCATAGACAGCCATCTGGTGGTGAAGAAGTACCAGTCCATGGAGGCCATGCTGTTGTACTTGGGTAAGTGGCGTCTCGGGGAAGGGGATGTGGGGTGGATAGGTACCTCCATCTACAAGCAGGGTGGGAGCTGGTGGCAACAGGACAGAGCAGGTCAGGTGGAGGAAACTGGGGGGCCTCCATGGGGAGGCTGGGACATGAGGTGGGGCACTGGAGTCTGTAGGTTGGGCAGTGTAACCCATGCCCACTCTGGACCTCCCTTAGCCAGCCGTGTGGGTGACACCAAGCATGGTATGATGAAGTTCCGTGAAGACCGCAGCCTCCTGGGTCTGGGGCTACCTTCGGGTGGCTTCCACGATCGCTACTTCATTCTCAACAGCAGCTGCCTACGGCTCTACAAGGAGGTCCGGGTAAGCCCTGTGATGGACATTAGTATCTCCTTTGTGCTCAGACACTCACACGCAAGCATTGTCCTTGGTCTGCAGGAGCGAGGTCCTTGTCTGAGGGTCTCGGCAGCACCATGACTGATGATAACTGTATATTCTCCTGCCGGGACCCTGAGTAGCCACTCAAAGCCTCTATCCACGTGAGGCCTTACGTGAGGCCAGGACATCATACACATGCTCCCATGTTTCCCTGTGCCTGTGGCTTATCACACTCTCATAAGAATGTGTCTGTTCCATGGCATCTATTTTGAGTTGTGCCCAATCCTGCTCCGCCCCTTCCTAGGACACAGCCCTCCTGACCTACTCTACCCCCATGCCCAGTGGTCTCCTAGACCACACTCCTTGGCACTCCATTCTTCTGTACACAGATGCCCTGCCATCCCCCTCTCCCTTGCCCTTCACACCACTACACAATGTCCTGGCTCTAGACTGGGATGATGCCCTCCATAACCCTGCTCCTCTATCAAACAGAGCCAGAGGCCGTGGAGCGGGGCCCCTGAGACCGTGAGTAGCTGTGGGCCAGCTGCCAGCTGCCTTCCTTACACTACCTGGGGCCAGGCGAGCAGGGTAGAGCTTGAAGACACCATCAGGGCTCCCAGTTCTCTCCAAGCATGGCTCCCTGTTTTCCTACCAAGTCACTGGCCCCTACCCTGACCCAAGATCTTTTTCTCAATATAGGGTCCCTTGTTGGTGTGATGCTAGAATTTTTCGTAGTGCTCAGAGAAGTTTTGGAGGCAGTATTAGAGACCCAAGTGTGGGTTAGGACTGGTTCATCTCCTCTTACTGTCAGAGCTCCCCACCTTCCAAACCTAGACAGAGTGCTGGGGCTGTCCTTGACCCTGTTGGGACACAAGGCTGTAAGACATTCTCTCTCACGGGTGGCTGTGCTTTCCCAGCCTCCCTAGCTGGTGGCCCAGCCTTCCTTGGCCACTCCTGAGAGACCCTCCATGTGCCTCTTAGGGCTGCCCAGCCTGGCTCTAATGTCTGGAGGTTGCCTCTGGCTCAGGTTCAGCTGAGAAGCACCGTCTGTGGTATACCGTGGGTACCACTTTTGCCACAGGGCACACAGAGTGTAGATGGTTCTGCAGGAGAGCAGTGGAGGCTCGATGCCAAGCACGGTGTTCTAGCGTGAGGTCCTTCAGTGACCCCGTCGTGGTCTCCAGCCCTTTCTTGCCTCTTGCATCTCCTGAGCATGTCTGAACAGATCTTGCTGGCTGCCATGGAAGATCAGATGGAGGGAGCAGCATCCCCATCTCCGTTTCTTTGTGCATTGTACCTCTGTTAATGCTGCCTGGACTCCTGGCAGGCACTCCCGTTTGTCCTTCCTCCTGTGGATCTCTCACTTCTGAACCTGCTTCTAGAATTTTCTCCCCCCTGGTCCTCCTTCTAGAGGCATTTCCTTAGACTCACGGAGCAGAGTGAGGCCACCTGTATAGGTAGAAGGGAAGGAGGGCACCTGAGGCACCCCAAAAGGCAGGTGCTAGGCATGGAGAGGTGGTCTGATGGTTACTGAGCAGGGCTTGGCATTTGTCCCTACTCCTCTCAGAGCAGGAAGTTACCTTTCCAAGGTGAGAAAGGGCCCAGGGACTTTCCCAAGGCTACTTTGCTCATGGCAGGCTAGGATGTAGGCCAGTGTTAGGGTTTGTCCTCTGTCTGGTGTCCTGGCAGTTTAGAGCTCCAGGGTATAGCAGGAAAGCTGCCAACTGTTAACAGGCAATGCTGTCATCTCGAGGCCACTGAAGTGTTGATGATTCTGACATCAGTTGGCTTATGGGGCCGCAGGAAAGAATATTTGAAATTAGAATAGTCTCATACCAAGGAGACTCTGTGGCCTCTCAGTCCCCATCCCAAGACCTCCTGCTGTTTAAGACTCTGGAGCACGTGAGAAAGGCATATTCTAGAAAAATCATGGTACTAGCATGAGGTACCTGAGTACTGAGCATAAATTTTATTTCTTGGACATCAGGGTACCAGAACCCTGAGCTGCTTGAAAATATAGTTCCTATATAGGAGTTAGTCTCTTCTCTGTGTTTCTGCCTACCCTTCCCCCACACTGTCCACCAGTCTCCTGCCCTGACAGGGACTGCCCAGGACCTTCTGCCTGACTTCTTCCAGCCCTTCCACATTCCATTGTCTTTGCAGGGGCCTCTCTTCTCCCAGCCTGCATCCTGTTCTGTCTATCTCCCATCCCTTCGCCCGTGTCCTAGTGTGCAGGCTGACTTTTTCAGTGCCTCAGCCTTGCCTCTGCCTGATGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGCGCACGCGCATGTGTGCACGTGTGTATATGTGTGTGTATGTGTGTGCACATGTATGTGTGTGTATGTGTGTGTGTGTGTATGGACGTGTGTGTGTGTATGTGTGTGTGTGTGAGGTCTTCCTCTCGGTGTTCTGCCCCCCCCCGTCCTGCCCCCCCCCCCAACCTTAGCTTTATTGTCCGTCCCACATCTTGATCCCCATTCTGCAGCCAGTGGTCTAGGCTGTTTGGGACATGTGATTATTGGGTGAGGTGCTCTATTTGAAGAGTTGGGGCTCCTTCATCCACCAGATCCACCAGGCCTTAGATCTTGACATGTTCTCTGGCCCACATCCCTGAGGTGACACAGAAGGACCCTCTAGTTCTGAGACAGATTATCCATTCTTCTCCTGTTAAGGAGCCATGCCTGGGGTGGCTGGGAGCAATGGTGGGGAGGGCTCGGTTTTGGAGCCTCAGTTGCAGTTGTAAGTACATCTCCCTCCCCTACCATCCTCTCTGGTACCTCTGATGGGTCCAGGGGAGCCTGGTAAGGGGAGGAAGGAAGCTAAGCAAATGGCTCCCACAACTGGAAGAAGTTCATTAACCTTCAAACAGTCTCTTCCTTGAGGGTCATTGCTCGTGTCCCCTCTGCTTTCGAGCCAGCCTGCTCCCACCAAGCCTAGACCCATATATGCAGAGGTGAGGGCCAGGCAAACATGTCAACAGTCTGGTTCCCCACTCTGGTCTATGGGTCTCTTGCTTCCTGCCTTAGACCATTGGGACTTCTCCCTCTGGCCTATCATGCAGAATACCATGCAAGCTTCAGTGTCAGCCATTGGCCTTCTGATGGGGCCAGATGCTAATGATGGCCGGTCCCCGAGCTTCCGTTCACACAGTCAACCCTGGAGCCTCCACAGGCAGGGGAAGGGAGCATGATGAGTGACTGAGACAAATGCAGACCCTAGTGGACAACCTTGAAGGCACTCTCACAGCCTGGGCCTGCCCCCGTGTGCTGTGGGGGGAAGTCAGGCCTGTGACTTCCAACCTGAGTCTCCAGTTTGACAAGCGGCAGGGTCTGGGAATCATTGCCCTGGAGCTCCCAGCTGGAGTGTCATCTTTGGGGACTGAGGGTTGACTGTCTGATGCTACTGTCATCTTTGGCTGGACAATGAACAGGGAGGGCTTTGGTGAGAAGGCTTCCTGGAGGAGGAGCCCTGTTCCAGAATGCCTGGGCGTTGGGGACGGGGGAGGGCAGTATGCCAGTGGAAGAGCTACTTCTGACTCTACCCACCTGACTGATGGAAGTGTCTCCCCCCACCCCCCAGAGTCACCGGCCTGAGAAGGAGTGGCCTGTCAAGAGCCTCAAAGTCTACCTGGGTGTAAAGAAGAAACTGCGGCCACCTACTTGGTAAGCCAGGACTGAGGTGCCAGGCCTATGGCTAGGATCTGTGACATCAAGAACTGACAGGAAGGCACAGCGGGGTTCAGAGCTTTATAGGGGATAGTGTAGTGGTTTTATAGTCGGGGTCCTCTCGGCTAGTAGCATCACCGAGACATACCTTAGAAGTACAGTCTTTCAGGTAACCCCTGAGCTTCCTGAGTTTGGGGTGCTGTAGTAGGGCTTGGGGCTCAGGGCTCAGTGTCTCCTCGAGCTGTCCAGGTAACAGAGTGAGTTTATGATTTGGGGGGTTGGTGTGTTTTATGTGTGTGGTGCAGGCCAGTGAGTGTCTGGGTGCATGTGCCTGTGTGTGCTCATGTGGAAGCCAGAGCAGGATTTAGGGTGTCTTCCTCTGTCACTCTCTGCCTTATTCTCTTGAGGCAGGGTGTCACTGAAGCTCACTGTTTCAGCTATAGGTGTCTGGTCAGTGTGCCCTGGGGGTCCACCTGCCTGTCTCCGCTCTCCAGTGCTGGGGTTACAGGCACCCACGGTTATGCCCAGCTTTTTATGTGGTTGCTAGGGATTTGAACTTAGAACCTCATGCTTGCAGAGCAAGCACTCTTATTAAGCGGTCTCTCTTAGCAAGTCGAAAAGCAATGCGTGCCACTGTGACTGTTAGGCACCGCAGTCGTGTGACTTGATTTGCTAACTTTCTCATCTGCTGGCTGTGCCAGGCTACCTCTGGTTCTTGGGTGGGCTTGGGCAGACATCAGCACAGTTGGATGGTTTTTTTTTTTGTTCTTCAGTGGTGAGGGTAGAACTCAGTAACTCAGGCAATGCTAGACACACGTACCACCCCCAGCTCAGGCCCTGCGTTCAGGTGGGGAGAGAAGGACACGGGCCCTAGTGTGCTGCACTGGGGGAAGCTTTGGCCCTTCCCTGCCCAGGCTTCTGGGCTCTGTCCCACAAATCTTTGCAAGTGCAAAGTGACCCCTTCTCTGGCTCTCCCTGCAGCTGGGGCTTCACGGTGGTGCACGAGACAGAAAAGCACGAGAAGCAGCAGTGGTAAGCCCTGGGCCCGGAGGGAGACAGGCAGGATTGGGGCCTCCCTCTCAGCCTATGAGGAGACAGGGAGGCAGAATGCTCGCTCTCCAAGGCCCTCGGCGGCAACCCGATCTGTGCCTTTTGCAGGTACCTCTGCTGTGACACGCAGATGGAACTTCGAGAGTGGTTTGCCACCTTCCTCTCTGTGCAGGTACCGGCTGCAGGGGGCTTCTCCAGAGGCTCCACCATGGAGAGTGGGGACAGCAGCAGAGAAATGGTGGCAGAGGAATTAGGTCTCTGGGCACAGGGATATTCACCTGGTGCAGAGTGGCTTCCAGGAAGAGGAAACAGCATATCCAAAGAAAAGGAAGGCTGCTTATGAAATACAGAATTTGATTTTTGTGTTCATGGTTCCACAGTGTTAGAGTCCCCATCATGGTGGGGAGCGTGGCAGTAGTCAGGCAGCCATGGTGCTGGAGGAGCTGAGACCTTATACCTCATCCATAAATGGAAAGGAGGGAGGGAGGGAGGGAGAGAGGGAGAGAGAAGAGAGAGAAGGAGGGAGAGAGAGAGAGAGAGGGAGGGGTGGGGAGAGGAAGGAGAGAGGGAGAGAGAGGGGAGGAGGAGAGAGGGAGAGAGAGAGGGAGGGAGAAAAGGAGAGAGAGGAAGGGAGAGAGGGAGGGAGGAATGGGAAGAGGAGGGAGGGAGGGAGGGAGAGGGATAGAAAGAGAGAGAGGGAGGGGGAGAAGGAGAGAGGGAGTGAGAGGGGGAGGGAGGGAGAAGAGAGAGAAAGAGAGGGAAGGAGGGAGAGAAGGAGTGAAAGAGGAAGGGAGCTAGAGGGAGGGAGAGAGGGAGGGAAGAGAAAGAGAGAGGGAGGGAAGGGAGGGAGAGAAGAAGAGAAAGAGAGAGGGAGGAAGGGAGAGAAGGAGAGAGAGAGAGGAGAGAGAACTGGAAATGACAAGAGCTTTTGAAACTTAAAAGCCTCATTCTCCAGTGCCACACCTCCTCCAACAAGGCCACACCTCCTAATCCTTCCCAAACAGTTCCATCAAGTGGGGACCAAGTATTCAAACATATGAGTGTCATTCCCATTCAAGCCACCACATTCACCACTTGCAAGGGGAGAAGCCATCAGTGCCGGAGGTTGGCCCTGATTGTAAGAACCTTGAGACCATGGTCAAGTGGCTGAACTAGACCTTGAGTTTCAAGTGAGTCCAAGCAGCGTGTAGGATTGAGCCTGAAGGGGGTCTCTCAGCTCCCTCAGCACCAGTGTACAGGGAACAGAGCCTGAAGGGCCACACCCACGGAGAAGTCACGCCAGAGACTGGTTAGACATGAAACACATGAGTTAGAACAGATGTTCAGCAGAATTCAGAACTGTGTAGGGAGAAGGAATTCAAAACTACCAGGGCTCTGGGCTCTGTTCCTGCTGCTGTTACATCCTTCTAATGCCGAGCTTCCTGGTGGTCAAGGACGAGATGAAAACGGTGGATTCTGTAGTTCTTGGTTGCTGGGAAGAGGAGGCACAATGCCTTTCGTTTTCTTGATGCTGAGTTCTTAGGGGAGGTTTGTGGATCTTGAGTAATCTAGTTGGCTGGGTTGTGCTGGGCTAGGGTCATCTGTGAACAGCTGCTTCTCATATCAGCCTCGATCAAAGCTGAAGGCGTTAGCTCAGATCCTAGCTGAAGGCTTTTCTGAGAAGGGGTGGGTGGAACTTGATGCTGCAAGCTGAGTTGTGGCCCAGACCCTAGCACTCCTTTCCTGGTTGTTCTCTAGCACGATGGCCTGGTGTGGCCCTCCGAGCCATCTCGAGTGTCCCGGGCAGTGCCTGAGGTCCGGATGGGCAGTGTATCGCTGATCCCTCTACGAGGCAGTGAAAATGAAATGCGCCGGAGTGTGGCAGCCTTCACTGCTGACCCCCTTTCCGTAAGTGTCTCTGGTTCATGTGGGCAAGGCTGGGTGGGACCTGGCTGGATGCCTGCCTGCACTTAACTGATTTCTCTGACAGCCCATCTAGTCTCTTCCCTAGGTTTCTGGGGCCCCTTTTGTCTAGCCTTGGAAACCCCAGCTGCTGATATTTCGGCATCTACTCCATTGCTGGCTGCTCCTTTTTACTTTCACAAAGCACTTATAGGATCTGGGCTTCTGTGCTCCCTACAGCTTCTCCGCCATGTCTGAGCACAGGAGTCGTTCTGACTCTGGGACACCATCACTGCCACCAGGAAGCTTTCCTGTTCAGACGCCCTCGTGCTCTGCGTGTTTGGTGTGAGCCAACAGAACACACGGGGAAGCCATACCCACATCCCATATCCTGACTGCAGCACAGGCTTCTTGGCTGGGCAGGAATGGGCTGGCAATGGGGATTTCCCAGGAGGGACCCTTCCTTTTCCTGCAGGCAAGCAATGCTCTTGACCTGGCTTGCTTACCTAGGGTCATGCTCTTTGAATCCGTGGAATTGGAAAGATGGACAGAAATCAGGAGCTGTGCAGGAGAAGGGTTTGGGGCCCCGCTGGGAGGGAGCCCACCCCCTTCCCACAGGCTCCCAAATGGAAAGGGTGACACTCTGAACGTACTCCCGGGGGTCTACAAGGGAGCTCGTGGGAAGCTTCTGCAGGGTGATTTCTGGACTTGGGGACATCAGCCCTCTTCTGGTGTGTGCTGGCAGGGAGGCCCAGGCTGTGGCTGTCTGCTATCCCTTCCCCACTTTGGATACTTTTTGATAATATAAATATATCTGTATATTTTACCCTATGGTGCTGAGGCCTGTGATGGTTTGTGGGCACTGGTGTCCTAGGCTAAGGGTACAGTTGGCTGTGAAGCCCAGAGGTGAATGCTGGGGCTTTGAAGCCAGGAGCCTGAGTCTACCCTCTGCATGTTTACTGAGCTATTTACCCTCCACTGTCCTGGCAGAGGCCTGGCCTGGCCCTGTACCTACTGTGCCACTGTACAGCCAGGCTATGGAATTTCTGATTCAGGACAAGGCAGACCCCAGCTAGTCTGAGTCCCGGTCCCTGCAACCATCTGAGCTGGGGCCTAGATCTGTGTTAGTGACCCCGGCACAGCTACTCAGAGCCTCGTGCTGGAGACACGAGGCCACAGTGCATACCACAAGCTTTGGAGGACTGTGAAGGGGGCTTTACCCTGGGCACTATGCGTGTGCTTCCAGAGTGGAGTCTGCCTCTCACATCACAGGGCATCGCCTTCAGAGGGAAGTGCTGACCTACAGAGGTCACCAGCTACTCAAAGACAGACTGGAGACTTCTGGGAAAGTGCTAAGCTTCTGCCTTCTCTGGAGTCTCATTGCCACCCTATCTCAAAGGCTTAGTGAGCAGACTTGCTGGTGTCCTGTCCTTAGCCTCGAAAGGGGCAGAGCAGAGCTGGATAAGACTGGGGTACCTGTGCCATCTGTGACCCCCCCATCACCTATAAAGCTCTGAACCCCGGCTGTGCCTTCCTGTCAGTTCTTGATGCCACAGGTCCTAGCCATAGGCCTGGCACCTCAGTCCTGGCTTACCAAGTAGGTGGCCCCAGTGGGGACCTGGATGTACACCTGGACATGTGTCCTGGGTGTTTGCCAGGAGACAGCACACGATCCTTGAGCTCTACTAACCTGTTGCACAAGCTACGGTCCCCATCCCTTTGTCCTATCTTCAGGGAGCTGCTCCAAGCCAAATTATCATGTCCTCCAGGCAGGACATGGCTAGAGGGCTTATGTGCCCAAGAGCTGCTTCCTCCCTGAACTTGATCTACTGTCCACCAACCCCAGAGACCAAGGAAGAGGGTACAACTAGAGGTGCCCTCTGCTGGTCTGGCACTGTCATTACTCTGGTTTAGGGATTAGCCAGAGGGGAGCTGCATTTGGCCACTAGGGGGCAGTCATGGACCACTCATAGTTGCAAATTTTGAGCAGGGTCTGTGTAACACCTCCTAACCCTCCCTACACCTGCAACACTTCCTCCCTCCCTCCTCTCCTTCCCCTCCCAGTGATATTCCTGGATCTGGCTTTGTTCTTCTGCCAGCTGGACCACTCAGCCCTGCCTCTGGCCAGCAACTAGTGATGTGTTGTAAGACAGCACAGTAGAGGTGCTTTGCTTTGATCTCCTGGGCTCTAGGACATGAGAGGAGCCCTTCGCCCAATGCCTACAGAATGCAAACCTAAGCCTGAGCCTCTGCTCTCAGCTTTCCCTGCCTGACATTAGAGTCTCCTCAGCTTTCCTCCTGCTCTTAGCCTGTTCTCCCCTTTTGTGAGCGCTCCCCGTAGCCAGCACTATGTGACACTGTAGAGTGCTTTCCCTTGGCGTGAGGTCACATCCCTGCAGGATTGAGACTCAACCTTCGTGAAAAATACCTGTGACTACAGTGTTGGGGGGGGGGGGCAGAGCAGAAGGTTCTGTTGTCTCAAGGATTCCTAATACTGGAGCCAGTGCCAGAAGGGAGG
Comments:

webmaster@sanger.ac.uk

Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SA, UK  Tel:+44 (0)1223 834244