High Throughput Gene Targeting: Create Design

This custom vector design tool is provided by the EUCOMM consortium as a service to the research community. When using this tool, the user agrees not to submit more than five designs per day for creation without prior discussion with the High Throughput Gene Targeting Group at the Sanger Institute.

Design Type Oligo Select Method Artificial Intron Design
5' retrieval block size U block size Min 5' spacer Critical Exon Min 3' spacer D block size 3' retrieval block size
 
       
Subtype Domain Disrupted
Gene Build Gene
Start Exon End Exon
Target Start Target End
Primer Length Design Comment
Created by am9
Valid After Annotation
not done
oligos on fwd strand oligos as ordered View gene and design in Ensembl UCSC BLAT recombineering primers
Design ID: 235609
Chr: 8
Strand: 1
Status: Ordered
BACs: RP24-86H1 : RP24-86F1 : RP24-292M21 : RP24-512A19 : RP24-545E23 : RP24-545A23 : RP24-421I15 : RP24-372L11 : RP24-192F1 : RP24-482E23 : RP24-542D14 :
Instance: Plate 177: Well B08: BACs RP24-86F1 RP24-86H1 RP24-292M21 RP24-512A19
Oligos on GRCm38:
Type Start End Length Seq
G5 110628402 110628451 50 ATAGGAGAGTTTCTAGGCCAGATATTAACTTCAAAAATGAGTTCAGCCAA
U5 110633956 110634005 50 GAGCCAGCAATTAAGAATCTTGTTTTCATACCCCACTCAGAATGATGAAA
U3 110634036 110634085 50 GTGCCAAGCCTTGGCCCAGACTTCAGAGTAGGGTTTTGCCATTCATTTAG
D5 110637079 110637128 50 AAGACAGAGGTCCCGGGACTAAACCTAAAGTATCATTTACATATGTTGAC
D3 110637181 110637230 50 GCAGCTGCACCCAGAGCCCATGCTCTTCACCCTTGCCACCTCAAAAGACA
G3 110641332 110641381 50 ATCTTAATCCTATAATCCTTGCTAAAAAGAACTTTCACGCAGAAGAAAAT
Oligos:
Type Start End Length Seq
D5_D3 113161029 113161080 52 TCGTTTAGTTGTTAGCCCACTCCTGCAGGCTCTGACAGCTGACTAGTGTCTG
15_E_15 113142856 113176130 33275 TACGAAAAGCGGAAGGTTGCAGCGCTGGAGATCGAGAAGTAAGAGCTCCTGGGACCCCGCCCTGGCTTTGCAGCGCCTAGCGGTTCTGCTTGCCCGCGGCGAGGGTTCGGTATTGACCTCTCCGGTTTCAGCTCTTAGCACATTGCTTTAGAGCGGGAAATCCAAGAGCCCTATCTTTGCTAGTCTTAACCTCCTGGTGCTCCCAGATAGCAGTGAAAATGAATTGACTTAAGGTATGTGCAGAACCTAGCGCAGTACCTGACACATTCAGTGTGGCCTCAGTCAAAAGCCAGCTAGATCGGAGAGTGGCCTCTCTGAGGAGGTGGAGAATTTGCTTATGGTGTCCCGCCTTCTCTTTGCAGCTTCTGAAGTGGCCAAGTGTAGAAATAGGTCAAAGCACGTGATCCAATGCTCAGAAGATTGTCAGGCCACCCTCCCTTGCAAGTGAAAATGGGAAGATTTGCCCTTCCCCGCTTCTGCAATAGTATACGTGTGTGTAATAGTGCACTGGTGTTTCCAGGTGTTCGAAATAGGGAATGTTTAATTCGGTAATGTTTTGCTGAGTATGTGAGAGAGCACGTGTTTTTCCCCCAGCCAAATCTTAGTAACAGTCAGTTGAGTAGGTGGTTTCAGAAGAGTAGAAAGCAGCAGCCTGTAAAACTAGAAAAACATTAGGAGTTAAGACATCCAACTTGGTAACAGCGGACCATATGTGTCTATGTAAATTTAAGTTAACCAGAGTAGTGACACAGGCTTGAGATTTGGCACTTGGAAGGCTCGGGCAGAAATACTGTACTCGTTTGAGATTAGCATTGGTCACGGGGCTAGATCCAGTCTCAACAACAACAACAAAGTAATGAATCAGTACAAATTGTAAATTCAGCACGTCAGTTTCACTACCCATAATCTGGGTGTTCAGGAGCCAACCACTACAGCTGCACAGTGCAGACTAGAGAACATTTCAGTCATTGTACAATGGTCACATGGCCAGCCCTAAGCTATGGAGTGGTGCTCACTCATTGACTAGGATAGACTCTTTACTCAAAGTTTTTTAACCTCGGTGCTGTTGATATTTGGGAAGCACAATACTTGGTTGTGATGGGCAGTTCTGTAGCTTGTGTGATTTTTTTTTTTTTTTTTAGTAGTACCTCTGCCCTTTACCCACTAGATGCCAGTAGTACTCCATCAGTTGTGACAACCCAAATTGTCATCAGACTTTGCCAAATGTCCCTTAAAGAATCAAAATCACACTAGTTGAGAACAATTGCTTTGCCCTAGACTAATGGCTTTGGGCTTAGGTAAGAAGACCCTTCCATTTGTTTGCAGTACTCACGCTAGCGGTTTCTTTCCTCAGCCGCCGCCTTTTTTTCCCCTCTTTTCTGTTTACTGCCTTGCATTGCAGTGCTTAGCACAGTTCTGTTGTCATGCCGAATAGTGTGACCCAAAGATAGTGTCTAGGTATGATTGTGTGTCCGTGAGTTCTGTTGGTTTTGTGAAGTTGCAGTGTATATTAGGTTTTCATTGCTGTATCAAACACTCGAGATTTAAATGGACAGGGTAGTATGTGGTCAGTTGGACCTGTAGCTTTTGGGCATGATGAAGCCCTTCAAGGGCACACACCAAAAGGAGCTCTCAATAAGCCTAACTCTCAAACTCTGTCAACTCCGAATGAACCAGACAGAGGGCTACCTACACCGTGCATACACGGGCCTTTGAGAAACGGTTAAGATTCAGACAGTGGCACACTGACACCAGTTTTTTGCCACCCACTCAGCGTCACAGAAGTATCTGCTTTTATCCTGGCTTGAGTCATCTGTTAGGTCCTTGAACAGAGGTGTTCACAGCATAGCTGCTTCCGGTCAGTCTGTGGAAGACTTCTCTGCAGGTGGTCGTGTAGGGGCTTAGTTGTTAACCCAGTTTGTTTTGTATTAGACATTGCCCTTGATTTGTAAAATTCAGAGAAAATTCCTAGGGTGGTAAGGGACTATGGCCTCCTTAAGAGAAAAAACATTTGATTTATCCTCTTCTCTTAACACAGTGAGTGCCTAGTGGCATTTGACACTTGTACACAGGAACAATAGTTTTGCAGTTTTGATAGGAGAGTAACATTGTAGCCTAAGGAACTTGCTTCTCAAAAGTGGCCTGCAGACAGCTACTGAAGAGAGACGCTGGCTTCATCCTTGTGTGAGTTAGAATTGGCCCTCGAACAAGATTCCTGCATGACTGTTGTACATGTTAAAGCTTGGCAAGTGCTAACTTCAAAGACCTTCTGTTCTGTGCATAGAATATTCGATATTTGCATATATTCTTCATCAGACTAACCCTTGGTCAAGTAGCCTATTAATCGGTCCCCACAGATACCCCATCAAAGAAAAGTTAGAGCATTGACTGTTGCGTGTGGCGTGTGACAGCTCGTGTGCTGCAAAAGTGAACATGCTTGCCCTGTTCTTAGTTGAGCGAACCCCTCCAAGACGCCTGTTCTTAGTTAAGAGGCCACATGGAGTGTTGGTGTTGAGCACTAAAGCCTGGGAGCTGGGATTCCAGCTCCTCCTAGTCGCTAGTGAGGTGCGCCTGAGCAAGCTAATTAACCCCAGTGTCCTCATCCACAGACTAACAACAGTATTCACTGGGGCCTGGTGTGCGTTTTATTCCGGGAGCTAATGCAGACGTGGCTAATGCAGCCCTAGACACATCGCAACTGTTATGTAATGTGCAAACAGCTGTTACATAATTATTTTTAAATATTTATAATTGTTTTATATCAGTACTTCTCTTGACACTCTTTGGTTATCAGAATAATGGCCTCCTAAAGATATCTTAATCCCTGGAACCTGTGAATGTTTGAATTTAAGATAGCAGGTATGAGCTTGAGGAGATGGCTCAGTGGGAATATTAGTTATTTTTCTGTTGCTACAGTAAAAGCCCATAAGCCACAATCAACTTATGGAGGAAAAGAGTTGTCTTAGTTTATGGTTTCAGAGAGCAAGCCCATATTGGCAGTGGATGCACAGCAGCCCTCAGCTTAGAAGAAGCCGAGAGCTCATTTCTGTCCACTCACTTATATAAAGCAGAAGAGCAAACTGCAAGTGGGGGGAGACTGTGTCTTCCTCCAGTGACATGCTTCCGCCAGCAACACTCCATCCCCTAAAGGTTCCAGAGCTTCCTCCCAAACAGTGCCACCAGTTGGCAACCAAATGTTTTCGGTATGCAAGCTTATGGGAGATGTTTCGCATTCAAATATCCTCGCTACACCAGCATGAGAACCTGAATTTGGATCCCCAGGCTCATATGTAAAACCTGGGCTTGGCAGCCTGCACCTAGAAATCCAAGTGCCTGGACTTAAGTCAGTCATTGTAACTAAACAGTGAAGTGCAGGTTCAGTGAGAAACCCTGTCTCAAAAAGTAAAGTTCTACTTACCTTTCCTGTGGAGGAGACAGGTGTTGGCTTCTGGCCTGCACATGCACTCATGTACACAAGTACAGCTGCGCAGGCTCCTACTCTACATCACAGAGACAAAGAAGGGAGAAGCATAGCAGGTACAAAGTTGCTAATCGGGTGATTTTATTTATTTTTATTTTTTTTAAAGTTCATATTATTTATTTAGAATTTAATTGCATCATGCTGTGGACTTATATAGAAAAAAAATGATGAAACTGATAGACCAATCGTTTCCAAAGAGTTTTCTTTTAAAAAAATTATGCTCATTAAGTAGAACTTAGGCATTCAATTCTTGTAATCTATAAAATCTAATTTCCCAGGTGACCTGTTTTTATATCGGGTGATTTTAAAATGGGAGATTAGCCTAGATTACCCAGGTGGACCTGGTGTAGCCCTAAGCATCCTTTAGTGTGAAAGAGGGAAGCAAGGAGAGTATCAGAGTCTCCAGCAGCCATCATTACATTAGCCTTGAAGTTGTAAGGAGCAGCTAGTAAGAGAATGTGGGCATCATCTGTAAGCTGGCAAGGTTTTCCTGCTCTCCAGGAAAACCAACCTTTCTAATGCAGTTCCTCATGTTGTAGCAACCCCAACCATAAAATTGTTTCATTGCTACTTCATAACAGTAAGTTTGACTGTTATGAATCATAATGTAAGTGTCTGATGTGCAGGTTATCTGATATGCAACCCCCAAAGGCCTGTCCACTCACACTGCTGTACAGCTTCCAAATTACAGCAACTTGCTCACACCCTGATTAGTTCAGTAAGGCCCATAAGTTGTGTCCTAAGCCTCTAAGTTTGTGGCCATTTGTAACAGGAGCCAGTAGAAAACTGGTACAACTCTGGGAGAGACTAGTGATAAACTCTGAGTGGTACAATGTTTGTCTAGAACTCCAGACCACTCTGTTGTTCTAGATCTGCTGCCTGTCTGAGGCCTTGAGCTCTGTGGAAGCAGGAACTCAGCTTCATACCATGCTGTCTCTTAGTAAGAGGCTGAAGGCCTGGCTGACAGTAGCTTGTCTCTGGCTTTCCCAAACCAAGCAGGAAGCCCTCAGCCTCATAGACAGCTGAGCCTAGTCGTCAGAGTGAGATATGATTAGGAGCCCATTTAAGTACACCTCCAGTGAATAAGATTCAAATCTCAGAGGCAGAACAGGAGTGTGCTTTGTGGTTTTCAAGGAGGCTGGTGTCTCAGGCTTCCTTAGTTCTGGCTGGAACTCCCCATTGGGTGGAGAAAAGCTGAGGGATATTAAGTGTATTGTGAGCTTTTCTCAACCCCTGTTACGTGCAGTCTGCCCCTGCTGCTCTAACAAAATACCACAAGCTAGTGGCTTCAGTAATATCCATTTATTGCTCACAGTTCTAGGGGCCTGCCTGGCCTTTTCATAGGTATTTGCAGGGAGGTGGGGGGTGGGGGAAGGGTGTGGCTAGCGCCTCATCATGTGAGTATGGAGCCTAAAGGGTACTCAGTCACTATGATCATGAGTATGTAAAGTTCCATCTGCCCCATCCCCTGGGGTAGAAGTGGGATGCAGAGGGATGGAGAGAAGCATCCCTGTGGTTAGCCATTGTTTACCCACCCTGCCTCTCACTGCCCTATGAAGCAGATGATGCTAACCCATTTCACAGAAGAGGAAGTGGAGACCTCTTAAATCATCTTTCCAAGATTTACAGCTGGGTGTATCTGTCCTAAAGGGCATCCCCACTAGCTGGGTATGTTAACCCTATCTCCAGACAAGAAACCCCACTCCTGTTAGTGGGTTCCCCGACCCAAAGTGGGGGGAAATGTGTGTATAATGAATTTCATCCTTGGACATCTCTGTAGTGATATTAGTTGCTGCTTTCAGTTCTACAAAGCCATCTTCTCATACGACAGCCAGTACTGCATTTGGTATTCCTGTGGGAAGTAAGATGTCTTATAGTTATTGCAGGTCCTCAGATGCTAAATGTCCAAGGAAAGGCATGTGTGGTTCCACTCTGCTAGCATGGTGTGACCACCTCTAATAGTACACGTGGAGTGCCCGCTGGGCACTAGACCTGAAGAACTTTCTGCCACTGCCTCTGTCAGCATGGTGCCACAATTTCACAAAGGCGAAGGCACTCAAGATTTTTCCTTGATTGGTGGTTTAGTCCCTCAGAGCTCTGGGGTGTCTGGTTGGTTAATATTGCTGTTCTTCCTATGGGGTTGTAAACCCCTTCAGCCCCTTCAGTCCTTTCTCTAAGTCCTCCATTGGGGATCCCGTGCTCAGTCCAATGGTTGGCTGTGAGCATCAGCCTCTGTATTTGTCAGGCTCTGGCAGAGCCTCTCAGGAGACAACTATATCAGGCTCCTGTCTGCAAGCACTTCTTGGCATCCACAGTAGTGTCTGGGTTTGGTGTCTGAATATGGGATGGATCCCCATGTGGGGCAGTCTCTGGATGGCCTTTCCTCAGGCTATGCTCCACACTTTGTCTCTGTATTTCCTCCCATGAGTATTTTGTTCTCCCTTCTCAGAAGGACTAAAGCATCTACACTTTGGTCCTCCTTCATGAGCTTCATGTGGTCTGTGAATTGTATCTTGAGTATTCCGAGCTTCTGGGCTAATATCCACTTATCAGTGAGTGCATACCATGTGTGTTCTTTTGTGACTGGGTTACCTCACTCAGGATGATATCTTCTAGTTCCATCCATTTGCCTAAGAATTTCTTGAAGTCATCATTTTTAATAGCTGAGTAGTACTCCATGCACTTGGAATTCTAAAAGCCTATCAATGTGGTGCCCTTTGAGAACCCAGGCAAAGTTAGGTACCAGAGCTCTGAGTGCTACTCACATAATTGGAGTTCCTGGGCATGGCCTAGAGTGGTTTGAGGCAATTTGTGGAGTTTGGAGTTTGGGCTCAGTCCTGCTGTTCATAAGCAGATTGCTTAGACCTGGGGTCAGAGGCTGGTGCTTGCTACGTTCTGCCTACAGACTGTTCTGGTCTGAATCTCAGAGCAAGTTCACGATGAAATTTGAGTTTCTGTAGAGTTATGGCTGGGGGTGCCACATTCCTGTTCAACAAGAGCCAACCCCTCCCCACCATCCTGCTGGCATGCTCACCAAGGCTTCCCACACCAGTACCCCCACTGGCTTTGTTTGACTCCCCTGTCTACCCACTGTGAAGATTGCCTTTTGTTTTTGTTTTTTCGAAACAGGGTTACTCTGTGTAGCTCTGACTGTCCTGGAACTCATTCTGTAGACCAGGCTGGCCTCAAACTTAGAGATCTGCCTGCCTCTGCTTCCCAAGTGCTGGGATTAAAAGTGTGCACTCTTGCCACCCAGCAAAGATTACATGTATGACTTCTGGTTGAATGTCTCTGTGCCTTGGCTTACTGTTTATTTATTTATTTATTTTTAATGTGCCTTGAAAACATTATGCTGGGTGAGAGAAGCAGGCAGCTATGAAAGGCCAGAAGTACTGTGTCTCTAGCGACAGCAGATTGTGGTTGCCAGAGGTTGAGAAGAAAAAGCTAGAGATGGAGTGACAGCTCAGAGGCACAGGGTTTCTTTAGAGCTTATGGAAATGCCTTAAAGTGATGGAGCTCTACAAGTCTACACGTGATAAAAATCACTGGGCTGTGTACTTGCAAGTAAGACTGGCGGCTTGTAGATCATATCTCATCTTTGAAAGTAAGAAGATAGACGGTACATCATTGGGAGAGGGCACTTACTAATGGTCACAGTTGTCACCTACAGTCAGGTCCCCTTTTGTCCCAGCCATAGCCAGTGAGTGCTCAGTATGGTTTTTGGTTAGGGAGCAATATCAGACTTTTTGTTTATTATGTGAATGAGTGTTTCCCCTGCATGTCTGCACCGTGTGTGTGTAGTGCCCATGGAGGCCATAAGATAGCCTGGAACTGGAGTTACAGTTGTGTGCTGCCATTTGAGTATGGGACTCTAACCCATGTCCTCCGGAAGAGCAGCAACTGCTCTTAACTGCTGAGCCATCCCTCCAGCCCTTAGGTTTCTTTAATGCAATATTTTTATTCCTTGATAATGTCATGCATGTGTACCATGTATTTTTACTCTACTCATCCCTGGCTTTGTCCCCTAACTCAGTGTGTGTTCTGTGAGTTAAATCCCAGGCCTTGTCAGAAGACAGTTGGCCTGGCCTCAGAGGCCTGTGCTCATTTCCATTCAGTTTTCTGGTGATGTGTGAGCAAATGGAAACCAACTTACTCTGGCACTCGGTGGAGCAGATGGAGACATACTTACCCAGATTCTCTTTGGGAAATCACTGCATGGATGTGCCATCTGAATACGGATGTCAGTCACAGGGGGAGCTGAGACAGAGAATTGTATTTGCCCCAGGCATAGGCTGCAAGCTTCACAACAAAGGCATGAGTGTCAGCTCTGGCTTACCTTTCTCCTCCTCGGAGCCAGAGGGAGCCAGGCTCCTCAGCCAGCGTGCTGAGTGAGCAGTGTCTTGGTGGCGTGCGTAGAGCGCATTATCTCCTGGTTCTGACTTGAGCACCTGCAGTGCAGAATATGTGCTACTCCTTATCCAATTCTCTTTTTAAAAGTGAAGTCCTTGTGATTCTTTCCCAAAGCTGTGTGGCCTTGGGTTGCTTAGCTTCTTCATCTGTAAACTAGAGTAAGTGCCAGACTGGGCGGCAGCTTTTAGGTTTCAGTTTGAGTACCCATTATCTTAGGATTATCATTTGCTGTGGTGAAACACCATGGCCAAAGCAGCTTGGGGAGGAAAGGGTTTATTTGGCTTAGTTTCCACGTCACTGTTTGTCGTCAAAAGAAGTAAGAACAGGAACTCAAACAGGGCAGGAACCTGGAGCTGACTCAGACCATGGAGGGGTGCTGCATACAGGATTGCTCCTAGGGGCTTGTTCAGCCTGCTTTGTTCTAGTACCCAGGACCACCAGGGGTGGGGTGGGGCGTCCCCACCCACAATGGGCTGGTCCCTTTCTGCCTGATCATCTGAAGGTATTTTCTCAACTAAGGTTCCCTCCTCTCAGATGACTCTAAGCTTGTGTCAAGTTGACATAAAAGTAGCCAGTACACTAGTGTAAACAGCCAGTGCTTGCCTGGTGGGCAGTAAATTCTTTATCTCCACAGTAGAAGGCTTAATTCAGAATGTCTTGAGGATGTAGCTTGTCTGCACTCGCTGTGTGTGTGGAGGGGAGATGTCTAAACACTGAGCAGCAGGTGGATGGCCTACAGAAAGGGCTTGTTGGACCATTTTTTCCCAATATGTAGGGAAACCAGGCAGTAGCAGCATCTCTTCTTTGGAGTATAGAACAGTAAATCCTGAGTCCTTTGACTGGGTCACCTGACGGGCTGAGTCTACACAAGAATTGTTATAGAATGTGGTCACTTTCCAGCTAAAAGGGCCTCTGGAGAGAGGAGGAGGAAACTGTGTTACAGTTTAAAGGACATAATACCTTGTTGATGTCAAGGGTTCAAACCTGTGATCCTGAGAAGTGGACTTACTCTCCCTAAGGTTGTTCAGATCTTGAAGTTGAGGATGATGTAGCTACAGTAACTGACCAGGGAAGTCTGCAGCATAACGAGAGTGCTTGCTGACTTACCAAGCCTTGTATAGCCTGTGATGTCACCATACTGTGTTCCAGAGCCTGGAGGTATCAGTGCAGGCTGGGACTATGTAGCACACAGTGTGGCTCCAGGTTTTTTCTTGGCTGATAGCAATCCAAAAATATCCTATGGAGCTGTAGTTCCCTCTGCCAAGGGAGCAATCAGTATAGCAGCTTCTTTGATATCATAGGCAGTTGTTAAACTCAGTGCTAGCCCACCCTGATGCTTATGTCTTTTGGGCGTCTCTACCAGACTCCTATACCTCCAGCCAATTGCAAGCAGAAGCTCTTAAGCCACTAAAGGACATGGTGCTACCAGGGAATCGGCTTGTTGAACCTTTTTTTTCCCAATACTTTGTAGGGAAACCAGGCAGTAGCAGCATCTCTTCTTTGGAGTATAGAACAGTAAATCCTGAGTCCTTTGTGTCATTGAAGGACCCCAGGGATAGGAGAGTTTCTAGGCCAGATATTAACTTCAAAAATGAGTTCAGCCAAAGACCCCCCACTTCTATCTCCCAAGCAGTAGATGAAAGCCGAGGCAGCCTGTTGTCTTTGAAGAAGACTAAGCCTGAAGCTGGGGAACCTGCTGTTGAACTTCACTTACTCTGCTCCCCTTGGGGTTGCTTTTCTTCTCTGCACTGTCCCTGTGAAGTCATGAGACCAAGGCACTGGCTGGCTGAGGGCACAGTTTTAGAGTGCAGCTGACCCTCAGCAGGAGCACTTCAAGTCCATGGTGTGGGTGTGTGTCTGTGTGTATGCGCGCGCGCGAGCAAGTGCATGCACGTCTCTACAGTCAGCAGCCGTGGCTATAGAGGACTGGGCTCTTCTCAGTGTGCGTTTTGAGTTTGCAGGAAAGGTGCCGTTGCTCGTGCTAACTTGTGGTAAGGTTAGAAGGGCCTCAGCACTGTCAGAAGCTACATCAGTTAACCCCCAGGTCATGTTTTCCCATGCAAGCAACATGGCAGCACAAGGCTTCACCCATATTTGCCCTACAGCTGTGCCCTCATCATCTCTGCCAGCCTTCGAAGACTGACTCCACTGGCGGGTGTTTACTGATTGGCCAGCTGTTGGATGCAAAAAATTGGTCTGGAGACCGCTGGTACTAGAATTGCAAAGTGGGCAGTGCCCAAAGCCCTGATCAAGCTTTATGGAGGTAGAAGGTGGTAGATGGTGGCACCAATCAGTACACTTCTGGGCACTAAGTGCTTCTGAGTGCCAAGGAGGACTAACACCGCACACCATGAAAGTGCAGGAAGGTGTAGAGGCAGGGCATCTGAGGAGGACAGGCCTGAATGTGAGAGGAGCAGGCCCCCTAGGAAGCTGCAGCTGGTGGAAGTGGGAGAGGGAAAGTGGGCAGGCTAGAAAGTCATGCGGCCTGTTTTGACTGCTAAGGGTGGCCTTGATTCATGAAACAAGATTGGCCCAAGGGTTGCCCTTGTGCTGTTTGAGCTCGTAATACTGATGAGAAGGTGCTAAAGTAGTTTCCCCTCCAGGGGGCGCAATTGCTTTGCACTTGTTTTCCCAGAAGATACCGAAACTTATACTTAATGTAATGGTCCCTGTGGTCATGGGTCTTTAATGGCCTTTGTTGTGACCTGGGGTGACTGAATTAAGCCCTGATAAGTTTCCAAGTTGGTGGGAGAAAGGTGCCACTGAGCTCATGAATTGCCCCCACCATCCATCTTCTTTAAAACCTCCTGTTATTGAAAGTAGTGGCTCTGGCACCAAGGCCACATGCCTTCTCCCCTTCCCTGTAGATCTTTGTGGGAGCCTGTGCTGTCTTCAGAGCTTCCTTACTGCCTCTCAAATTCATCCCCCGCCCCCCAACTACAGATCATTCTTCAGGATCCCATCCAGCCGCTGCAGGCCACTTTCCATGGCTCCTCATGGCCACCAGAGGGAGATGGGAGGGATTGCTTTGCCAAGCCTTCAGGATTGCCAGCTGTTTGCCCATCTTGCCTCAGCCCAGATGAACACCTCCTCACACTTCCGAACCCTCTCCCAGGCATACTCACATAGGACCACAACATAACTCGCCGATTAGACCCCAGCTTTCCTGCCTTCCTCACCTTGCTGTCCACTCTTGATGGGTTTGTACTGTCATCCTCCACCTACCCCAGCAGAGCATCCTTCAGAGCCAGAGAATGAGTCTGTGCAGGGCTGACATCTGGGAGGAGTGCTCCCCAGCTGCTCCATGAATGTCCAGGAATCTGTAAAGGACAGGAGAGGAGCATGTCTCAGGGATGACTGGGAGGGAGACTGGCTCTCCTCTTGAGTCCTGGCCTAGCCTGGACGGTATCCACATTCCAGGTGCTGCTGCGCCTTGTGCAGGCAAAAGCAGAACTCAGCTTCTGGGCAGGAGTGGGAGGCACAGTTACTCACTCTCAGTAACTGTGTGTGGTATAGCCCCATGTTCTTGATCCTTCAAGAAGACTCACGGGTTCTGGATCTCTGTGGAATTTAGAAAATGCTTTTCCATGAGGAACATTTAAAAACAGGCCAAAACCAAGTCATTTCCTTTTTTTTCTTTTAATATACTTAAAAATTTATTAGGCAGTGTGAAATTTTCATCTCTTAGAATTAAAAGGATTGCTACTGCATTGGCCGGGAATCGAACCCGGGCCTCCCGCGTGGCAGGCGAGAATTCTACCACTGAACCACCAATGCTCCAGCTGTGAGCAGCTGTGTGGCACCTCCCTATAACCTCATCCCTGGGCCTCCATGTGTATATGTTGAGTCATAGCCCAGTTTATGATACTGCCACATCAGCTTAGCTTCAAGAAGAGCAGCAAGCTCCAGAGCCAGAAGGAAGTGAGGGGTGAGTGTAGGTCTGTGTGCATGTGAAGTAAATTTGCCTTTGGGCTTTGAGACAGGAAAGAGAGCTCCACTCCCTCCTCAGTCAGCAGCAAAACACAGAGACTGTGGGCGAGCCTCCCCTCTGCCGTGGAGCTGGTGTGCTGCTCTCAGTTTTCACACTGCGTTCTGCTGGCGACTGGCCCAGACCAAGGGCAGCACTGTGGAGTTCTTTCAGGTGGAGATGAGGAAGCCAGACTCCTGCAGCCAGTCACACTTGTCAAAGAGCCCAGCAACTCCCTATGAACTCTGAGCAGAAATCTGTAGTCCTTGGGCTGCCTCAGGCCTTGTTTGGTTGAGGGACCAGGCTCCTCTGGCATGAGTTCTGTGAGGAAACTGACCAGAAAGGGACCCACACACCCCCCAAACAAATAAACAGTAATAAAGCAAATAAATTTTAAAACATAATTTTTTTTTAAGAAAAGAAAACAAGCTCTGCATTGGCCGGGAATCGAACCCGGGCCTCCCGCGTGGCAGGCGAGAATTCTACCACTGAACCACCAATGCTCCAGCTGTTTGGTGTGGTGTCTGTAGAGCTCTTCTCAGGGCTGTTTCATTGAAGAAACACTGGGCTTCACCTGGCTGGTTTGTCCTGTTTGGGAAACCGCACAGGATTGGTTCTTTCCCAACCTTCTTATAAGCTTCTGAAGTCAGGGCCTATGATCTGACAGCTCCTCCCACTTAAAAGCCCTTGAGTCATCTGTAACCCATAATGATGTCCTTTCCTACTGTACATGATCCTGCCTTCCCATTTCTTTTCAGTAGGCAAATGGAGCAATACACCCACCTTCCTTTCCCTGGGCATTGTCTGTTAATGTTTCTAAAGTAATACCTCAGATGGGACTGCCCTGTCGCCAGTCTCCTGGACAGAGATAGCGTATTCTGTTTCTGTGACATCACTACTCTATTTTGCTACAATTTTGTGTTTGTGATTTGATTTTGCCATGTGTCCCAACATAGATACAGAGGAGTCCTCAGATGCATGAGTGCAGAACTGAGCAAGTGTTTGATAAAAATGGGTATTAGCTTTTTTTAAGACAGTAATTTACATTCTCTCAGATTCCCAGAAGTAAACTGGCCCCACTACTCCTCACTGAACGCTGAGCAGGGCAATGGTTAGGACCTACCCAGCAGCAGAACCGAGAGGACCTGCCCTGGAGCCCAGACAGCAGAAGTAGCCCGGGTTTGTGTGTCCCATGCTTTCTCTTTCCTCTTTCCAGGCTGGTGCGGGACTTTGTGGCCCAGAACAACACCATGCAAATCAAGCACGTGATCCAGACCCTGTCTCAGGAGTTTGCCCTGTCCCAGCACCCCCACAGCCGGAAAGGGGGCCTCATCGGTCTGGCAGCCTGCTCTATTGCCCTAGGCAAGGTATGTCTTCATTCTGATTGAGGTGACCAAATACCTTCCTACCTGAGCCTCAGCAGGACCATTACAGATGTGTATTTTATCAAGACTTCTGCATTTAGGACTACTAGCAAATATCACCGTGTGGCCTGGCAGCCATGTCCCCATAGTGTGGTTCTACTTCTGGAAGGTTGGCTTGGGATGAGTGTTTTTAGCTCAGCTCTCACAGAGGCCTGAGCGTCTCCAAGGGAGGGGACTAACCCTTCTGACTAGTCCTGGCTGCTCGTTACAGGACTCAGGGCTCTACCTGAAGGAGCTGATAGAGCCAGTGCTGACCTGCTTTAATGACGCAGACAGCAGGCTGCGCTACTACGCTTGTGAGGCCCTCTACAATATCGTCAAAGTGGCCCGAGGTGCCGTGCTGCCGCACTTCAATGTTCTCTTCGATGGACTGAGTAAGGTAACTTCTGATTCAGCTAAGAACAGCCCACCTACCTGACTTGACTTTCTAGGACCCTGAGAGAGAGCTTGGGACAGATGCAGGCAGAGCAGGAGCAGACACTGCTGCAGGGGACACTTAATGCCCAGGTCTGATTTTTCATAGACCTGTATCAGTGTATCGTTAAGTCCCGTTCACCCTCATTCCACTCTGTGGAAATGTCTGCCTGCTGTACACATTATCGGAAAGGCTCATAGTTTGAGAAGCACTAACCTCCCAGGCAAAGGTAACAATGATGACTCCACAGTACAGGCTGTCCCTTTGAAGGACAGTCATGACAAGCTCCCTGTGCTAAAGAGTGATCCCCTATAGACCTTTAGGGTCCCTATTGCTGTCCTTCTTGGCTCTCAGTCTGGTGGGTTGCCTTTCCCCTCACCCTGGTGGGGATGCTCTCTCCTCAGCCTGGGGCAGTCACCCTACTCAGTTGTGCAGAGTGGCCCCTGTAGAATGAACAACATGACCATTTCTCAATGCCACCCTCACGGCTGTCTCGGGGGCCCATGAGAGAACCAAGCCTTTTAAGATAAGCGTGCCCTGGGAGCAGCCAGTGGGAACAACCGTGTGACCCAGTTCCAGCATGGCCTGGGAACCCCAGCAGATCTTGGGTTACCCCTGAACAAATGGGAACTCTCCTGTAACTGGTTGTAACTACCTTTCTCAGTCAGACACTGGGAAAGACACCACGTGGTGTGCTGATCTGCATCATGGCCTTGGCTGTTGCTTTGCATTCGGTCTCTAGGCTTACGTCTCACTGTGACTGAACATTGCCTCTGTTTCTCTGTTTTGGTGCCTCATAGTTGGCTGCTGACCCAGACCCCAATGTGAAAAGTGGATCTGAGCTCCTGGACCGCCTCTTAAAGGTACCCCACTCCAACCTTCTTGTATTTTAGACTTTATTCCCTCTGCGTGTAGAGTAGAAATTCTGGTGGTTTTCCTCATGTAAGTTGTTTTTCTATATAGCACACACATATTAAAGCTCACTGCTTGGTATGCAGTTTCTGTGACATATGTAAAGCTGTGTTACTACCACTGTCAAAGTACAGAACTGGGCTGTCCCCCTAAGTGAAGATCTTCTGTTTGGGGTGGGGATTGGATATTTTATGTATATAGGTGCTTTGCCTGCTTGCATGTCTATGTCTATGTCTATGTCTATGTCTATGACCTGTGTGCCTGGTCACTGCAGAGGTGATAAAGGGATGTCATATCCCCTAGAACTAGAGTTCCAGCTGGTTGTGAGTCTCTGGGGTGCTGAGAATCTAACCCAGATCCTCAAGAATAGCAGCTAGTGCCCGTAACTGCTGAGCCAGCAATTAAGAATCTTGTTTTCATACCCCACTCAGAATGATGAAATTGAACTTCGACCCAGCCTTCCAAGACAGGGTGCCAAGCCTTGGCCCAGACTTCAGAGTAGGGTTTTGCCATTCATTTAGGTCTATTGACTTCTCTGCTGGCCATCCATTATTTTGTTAGGCTTTGGGCCTATCACAATGCCGGTTCTCCAGGGACCTCTCCTACCTGGCTTAGGCTCTGCCATTTCTCTCCATGGTTACCTGACCCTCAAGTGAGCCCAGGGCCAGCAGCACAGCAAACCCACTGCTGGCTTTTCATAACCTCACTCTTCAATCCACAGGACATTGTGACAGAAAGCAGCAAGTTTGACCTGGTGAGCTTCATCCCCCTTTTGCGGGAGAGGATTTACTCCAACAACCAATACGCCCGACAGTTCATCATCTCCTGGGTATGGCCCAGTCCTTGGTAGATTCTTCCAACAACCAAGAGTTTCTAGTGGAATCATGTGGACTCCACTAGGGGACACACAGTGATTATTTTGACTAAAAGACACCTCTTTGTCTCTACCTCTTAATAACCTTCAAACACCTCATCACCAAAAACACTGTGGGTTGGGCATAGTGGCACATGCCTTTATTCATAGCACTTGGGAAGCAGAAACAGGCAGAGCTCTGTGAGTTCAAGGCCAGCTTTGTCAATAAAGCAAGTTCCAGGCCAGTTAAGACCACACAGTGAGACCTTGTCTGGAAAAGCACTCTGTCTAGAGTAGTCTTACTGCACGTCCTGTTTGCCCTGAAGGGGTGTGATTCTTTCCTTGTCCTGAAACTGCCCAGGATCTCGGAAGCCCCTGGTGCCACATCCAGCAGCTCCACCTCTGTGAACCGTCTAGCTTCATCCAGCCCTCTCGATTAGTCGCCCTCTCCTCTAGCACCCAAATCCTCCTGGAGTCAAACTCCCACTTCCTTGCACATTGAACAGAAAAATTCCTGCAGCACTGCAATGTAGATACTACAATGCTGTGACACAGGACCCTAGTCCTTCTGCTGCTGGTCCCAAGGGAAGAGTAGGAGACCAGGCTACACCTGGGCCAGCTCTCAGCTCTCCCTCTCCTACTCCCCTCCATCAGATCCTGGTTCTGGTGTCGGTGCCAGACATTAACCTGCTGGATTACCTGCCAGAGATCCTAGATGGGCTCTTCCAGATCCTGGGTGACAATGGCAAGGAGATTCGGAAAATGTGAGTTGTGGGAAACGGCAGGCAGCTGCCACTCGCTCGAGTGTCTATGGGAACTTCTTCCTATATCCTTCCCCATGGAGGAGTAGAACGCTCACCTTCCCAGCCCCTGCTCAGTGTCCTCCTGACGAGTATAGGGTTGACCCAGAGCAGAAATGGGCTTTCATGCTAGCTTATGCTTCCTTTTCTCACTGGTAGGTGTGAGGTGGTTCTTGGAGAGTTCTTGAAAGAAATTAAGAAGAACCCATCCAGTGTGAAGTTTGCTGAGATGGCCAACATCCTGGTGATCCACTGCCAGACCACAGGTGAGTGTGTGGAGGCCCTGTAGCTACAACTGCTGCCTCAGAAGCCCCTGTCTCTCATATCTAGACTTCAGTATGGGGCAGAAGGGGGACCCATGTGGGCTAGCCACCACATGTGACTCTGGATCTGGAAGCAGTAGGGTGGTGGGTGTGAGAAGAGATCTATGTTCTCCTCTGATAAGCATACACTTTCACCTGGCCTGAAGACCTTGTGGATGTGCTTTGCCTTAGGTAAAGATAGGACGTGTGGAGGTCAGAATTGCCTTTCCCGCAGCATCTATTGGCTGTCAAACCACATGAAACAGTCACAGCAATGGCTGCTTGTTACTGGCCAAGAACCTCCAGGTCAGCTAGGTGACTTTGCTCCCATGTCCAGGCTGGTCATAATGATTTCAGGCTTAGTTGGAGCTAGGTGTGGTGTGCAGTGACCCACATCTGACATGGGAGCTCAGTATCCAGTAGGTTGGATGGCCTTAGCAGGGTTCCAAGAGACACAGGACACAGACATTGTCAGGACTCTTGATTCCTATGCTTAAACCAGAGACACAACTACATGCTGTTGGCCAGAGTAGCAAGTTTTCTGGGTCCAATGATAGGAAAATGAATTCCACTTAGAAAGGAAGTGTGTCATATTACAACAGGCAAGGGTATCGCTGCTGTTTTCGAAATCCAGCGCAAGATTTTCACTCTTAACCTATCCTTACAGCCCTGTAGAGAGCAGGGAGCCCAGGAAATGTTGTATTCATATAGCTAGAAGCAGTCAAGCCTCCAGGCCTAGCCTCTGTGCTTGGGAGGTAGGAGGAGCTCTCAGTGTATGTGCCAGCCCCACCAGAAGCCACCAATTTCTCTTCCAGATGACCTGATTCAGCTGACGGCTATGTGCTGGATGCGGGAATTCATCCAGCTGGCGGGCCGGGTAATGCTGCCCTATTCCTCTGGGATCCTGACTGCTGTCCTGCCATGCTTGGCCTATGATGACCGCAAGAAAAGTATCCTTCCCTCTGTAGAGGAGGTTGAAGTGGTGGGTCTGTGAATGGGAAGGACGCCCTTAGGCTCCTTCACTCCTGGGAAGCAAGAGATGAAGCTGAATGTGGATTGGGAAAGCCAGAGGTGCAAGACTAACGCTGGCTGTCCCCAGTCCTCACTGGCTTACTTCCAGATATGGAGCAGCAATCTCATGTGCCAAGGTTCTACCCTTCTGAGCTCATCCCTCTGTGTCTTGGGTGAGAAATATCCAAATGGAGGAGGAACCACCTGTGAGAAGAAAGAGGACTATCTCACAAGGGTGCATGTAACAAGAACGAGACTTAGGGAGGACTAAGTCTATGTGACCAGGGAGCCTGGTGGCCTTGGGCTTTAGGAGGTCTTTGCATAGGGGTGATCCTTACATCAGTAGACAGGTATCAAGGAGGTGGCCAATGTGTGTAACCAGAGCTTGATGAAGCTGGTCACCCCTGAGGATGATGAACCCGATGAGCCAAAGTCAGTAGCACAGAAGCAGACCGAACCCAACCCTGAGGATTCCCTGCCAAAGCAGGAGGGGACAGCCAGTGGTGAGTACCCTGACCAGAGTCAGAGTCCCCGTTTCTGCTGCTGGGAAGACAGAGGTCCCGGGACTAAACCTAAAGTATCATTTACATATGTTGACTCGTTTAGTTGTTAGCCCACTCCTGCAGGCTCTGACAGCTGACTAGTGTCTGGCAGCTGCACCCAGAGCCCATGCTCTTCACCCTTGCCACCTCAAAAGACATGACACATTGCCCTTGATCTCCAACTGGGATCAGCCACCATCAAGTCATTATTGGGAACATGGTAAGAACATAAGAGCACCGAGCTGCACAGTTGGTTTGATTCTTAGCATCTGGCCCTTTCTCAGGGAGGATAGGTCAGGAAAATGCTAGTTTATTAAGTACTGGAAATTTCTACTGCATAAGTCATTGCCTTTAAACAGTCCTTCCAATGCTTTTTGACATGGTTTTCTTTTATGCTGATTGGAGATAGACTTTGCCTCTAAAGCCCTGCTGGTCTTATCTCCTGGACCTCTGCCTCAGTGTCTCTGACAGCCTCAGGGGGAGTCCTCCTTTTCAGTTAGTCAGAGAGTAAATGGATGCACACCCTGTGCAGATGGCTGAGGGTGACAGAGCAGGGTCTGGAACCTACATTTGGGCCAGAGAAACGCCATAGCCATGGCACGTGCTTACTGTGCTTGCTGACTCCTTGACGGGTTAGCAGACAGCCTTCTGCCAGGTCACAGGGCCGCCTCCTGTGGGTTTGGCTGGTAGAAGAGAAAATGAGCTACCTTGCTGGACCTATGTTGGGTACCAGGTTACAGCTGTGCCAGAGCCAGAGCAATAAAACACCTGGAGACAGAAGAGCACATGGCAGGAGCATTGGTGGAGCACTGTTGGTTCTGTGGTAGATTTCTCACCAGCAAGAGGGAGACGTGGCCAGAGCAGTAGCTTGTGTACTTTTTGACAACTCCTGGAAAGAGAAAATTTCGGTAGGTTAATGTAGGCCTTGCACAGGAAAAGCTCTCTTTCTAGGATAAGCTAGAAGTCTCAGTAATAGACAGTTTGTGAGCTTGTGCTGGTATGTGAGCTTTTTGTTGATGGTTCTCATTTTAGAAATGTTGCACAGAAGGGAAAAGTTACAAAGCAGCAGGATTGCCTGCGCCGACGATGAGCAGTGTCACATTTTTAACATTACACAATTGAAATGATGCGTCAATCCCACATCTTGATTTTCTGTGTCGGAAAACTTTCTCTTCTTGTTTTTGCTTGGTTTCCTTCCGACTTTGTCTTGACATGAAGGTTGGTGTCTCTGAACTCCCATCAGCAAGTAGAAGAGTAGTTGCCTGGGCTGAAGGGACAGTGGGCCTGGGACAGATCCTGGTTGCTCTGGGAGACGGTGGAAATACTCTAGAACTGAATAGAGCAAATCCTTTGTGATTGTACTTAGAACCACCCATTTATATACTTCACAGTGGTAAAGTTGTGTTAATCAAAATTTTGTGGTGTAAATTGTATTTCAGTTAATATATATGCAGAGGTGGCAGTCCTGCCCCTTCCTTTTTGCTTCTGAGGCAGCAGTGAACTCTCTGGAGAGGAGCTGATCCACTCTGGGGCGTGGCAGCAGCTCTAGAGTGCCCTGTGAGCTGGTGCGTTGGTAGTTTAACGGGAGAATTCTCCACTGGCACGTGGGAGCCCTGGGTTTGATTACCAGCCAGTACAGTGTCCTTATCCTTTTAACCAGCTCTTCAAAGCCACCTTCAAGTAGCTGTCTGCTGAGGAGAACATTACCCTAAACCAGAGTACATTTCAGCAGTTTGCCCTGGATTTTACTACCTCATAAACAGCATTGAAAGAGATGAACAGCAAACTTTATAGTAGTTTCTAGAAATGGGAACATCCCATTTGAAGCTTTACATTTATTCTCAGCCTTGCTCACCTTATAGCTAATCACATTCTTTTCTAGGACAGAGTCCTAGCATGCTAGTAGACAGATGATTCAGCCAAGAAATGGGCAAGTTTAGCCCATCCTTGTCTGCTCCTTCTATTCTGCCCAGGACCACCTCTCTGTCACAGGTGCCTCCTGTCTGGTCTTCCTCTTTGAGTCTCTTGCATGCTCAGCTGATGCTGATGCAGCCTGTTCCTCTGTGTGTCTGCATGTATCCAAACATACATGTACAGTTCTAACCCTCCAAACATACATGTACAGTTCTAACCCTCCAAACATACATGTACAGTTCTAACCCTCCAAACATACATGTACAGTTCTAACCCTCCAAACATACATGTACAGTTCTAACCCTCCAAACATACATGTGCAGTTCTAACCCTCCAAACATACATGTGCAGTCCTAACCCTCCAGAGCTGATTCTTCCTGCCAAAGCACAGAGCTCCTCCTCTGCACTCTCTGCCCCAGCCATGTCCACCTGCAGCTCCCCATTGCCCTGCCATTATGGGATTGCAGTGCAAAGTCCTTTCCCTGACACTGTCCTTGTGGTATTCAATGTGCCTGGCCTGATCCCACTCCACCACCACCTCACCTACCCACCCAGCCAGCTCTGTCATCTGCTACTTGTCTTGGCTGTTGCAGCACTGATTCTGGCATGTTTGGCCCTTAAACTGCTTGGCCTCCTTTGATCTCAGCCTTCCTAGCTTCCACACTTGGCCTTGATGCTTAGCCTTTCCAAAGCTTAGTTTCCTTACTTGTTGAGTGGGGTAACCCTTGTCACCTAATTTGAAGGGTGGCTGTGAGTTCCAAAATAGATGTTTGCTTGTATAACAAATACTCTTCACAACAAATGCTGTAGTATTTTTTTAAACATGGGTGCTCGTTGACTTAAATTGTAATCCACAAACCCTTTGGCTGAAAATACTGGGAGTCAATGCATTTGAACACCTTTAGAGCACTTACAGCTAGCCAAAGCCATCTCAAAGCCTGTTGGAGGCATTATGTGGAGTTTTGTAAACTCTGTATTGAAAGCAAAACACAGTTGTTCTAAGAATACCTCCTTTGCAGCATGAGGTAGTTAAGTCCTAGGACATCAAGAACCATTGTAAGTCAGAGCATAAATATGTGTTCCCATAGCAAAACCCTCTTGCTGGGCCTTCTGCAGTCTTGTTTCTCTTCATTGAATTCTAAATGAGTAAGTAGCAAGTGAGAAGGGAGGCTATACAGAGGATTCCAGTAGAGAGCTAGTGGCAGCTCCAGGGTGCTTGTAGTAAAATCCACCTGTTGGCAAATCTGACTCTGGCAGGATTTGTCAGCTCTATCTATGGGTGCTGCAAGTACAGACAAATCAGATGCAGATCTGCCTGTGAGAACAGCTACAGAGCAGGGTTACACTGACACTGGGGGATGGTCGCAAGGGCCTGTACCTGGACAAAGGAGAGGGAGCATGGGCAGTGTGCAGGCGCAGCTTCCCAGAGGTCTTGAAACAGTGTGTTTGTTTCAAACCTTCGGACTGTAAAGGAAATGCATGTTCCTGAAGAGGTGGTAGAAGGACTGCACTTGAAGTGCATCACCCAGGACTCCCCACTGCTAGCTACAGTGTGCAAGTGGACTGTAAATGGGTTGTTTCTTGGTGTTTTTGTTTTGTTTTGATGTATAAATATACACTTGTATCTCTTGTATTTTGTTTTTACACACACACACAAATGGAGTCCTTACAAGCTTGAATTTTTTCACCAATAGTACACATCTTTCCAGGTTAGTCAGCACTAATCTGCACTAATTTATTTTTTTAATTGACATTATTTTAAAGTGTACAACTTACTTGTTTTAATATCTTTTGACATATCCATTTCCAAAACATTTCTACCATGCCCCAGTGAGATCCTCATACCCTCCCCAGCTCTGTGCTGCCTTCAGCCCTGTGGGCCTGGCCTGCCTGTTGTGAGCATTCCATATAACGGAATCGTACAATATGTGCCTGATCATATCTAGCTTCCTTCACTTCACTTTTCAAGGTTTCTCCATGCTAGCATACATTAGTACTTCACTTCTTTTTATAGATGAACACTGTTCCATTGTGTGAGTAGATATTAGAGTTATTTCTTCCACTGTGTGGATATTTGGGGCTGTTTCTGTACAGTTTTTTAAAATCACAATATATGCTGACTTTCCCTCTTAGCCAGCATTGTATAATTAGGTATATTAATAAAGCCAGTCTCTGGACTGGTAATTCAAATACGTCTTTTGTCTTTGAGGATGTAGTTCATCATCTCCCAGTTCATTAAACTGTGCTTCCTATTAATGCACTGACCTTGTGTCATTACATCAGATAGATAAAGCTCTAATCTGTTTAACCAATCTATCATAAATCACTTAGCTACTTCTAATTCCATCTTAATCCTATAATCCTTGCTAAAAAGAACTTTCACGCAGAAGAAAATGTTTTTACAAACATCTGTGGTTGTTTCTTAAAGATACATTTGTAAATTTTTAAGGCTTGCTGCTGAATGCCAGGCTCTAACCCCAGCAACATGAAGGCTGAGAACCCCTGCCCTAATGTGATCCAGTGTCCATTCAGGGCTTATAGTTCCCCGTGGACTTGTGATTTATTTTGTTGGACTTTTGGATTTGTTTTGTTTTGTTTTTTTCTCCACTTAGAGCCAGGAACAAAGTACATATAGTTCACTTGACTGAATGGTCATTATATTCTGTCTGTCTTCTTTCCTTCCTCAAAATGTTAAGAGACTGGATCGGAGCTGAAGAGATGGCTCAGTAGGTAAAGCGTGAGGCCTAGAGTTTGGATCCCCAGGACTGACATAAAAGGTAGACATGGTGGCACACATCAGTTCTAGGGAGGTAGAAACAGGATCCCCAGAAGAAGTGGCTAGCTAGCCATGTCTAATCAGCAGGCTCCATATTCAGCAGAAAACATATCTCAGTACAGAAAATGAAAAGGAGGACACCTGACATCTGCATCTGGCCTCCACATGCAAACATAGGGTCGTCCACAAAAGTGGACTTTCACACATGTATTCACACAACACACACATACTTATGCAAAAAATTATACTGAGGAAGATACTGGAAATCACACAAAGGTCCTGTTTTCCTCCACAAACCACCTCCCCAGTAAGTGACTAGCCAAAGCATCCGTTGGTAGAGCAGATAATCCTGTGGCAAACTGCCTCACGGTGAGTTTCTACCTGCACCTGTCTTCTTTCTTCTTGAGACAGGCCTTTGCTGTGTCACCCAAGCCAGGATTCAACTCTGCATCCTCCCATGTCAGCCTCTGCAGTGCCAGAGTTGCAGGAGGGAGCGCCATTCCTGCCGAGTCGTGTCTGTCTGCTCTGTGTTGCTCATGGAAGGGGACTGGGTGGAAACAGAGGCTCTGGCTGAGGCGATTGGAGATTCAGGCTTGGTATCCTGACATTTTATCCACAGATATGTAGCTTCCTATAAGAGAAGGAGGGTGGACTTCAGGGGTACGGACCCTAACCGTGGGTCAGCCTGCCTTTCCCATCACTCGCTGCATCCTCTTTCCACCTGCCTCCAGGCCCTGCGCACCATGACATAAGTAGGGTGAATGCCACAACAGGCTTGGCCTGCTGCCATAGCCTTCCCTCCTCCACTCCTGTGACTAGAGAAGGCAGGTGGCAGTGTGGGCCTCTTACTTAACACAGAAATAAAGATCCCCTTTACCAGGAGGAAGAAAGACCATAGGCTATTTTTGGAATAGGCTAAAAACTTGGTTTGTTATTTTTAGAAAATATTTTATTTGTAAACTTTAAAACTTTTGAATGACAGTAGGGACAATGTTAGTCATCATCTGTAACAGAACAGCTGGATTGATGCTGCACTGTAATCCTTGGGCTATGGAGGCAGGAGGATTAAGAAATCAAGGTTGATCCTCCCTACATGGAGAATTCAAGGCCAGCCTGGGCTACATGAGACCTTGTCTTTAAAAAGTCAGAATAAAAGAAACAAAACCTCACATAAGAAATATCTATGGCTCCCTAATGTTTGATATAAATGGCTGAATGAATGAATGAGTGACAAAGAAAGGACAGCTCCTCCTTATAGAAAATTCCAGCTAAAAGCAGGAAGAGTGACTGGAGGTGTGGCTCTAGTCATGGCGCACTTGCTTAGCATGTGCAGGAACCTGTAGAATGGGGCACTTCCCACGTGAGTCCATAGTGCTGAACTGACCCTGGGAGGGCCAGTGGCTGCAAAAGCACTTCCAGTGTGGAGACGCCTGAGCTCCCTCCCAGCCTTCCATGGCAGTGAGGCATCTCTTAAATGTTCAGGCCCTGGTGAGTGAGCGAAAACATCTTACTCTGCAGTCAGACGATTTCCTGCAGTTCCTGGCCTCTTAGAGCAGCTTGCCCTCCTCAGAATGCTGCACAGTGACACCCAGCCCTGGGCCTGTTAGAGCAAATCTTCTGACCTTGCCTGCCTTCTTCACCTCTATTCTGACAGTCCTGGCACCGTCAGCCTGTCACAGTAAGTGAGCTAACATCTGTTGCCTGTTTACAAGTGTTCCTCAATGCATCCCAACAGCCATGGAAGCATTTGCTACAGAAATGAATAAGCTGCTTTGTCAAGAACTTGAACATTCACCTTTCAGCTGCTTTCCTTTATTTTATTTTATTTGCGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTACATGTGTACACATGGGTGTGCAACAGAAACCAAACCCTTGGCTTCATTCATGTTAGGCAGATGCATCCCTGAGTGACTTTTCTTGGCTTGACTTGGAGAAATTGTTTGCTGTGTTGATTCTGTGTTGGTTCTGACAGTGAAAGCATTATAAATGTATTCTCCCAGCAACTTTAAAATCAGGTTTCAATTTCCATTAGCTTCTCAGGTCTTTTCCTTTATAATTTTTGCCTGTTGGCCTGGTTGAGAAATTGTCACCATGCACCCTTGTCAAGAAATTTTGAACTCAAGCCTGACTGAGAAGCACTGAAAATTTAGAATACAGGGGGCAGGTAACTGTGACAAAAATCCCAGGCAGAAACTATGACAATTTTTTCTCCGTCTCTGTCTGCCCCCTGCCTCCTCTTGTTCTTTCTCAGTGTGTGTGTGACTCTGGGAAAATCACAGGCTCCTGCTATTGTCTGGTTTAGAGCAGTCATGGAGGTATCCTCAGTTTCTCAGCCCCACACGACTGCCACGCCATAGTCTATATATTCTCCTCAGTTTAGAAGATCACTTTAAGTGTACAGAAAATGAATAAAGAGATCCTTATGTATATTCTCTGAGCTGTCTGGAAATATGTTAGGACACTGCTGACCCCATTTGTCCCTTCCTGTCCCTTTGTAGGTAAAACTCCACATTACACCAATTGCTGTCCTCTGAATCACCTCTAATCTTGACAATTATGAAGGGCTGGCTGGTCACTTTGCTGACCACCTCTCCACATGAGTTGGACTCACATTTCTCTCATGCATCCTGAAGTTAAGCACTTGGGAAAGATGCAATCGAAGTACTTTGTCTGCAGTGCATCCTGTTGGGGCTGCATTGGCTCAGCACTGAATGGTGGTACTGACCCCTTATCTGAGCACCTCACGCTGCTGACCCCTCCTCCTTTCCTTCATGCTCTGAGCTGTGGCCATTGCCTGGCCAGTACTGGGGTTAGAAGAGAGCCCACTGGCAGCCTTCCAGATGCGCAAAGTCTTGGCTCTTTAGATAACTTAATTAAGCGCCAAAGAAAAAGGTTGGGATTATCTCAGTCCTGTCCTGCTTGAGTTTTGCAGCAGAAAGCTAAGTATAGTAAAGGTTTTGAATTGGCCACATGCTAAGGGACTTGTGCAGAGTTCAAGGTTACAATTCTTTCCCAGAATCATTTTAACCCTTTTATTGAGGTTTTGTAGACTCTACATACCCAGCTGAACATGTACAATTAGCAACTTTTGTTCATTCACTGAGTTGTATAATTATCACAGCCAATTTTAGGACATCATCAACAACCTAAAGTCCTTGCCCATCACACCCCATACTCCCAAAATTCTCCAGCACTCTGTAACCTCTAACCTACCTTCTGTCTCCAGACTCGTCTATTCTAATCGTTTCCAGTGAATGGAATCTTGCTATGTAGTTTTGGAATTGGCTTCTTTGACTCAGCATGTCAAAGTTCATCCATTATATAACCTGTTGCTCTTTATTGCTAAATAATATTTTAGTTTGTTTATCCATGCATAGGCATGTGGGCTCTGCCCACCTTTTGACTATGGTAGGTGGTCACACTAGCATAAGATACAGGATACAGACTTGCATTGCTCTTGGGTGGGGCTCTTAGAGGGCACACAGGTGCCCACAGCTGCTGGGCACCTGTGTCTAACTTCTGAGGAGCTTCCAGCCTGTTGTACAGCCTGTGGCAACACCACTTCACATTTCCACCAGTGATGTGTACCTAGCCAACACTCGCATTTTCTTGCATTTCGTCATTAGCCCTCCTTGTGGATGAGAAATAGCATCATATTGTGAACTTGACCTGCATTCCCTGCTGGCCACGATGTTACATAACCTAAGTCATGTACAGCCACTGCCCTTGGACCTTCAGACCTTTCTGAAATGTCCCATTTGTATTCAGCATGAGTGTGTCCCCAGCTTGTGAGAGCCCTGAGCCTAGCTGAGCACTGGGGCCTGTAAAAGTGCTGGATCCTTGGCTTCCTTCTCAGGAGCCTCAGTGGAGGAGTGGGTGCTGAGGAGGAGAGAACAGGGTCTTGTCTCTACAGACAAGTAGGCAGGCTTCAGGAAGCATCACCTTGTCCCTCTTCTTCCCACAGGAGGTCCAGGTTCCTGTGACTCCAGCTTTGGAAGTGGCATCAATGTCTTCACCTCAGCCAAGTAAGTGCTTTGTGAAAAGCCAGTGGTCTAAGTCTTTCTGGGTGCAAGAGATTGCAGCAGAGACCCAAGGAAACTGTCTGAGGCCACTCTTGGGGGAGTTTCTGATACACAGAGGAGATACTTGAGGAAACCTGAAGGGCCACAGGCACCCTCTCCCCGGTGCCTCTGGACAGAAGGCCTTTGGGAAAGATGGGAAGCCACTGGAGGTCTGTAGATGCACATCCTAGAAACCCAGCCGTGTGTGGTGATGGCTTTGGGGCTGCAGTTCCCTTTGCCAACATCTTTTCTTTATCCAAGGCAAGGCCGACTCTGGGCAGGGGAGGCATGGAGAAGAAGAAGGAAGGAAGGGCACAGCAGGCGAGAGAGTGATCCAGGCACAGGCACCAGAACGGTCCCACCTTCTCCCAGGATAGGTGTCATAGGACAGGCTTCCACGGGGGGGCAGTGCAGGCCAGGGAGCAAAGTCATAGCCTGCCTTGCCAACCCCTTGGGAGAGAACTGTCATGGTTCTCCCGTGGGCTGTGTCTGCTGACCTGCCTGCTGGAGCTGCTTCTTTGAAGCATTAGCACCTGTGCCTAAGGTGGATGACATTTCTACAGTGATTTCCTCTGAACTCAACGTTGAGCCATTGCCTGGGGAGCCAATGGAGAAAATGTAAAAAGTCAGCCCTTAAATATGATCCTGACTTCAATACACTTTAATGGCAGACAACACAGTAACCAGCAGATTTCTAGGAGACAGGAGAACTGTAAAGGGGTAGGGGACCAAGCCACTGTGAATGGTGAAGTGCTCCCACAGCCGGGCTCTGTGCTTACCTTGGTCAGACCATTGGGTCTGCTAGTCCTGGGGTTGACAGAACCATTATATCTATTTTAGGGATGAAGAAGATTGAGGAAATAGGCTACTCTATACAGAATGGTTTTAGGGGAAGGTCGTGTGGCTGGGGAGAAGGGACAACAGCTTAGACTGAGAAGCTGGCAGGATGGAAGATGTGTTTGAGAAGGAGGCTTGGCAGCTTTTCCTATTTGTTTTGTTTTTTGTTTGTTTTCTCGTGTCTTTTTATTTATTTATTTTTATTAGATATTTTCTTTATATACATTTCAAATGCTATCCCGAAAATTCCCTATACCCTCCCTCTGCCCTGCTTCCCTACCCACCCACTCCCGCTTCTTGGCCCTGGCATTCCCCTGCACTGGGGCATATAAAGTTTGCAATACCAAGGGGCCTCTCTTCCCAATGATGGCCGACTAGGCCATCTTCTGCTACATATGCAGCTAGAGACAGGAGCTCTGGGGGGTACTGGTTAGTTCATGTTGTTCCACCTATAGGGTTGCAGACCCCCTTCAGCTCTTTGGGTGCTTTCTCTAGCTCCTCCATTGGGGGCCCTGTGTTCTGTCTTATAGATGACTGTGAGCATCCACTTCTGTATTTGCCAGGCACTGGCATAGCCTCATATGAGATAGCTATAACAGGGTCCCTTCAGCAAATCTTTCTGACATATGCAATAGTGTCTGGGTTTGGTGGCTGATTATGGGATGGATCCCCAGGTGGGTTAGTCTCTGGATAGTCCATTCTTTCATCTCAGCTCAGAACTTTGTCTCTGTAACTCCTTTCACAGGTATTTTGTTCCCTATTCTAAGGAGGAACAAAGTATCCACCCATTGATCTTTCCTTTTCTTGATTTTCTTGTGTTTTGCAAATTGTATCTTGGGTGTTCTATGTTTCTGGGCTAATTCCACTTATCAGTGAGTGCATATCAAGTGACTTCTTTTGTGATTGGGTTACCTCATGAAGGATGATATCCTCCAGATACATCCATTTGTCCAAGAATTTCATGAATCCATTGTTTTTAATAGCTGAGTAGTACTCCATTGTGTAAATGTACCACATTTTCTGTATTCATTCTTCTATTGAGGGACATCTGGGTTCTTTCCAGCTTCTGGCTATTATAAATAAGGCTGCTATGAACATAGTGGAGCATGTGTTCTTATTACCAGTTGAAACTTCTTCTGGATATATGCCCAGGAGGGGTATTGCTGGATCTTCTGGTAGTATTATGTCCAATTTTCTGAGGAACCTCCAGACTGACTTCCAGAGTGGTTGTACAAGCTTGCAATCCCACCAGCAGTGGAGGAGTGTTCCTCTTTCTCCACATCCTTGCCAGCATCTGCTGTCACGTGAATTTTTGATCTTAGCCATTCTGACTGGTGTGAGGTGGAATCTCAAGGTTGTTTTGATTTGCATTTCCCTAATGATTAAGGATGTTGAACATTTTTTCAGATGCTTCTCAGCCATTCGGTATTCCTCAGTTGAGAATTCTTTGTTTAGCTCTGAACCCCATTTTTAATAGGGTTATTTGAATTTCTGGAGTTCAGCTTCTTGAGCTCTTTGAATATATTGAATATTAGTCCCCTATCTGATTTAGGATTGGTAAAAAATCTTTCTCAATCTGTTGGTGGCCTTTTTGTCTTATTGACAGTGTCCTTTGCCTTACAGATGCTTTGCAATTTTATGAGGTCCCATTTGTCAATTCTTGATCTTACAGCACAAGCCATTGCTGTTCTGTTTAGGAATTTTTCCCCTGTGCCTATATCTTCGATGCTTTTCCTTACTTTCTCCTCTATTAATTTCAGTGTCTCTGGTCTTATGTGGAGGTCTTTGATCCACTTAGACTTGAGCTTTGTACAAGAAGATAAGAATGGATCAATTCGAATTCTTCTACATGATAACTGCCAGTTGTGCCAGCACCATTTGTTGAAAATGCTGTCTTTTTTCCATTGGATGATTTTTAGCTCCCTTGTCAAAGATCAAGTAACCTTAGGTGTGTGTATTCATTTCCATTGATCTACCTGTTTGTCACTGTACCAGTACCATGCAGTTTTGGCAGCTTTTCTGATGGACAGGATGGAGCAGATGAGAGGGATGGGAAGGGCGGCCTCTAGGTGTTAGCTAATGCTAAACCAGATTGTGCTGGCTCATTCCTAAGTTGGACTGCAAGGAGAAAAAAAGTGTGACTCAGACTATCTAGACTCCACCCAGTCATGCAAGGCATCCTCAGGGAGGAAGCTCAGTGTGGACACTGGGTTTTGGAACTCAGGGTTGGAGGAATGGGCAGGCATATAGGGCATACGTGAGTCCGGGAGGTCTGAGCACTGGGCTCGGAAGAATGGTGGAGTCTGTAAGGGGATTTATGAGCTCCCACTTATAGCCAAAAAAAAACCCTGTCTGACTTACTTAGCACTGTACTCTGGGCTGCAGAGACTGTCATGCTTCAGGGGGTGACAGTGAAATGGAGGAACATATACGGTGTGACTGATGGACTGCAGGGGTGGCACAACCTTCTACCACTTCTCTTTCAGTTTGAAAACATGCTCAGCTGGACAGGCCTACAGAGACTTGATTTCTTCTCTACAGGTCAAACCAGCGAGCTGGAGCTAGTTTAATTCACCATACCTGTCACTCAGGAGACAATGCTAAACCTAACCTTTTAAGAACACACGCAGGGAAACAACACACCATGTGCTCCACTGGTGCAGGAAGACCATCTTGTGGCAGCATCGTCGAGTGCAGCCCTGCCTGTGCTTAGAAGCAGCAGCCACAGGAATTATGAGAACAGATCGGACATTCAGAGCCTCTGGCCAGCTCCCTCCAGGGCCACTGAGCTCCCACAGATGGCATCGTTCAGGGTGTCACAAAACAAGCTGCCCTCCCATCTTCTCATGTGTTGCTTATCCAGAGCACTACCCAGATAGCCAAGTACGAGCAGTGGTTAGAGGGAAGGTTGTTCCTGGTCACTGGCCTCTTAGTGGTCACCAGCCTTTAGAAAGTCTAATGACAGCTGTGTAGGAAAGTACACACCCACACAAAATTCCGAATCCATAGACAGTCGGGGAGTCAATGCACTAAAGCCACAGATGCCTTCTGCCCCGGTCTGGGGCCCAGGCTCGGCCACTAAGAGAGCCACTGAGTAAACAGGTAACATCTCTGTCTCAGTGGATAGACAGTCAAGCAACCCCCGTCAAAGGGGTCCAACCTCCTCTCCCCTCCACAGTGCTGGAGCTGTATGGGAGGTTGAAGACAGCAGAATGGAGAAAGTGTGGTAGAAAGCAAGACAAAGCTGAGGGAGGATTTCACCACTGCTGTCTGTCTGTATGCCAGGTGCACCTCTCCTTTGGAGAGAAGCCCTCTGGGGTTCTCATCCTGTGGGCTGTGTGTAAACTGTTGGGGTAGTGACAGCATTGACCCCAGAGAGGAATGGGATGTCAATGAGTTAGTTACATATGTGAAAAGCCTGGAGCAGTGCCTGGCGGACAGCACACACTTGGTTGCACTGGCTACCTTGGTTATCACAAGAACCTCCTTATCCTCATAATCAAAACGAGGAGAGGGGACAGAGAGGTTAAATTTTTGTTGGAAGCCACCCCGCTAACTAGTGATGAAGTGAAGGTCCAAGCCTTTCTGGCTCCATATCACCAGCATTTAGCTTGCCGGATTATTGCTGGATAGCTCTAGGAGGGTGCTCATTGGCCTCTCTGACACATTTGGCAGGTTTTTGGACAGGTGTCACTGTGCAGACCTCCCCCCTGACACCTAGGGCCTTGCCAAGAGCCATGGTGTCACCAATGACCATTCAGGACTATTGTCCTGGTGTGGTTGTCTTCCCTGTGCCACAACCTGCAGAAAAGTCTAGAAGCTGATGCTGCCCAACTTTGAATGACACTGCCAGTTAAAAAAAAAGGCTGCACTGACCTGATGTCTTAGAAAGGCAGCACTGGATTCCTAAGCTCTCTCTTCACAGTTACCTTTCTTCAGTTTGATGTCAGCTATAATGTGAGTGGAAAAGAAAGTTATGCACTTCAGAAATACAGTGCTGCCTCCCAGAAAGACCCGCTCACTGGGTGCTGTGGCGTCAGAAGCATGGCTGGGCGATCCTGTGCTTTAAGCGGCAGCAGTGCAGTACACGTGGATATTGTAGTATATGTTCATGTAAGACTCATTTTTTGCTGAAGATGCCTTGAAATAACTCGGAATCTCTTAGGAGTGACTTGTCTAGACATATTGGAACCGGTATAGAAATGTATTTTAAACCTCCTGTGAGTACTATTCTGTTCATGATAGCTTAGCCAGAACCAAGGACATGCATCTCAGGCTTGGCCCAGTAGAGGGAAGCCGACCACTTTGGGCAAGCACACCCCACTCTGGGAAGGTCTCACAGCTCCGGTTCTCCACAAGCACGGGCAGAGCTCAGCAGCCAGCACCACCCACCAGAGCCGCCTGCTCAAGGGCAGGTGGGATCCGGAGCTCACTGTGCTGGCCACAGAGATAAGTGTGCAGCTGCTTCCCTCTTCCCGTGACCTTCACCTTGAACTAGCCGAGGGAAAACAACTCAGGAGCATGTCTCCAGCTAAGAGAGTGAGTTCTTAGCCCTTGGCCTCTTGACTTGGGTGCATCTCACTCTGCCTCTGGGCCCAGGACTCCTCCTCTGTGCATTGGCAGATGGCCTGAAACTTGAAGTTCCTTCCATGACCTCATGATTGTTGGTTGAAGCTAACACCTTGCTAGGGATTGGGGGAAGAAGTGTCATTGAAGAGTGTCATCATCTACAGCGCTGCCAGCTTGCTTTCTTTACTATGTGGTCTTGACATGGCACCAACAACCTGAAGGGATGGCCAGGGCTGGTTCAGCTGAAGTGTAGCAGTGGTCTTCAGGAACACGCACGCACACACACTCGCACACGCACACACACAGCATTCCGACTGCCCTGTGACTCCTGCTGGAAAATGGACCTACTGTAGACCCTAGGGCATGGGGCTATCAAAGAGTGGCTGAGAAAGGGCAGTTACCCTTCAGTATCCACCTGCTTCGTTAAGGCCCTGGACTGTGGCAAGCATCCACTTTACCACTGAGACAGCTGTTCTAGCCATAAGATTGTATGTTGATATGCTAATGCCGTGGCTTAGTTAAAACATGAAAGCTAACTTCGGCTTGGAAACTAAAAATTGTCGAAGCCCATCCGTGCTTCAACTGTGTTTCTGTTGGACAGAGAACAGGATAAAGGGCTTGAATGGCCACTGTTTCTGCCACCCTGGCTCTGCCTATCATTTGCTGCCAAAGCCTTGACAGTTTGAAATGTTCAAAATCCATCAGGAACTCCTAGCCATGTGACTCCTGGAATAGCACAGTGGCTGCCTTCCTCTGTGCAAAGGCTCTATTCTGGGTTCTGTCACTGTGTCACATACTGAGATCATCCGATCCCCTGAGAATGGAATGCCCACACTCAACCCTGAAACAGGCACCAGAGAAATACCAGTGTGTATTAAACAGCAATTCTGCCTCGTAGTAATAGAGCCACGCCCCTTAGAAGTCATGAGCTTCAGAGAGTCTGCAGGTGCATGAGGAAAGCACGGCCATC
G5 113152302 113152351 50 ATAGGAGAGTTTCTAGGCCAGATATTAACTTCAAAAATGAGTTCAGCCAA
U5 113157856 113157905 50 GAGCCAGCAATTAAGAATCTTGTTTTCATACCCCACTCAGAATGATGAAA
U3 113157936 113157985 50 GTGCCAAGCCTTGGCCCAGACTTCAGAGTAGGGTTTTGCCATTCATTTAG
D5 113160979 113161028 50 AAGACAGAGGTCCCGGGACTAAACCTAAAGTATCATTTACATATGTTGAC
D3 113161081 113161130 50 GCAGCTGCACCCAGAGCCCATGCTCTTCACCCTTGCCACCTCAAAAGACA
G3 113165232 113165281 50 ATCTTAATCCTATAATCCTTGCTAAAAAGAACTTTCACGCAGAAGAAAAT
G5_U5 113152302 113157905 5604 ATAGGAGAGTTTCTAGGCCAGATATTAACTTCAAAAATGAGTTCAGCCAAAGACCCCCCACTTCTATCTCCCAAGCAGTAGATGAAAGCCGAGGCAGCCTGTTGTCTTTGAAGAAGACTAAGCCTGAAGCTGGGGAACCTGCTGTTGAACTTCACTTACTCTGCTCCCCTTGGGGTTGCTTTTCTTCTCTGCACTGTCCCTGTGAAGTCATGAGACCAAGGCACTGGCTGGCTGAGGGCACAGTTTTAGAGTGCAGCTGACCCTCAGCAGGAGCACTTCAAGTCCATGGTGTGGGTGTGTGTCTGTGTGTATGCGCGCGCGCGAGCAAGTGCATGCACGTCTCTACAGTCAGCAGCCGTGGCTATAGAGGACTGGGCTCTTCTCAGTGTGCGTTTTGAGTTTGCAGGAAAGGTGCCGTTGCTCGTGCTAACTTGTGGTAAGGTTAGAAGGGCCTCAGCACTGTCAGAAGCTACATCAGTTAACCCCCAGGTCATGTTTTCCCATGCAAGCAACATGGCAGCACAAGGCTTCACCCATATTTGCCCTACAGCTGTGCCCTCATCATCTCTGCCAGCCTTCGAAGACTGACTCCACTGGCGGGTGTTTACTGATTGGCCAGCTGTTGGATGCAAAAAATTGGTCTGGAGACCGCTGGTACTAGAATTGCAAAGTGGGCAGTGCCCAAAGCCCTGATCAAGCTTTATGGAGGTAGAAGGTGGTAGATGGTGGCACCAATCAGTACACTTCTGGGCACTAAGTGCTTCTGAGTGCCAAGGAGGACTAACACCGCACACCATGAAAGTGCAGGAAGGTGTAGAGGCAGGGCATCTGAGGAGGACAGGCCTGAATGTGAGAGGAGCAGGCCCCCTAGGAAGCTGCAGCTGGTGGAAGTGGGAGAGGGAAAGTGGGCAGGCTAGAAAGTCATGCGGCCTGTTTTGACTGCTAAGGGTGGCCTTGATTCATGAAACAAGATTGGCCCAAGGGTTGCCCTTGTGCTGTTTGAGCTCGTAATACTGATGAGAAGGTGCTAAAGTAGTTTCCCCTCCAGGGGGCGCAATTGCTTTGCACTTGTTTTCCCAGAAGATACCGAAACTTATACTTAATGTAATGGTCCCTGTGGTCATGGGTCTTTAATGGCCTTTGTTGTGACCTGGGGTGACTGAATTAAGCCCTGATAAGTTTCCAAGTTGGTGGGAGAAAGGTGCCACTGAGCTCATGAATTGCCCCCACCATCCATCTTCTTTAAAACCTCCTGTTATTGAAAGTAGTGGCTCTGGCACCAAGGCCACATGCCTTCTCCCCTTCCCTGTAGATCTTTGTGGGAGCCTGTGCTGTCTTCAGAGCTTCCTTACTGCCTCTCAAATTCATCCCCCGCCCCCCAACTACAGATCATTCTTCAGGATCCCATCCAGCCGCTGCAGGCCACTTTCCATGGCTCCTCATGGCCACCAGAGGGAGATGGGAGGGATTGCTTTGCCAAGCCTTCAGGATTGCCAGCTGTTTGCCCATCTTGCCTCAGCCCAGATGAACACCTCCTCACACTTCCGAACCCTCTCCCAGGCATACTCACATAGGACCACAACATAACTCGCCGATTAGACCCCAGCTTTCCTGCCTTCCTCACCTTGCTGTCCACTCTTGATGGGTTTGTACTGTCATCCTCCACCTACCCCAGCAGAGCATCCTTCAGAGCCAGAGAATGAGTCTGTGCAGGGCTGACATCTGGGAGGAGTGCTCCCCAGCTGCTCCATGAATGTCCAGGAATCTGTAAAGGACAGGAGAGGAGCATGTCTCAGGGATGACTGGGAGGGAGACTGGCTCTCCTCTTGAGTCCTGGCCTAGCCTGGACGGTATCCACATTCCAGGTGCTGCTGCGCCTTGTGCAGGCAAAAGCAGAACTCAGCTTCTGGGCAGGAGTGGGAGGCACAGTTACTCACTCTCAGTAACTGTGTGTGGTATAGCCCCATGTTCTTGATCCTTCAAGAAGACTCACGGGTTCTGGATCTCTGTGGAATTTAGAAAATGCTTTTCCATGAGGAACATTTAAAAACAGGCCAAAACCAAGTCATTTCCTTTTTTTTCTTTTAATATACTTAAAAATTTATTAGGCAGTGTGAAATTTTCATCTCTTAGAATTAAAAGGATTGCTACTGCATTGGCCGGGAATCGAACCCGGGCCTCCCGCGTGGCAGGCGAGAATTCTACCACTGAACCACCAATGCTCCAGCTGTGAGCAGCTGTGTGGCACCTCCCTATAACCTCATCCCTGGGCCTCCATGTGTATATGTTGAGTCATAGCCCAGTTTATGATACTGCCACATCAGCTTAGCTTCAAGAAGAGCAGCAAGCTCCAGAGCCAGAAGGAAGTGAGGGGTGAGTGTAGGTCTGTGTGCATGTGAAGTAAATTTGCCTTTGGGCTTTGAGACAGGAAAGAGAGCTCCACTCCCTCCTCAGTCAGCAGCAAAACACAGAGACTGTGGGCGAGCCTCCCCTCTGCCGTGGAGCTGGTGTGCTGCTCTCAGTTTTCACACTGCGTTCTGCTGGCGACTGGCCCAGACCAAGGGCAGCACTGTGGAGTTCTTTCAGGTGGAGATGAGGAAGCCAGACTCCTGCAGCCAGTCACACTTGTCAAAGAGCCCAGCAACTCCCTATGAACTCTGAGCAGAAATCTGTAGTCCTTGGGCTGCCTCAGGCCTTGTTTGGTTGAGGGACCAGGCTCCTCTGGCATGAGTTCTGTGAGGAAACTGACCAGAAAGGGACCCACACACCCCCCAAACAAATAAACAGTAATAAAGCAAATAAATTTTAAAACATAATTTTTTTTTAAGAAAAGAAAACAAGCTCTGCATTGGCCGGGAATCGAACCCGGGCCTCCCGCGTGGCAGGCGAGAATTCTACCACTGAACCACCAATGCTCCAGCTGTTTGGTGTGGTGTCTGTAGAGCTCTTCTCAGGGCTGTTTCATTGAAGAAACACTGGGCTTCACCTGGCTGGTTTGTCCTGTTTGGGAAACCGCACAGGATTGGTTCTTTCCCAACCTTCTTATAAGCTTCTGAAGTCAGGGCCTATGATCTGACAGCTCCTCCCACTTAAAAGCCCTTGAGTCATCTGTAACCCATAATGATGTCCTTTCCTACTGTACATGATCCTGCCTTCCCATTTCTTTTCAGTAGGCAAATGGAGCAATACACCCACCTTCCTTTCCCTGGGCATTGTCTGTTAATGTTTCTAAAGTAATACCTCAGATGGGACTGCCCTGTCGCCAGTCTCCTGGACAGAGATAGCGTATTCTGTTTCTGTGACATCACTACTCTATTTTGCTACAATTTTGTGTTTGTGATTTGATTTTGCCATGTGTCCCAACATAGATACAGAGGAGTCCTCAGATGCATGAGTGCAGAACTGAGCAAGTGTTTGATAAAAATGGGTATTAGCTTTTTTTAAGACAGTAATTTACATTCTCTCAGATTCCCAGAAGTAAACTGGCCCCACTACTCCTCACTGAACGCTGAGCAGGGCAATGGTTAGGACCTACCCAGCAGCAGAACCGAGAGGACCTGCCCTGGAGCCCAGACAGCAGAAGTAGCCCGGGTTTGTGTGTCCCATGCTTTCTCTTTCCTCTTTCCAGGCTGGTGCGGGACTTTGTGGCCCAGAACAACACCATGCAAATCAAGCACGTGATCCAGACCCTGTCTCAGGAGTTTGCCCTGTCCCAGCACCCCCACAGCCGGAAAGGGGGCCTCATCGGTCTGGCAGCCTGCTCTATTGCCCTAGGCAAGGTATGTCTTCATTCTGATTGAGGTGACCAAATACCTTCCTACCTGAGCCTCAGCAGGACCATTACAGATGTGTATTTTATCAAGACTTCTGCATTTAGGACTACTAGCAAATATCACCGTGTGGCCTGGCAGCCATGTCCCCATAGTGTGGTTCTACTTCTGGAAGGTTGGCTTGGGATGAGTGTTTTTAGCTCAGCTCTCACAGAGGCCTGAGCGTCTCCAAGGGAGGGGACTAACCCTTCTGACTAGTCCTGGCTGCTCGTTACAGGACTCAGGGCTCTACCTGAAGGAGCTGATAGAGCCAGTGCTGACCTGCTTTAATGACGCAGACAGCAGGCTGCGCTACTACGCTTGTGAGGCCCTCTACAATATCGTCAAAGTGGCCCGAGGTGCCGTGCTGCCGCACTTCAATGTTCTCTTCGATGGACTGAGTAAGGTAACTTCTGATTCAGCTAAGAACAGCCCACCTACCTGACTTGACTTTCTAGGACCCTGAGAGAGAGCTTGGGACAGATGCAGGCAGAGCAGGAGCAGACACTGCTGCAGGGGACACTTAATGCCCAGGTCTGATTTTTCATAGACCTGTATCAGTGTATCGTTAAGTCCCGTTCACCCTCATTCCACTCTGTGGAAATGTCTGCCTGCTGTACACATTATCGGAAAGGCTCATAGTTTGAGAAGCACTAACCTCCCAGGCAAAGGTAACAATGATGACTCCACAGTACAGGCTGTCCCTTTGAAGGACAGTCATGACAAGCTCCCTGTGCTAAAGAGTGATCCCCTATAGACCTTTAGGGTCCCTATTGCTGTCCTTCTTGGCTCTCAGTCTGGTGGGTTGCCTTTCCCCTCACCCTGGTGGGGATGCTCTCTCCTCAGCCTGGGGCAGTCACCCTACTCAGTTGTGCAGAGTGGCCCCTGTAGAATGAACAACATGACCATTTCTCAATGCCACCCTCACGGCTGTCTCGGGGGCCCATGAGAGAACCAAGCCTTTTAAGATAAGCGTGCCCTGGGAGCAGCCAGTGGGAACAACCGTGTGACCCAGTTCCAGCATGGCCTGGGAACCCCAGCAGATCTTGGGTTACCCCTGAACAAATGGGAACTCTCCTGTAACTGGTTGTAACTACCTTTCTCAGTCAGACACTGGGAAAGACACCACGTGGTGTGCTGATCTGCATCATGGCCTTGGCTGTTGCTTTGCATTCGGTCTCTAGGCTTACGTCTCACTGTGACTGAACATTGCCTCTGTTTCTCTGTTTTGGTGCCTCATAGTTGGCTGCTGACCCAGACCCCAATGTGAAAAGTGGATCTGAGCTCCTGGACCGCCTCTTAAAGGTACCCCACTCCAACCTTCTTGTATTTTAGACTTTATTCCCTCTGCGTGTAGAGTAGAAATTCTGGTGGTTTTCCTCATGTAAGTTGTTTTTCTATATAGCACACACATATTAAAGCTCACTGCTTGGTATGCAGTTTCTGTGACATATGTAAAGCTGTGTTACTACCACTGTCAAAGTACAGAACTGGGCTGTCCCCCTAAGTGAAGATCTTCTGTTTGGGGTGGGGATTGGATATTTTATGTATATAGGTGCTTTGCCTGCTTGCATGTCTATGTCTATGTCTATGTCTATGTCTATGACCTGTGTGCCTGGTCACTGCAGAGGTGATAAAGGGATGTCATATCCCCTAGAACTAGAGTTCCAGCTGGTTGTGAGTCTCTGGGGTGCTGAGAATCTAACCCAGATCCTCAAGAATAGCAGCTAGTGCCCGTAACTGCTGAGCCAGCAATTAAGAATCTTGTTTTCATACCCCACTCAGAATGATGAAA
U3_D5 113157936 113161028 3093 GTGCCAAGCCTTGGCCCAGACTTCAGAGTAGGGTTTTGCCATTCATTTAGGTCTATTGACTTCTCTGCTGGCCATCCATTATTTTGTTAGGCTTTGGGCCTATCACAATGCCGGTTCTCCAGGGACCTCTCCTACCTGGCTTAGGCTCTGCCATTTCTCTCCATGGTTACCTGACCCTCAAGTGAGCCCAGGGCCAGCAGCACAGCAAACCCACTGCTGGCTTTTCATAACCTCACTCTTCAATCCACAGGACATTGTGACAGAAAGCAGCAAGTTTGACCTGGTGAGCTTCATCCCCCTTTTGCGGGAGAGGATTTACTCCAACAACCAATACGCCCGACAGTTCATCATCTCCTGGGTATGGCCCAGTCCTTGGTAGATTCTTCCAACAACCAAGAGTTTCTAGTGGAATCATGTGGACTCCACTAGGGGACACACAGTGATTATTTTGACTAAAAGACACCTCTTTGTCTCTACCTCTTAATAACCTTCAAACACCTCATCACCAAAAACACTGTGGGTTGGGCATAGTGGCACATGCCTTTATTCATAGCACTTGGGAAGCAGAAACAGGCAGAGCTCTGTGAGTTCAAGGCCAGCTTTGTCAATAAAGCAAGTTCCAGGCCAGTTAAGACCACACAGTGAGACCTTGTCTGGAAAAGCACTCTGTCTAGAGTAGTCTTACTGCACGTCCTGTTTGCCCTGAAGGGGTGTGATTCTTTCCTTGTCCTGAAACTGCCCAGGATCTCGGAAGCCCCTGGTGCCACATCCAGCAGCTCCACCTCTGTGAACCGTCTAGCTTCATCCAGCCCTCTCGATTAGTCGCCCTCTCCTCTAGCACCCAAATCCTCCTGGAGTCAAACTCCCACTTCCTTGCACATTGAACAGAAAAATTCCTGCAGCACTGCAATGTAGATACTACAATGCTGTGACACAGGACCCTAGTCCTTCTGCTGCTGGTCCCAAGGGAAGAGTAGGAGACCAGGCTACACCTGGGCCAGCTCTCAGCTCTCCCTCTCCTACTCCCCTCCATCAGATCCTGGTTCTGGTGTCGGTGCCAGACATTAACCTGCTGGATTACCTGCCAGAGATCCTAGATGGGCTCTTCCAGATCCTGGGTGACAATGGCAAGGAGATTCGGAAAATGTGAGTTGTGGGAAACGGCAGGCAGCTGCCACTCGCTCGAGTGTCTATGGGAACTTCTTCCTATATCCTTCCCCATGGAGGAGTAGAACGCTCACCTTCCCAGCCCCTGCTCAGTGTCCTCCTGACGAGTATAGGGTTGACCCAGAGCAGAAATGGGCTTTCATGCTAGCTTATGCTTCCTTTTCTCACTGGTAGGTGTGAGGTGGTTCTTGGAGAGTTCTTGAAAGAAATTAAGAAGAACCCATCCAGTGTGAAGTTTGCTGAGATGGCCAACATCCTGGTGATCCACTGCCAGACCACAGGTGAGTGTGTGGAGGCCCTGTAGCTACAACTGCTGCCTCAGAAGCCCCTGTCTCTCATATCTAGACTTCAGTATGGGGCAGAAGGGGGACCCATGTGGGCTAGCCACCACATGTGACTCTGGATCTGGAAGCAGTAGGGTGGTGGGTGTGAGAAGAGATCTATGTTCTCCTCTGATAAGCATACACTTTCACCTGGCCTGAAGACCTTGTGGATGTGCTTTGCCTTAGGTAAAGATAGGACGTGTGGAGGTCAGAATTGCCTTTCCCGCAGCATCTATTGGCTGTCAAACCACATGAAACAGTCACAGCAATGGCTGCTTGTTACTGGCCAAGAACCTCCAGGTCAGCTAGGTGACTTTGCTCCCATGTCCAGGCTGGTCATAATGATTTCAGGCTTAGTTGGAGCTAGGTGTGGTGTGCAGTGACCCACATCTGACATGGGAGCTCAGTATCCAGTAGGTTGGATGGCCTTAGCAGGGTTCCAAGAGACACAGGACACAGACATTGTCAGGACTCTTGATTCCTATGCTTAAACCAGAGACACAACTACATGCTGTTGGCCAGAGTAGCAAGTTTTCTGGGTCCAATGATAGGAAAATGAATTCCACTTAGAAAGGAAGTGTGTCATATTACAACAGGCAAGGGTATCGCTGCTGTTTTCGAAATCCAGCGCAAGATTTTCACTCTTAACCTATCCTTACAGCCCTGTAGAGAGCAGGGAGCCCAGGAAATGTTGTATTCATATAGCTAGAAGCAGTCAAGCCTCCAGGCCTAGCCTCTGTGCTTGGGAGGTAGGAGGAGCTCTCAGTGTATGTGCCAGCCCCACCAGAAGCCACCAATTTCTCTTCCAGATGACCTGATTCAGCTGACGGCTATGTGCTGGATGCGGGAATTCATCCAGCTGGCGGGCCGGGTAATGCTGCCCTATTCCTCTGGGATCCTGACTGCTGTCCTGCCATGCTTGGCCTATGATGACCGCAAGAAAAGTATCCTTCCCTCTGTAGAGGAGGTTGAAGTGGTGGGTCTGTGAATGGGAAGGACGCCCTTAGGCTCCTTCACTCCTGGGAAGCAAGAGATGAAGCTGAATGTGGATTGGGAAAGCCAGAGGTGCAAGACTAACGCTGGCTGTCCCCAGTCCTCACTGGCTTACTTCCAGATATGGAGCAGCAATCTCATGTGCCAAGGTTCTACCCTTCTGAGCTCATCCCTCTGTGTCTTGGGTGAGAAATATCCAAATGGAGGAGGAACCACCTGTGAGAAGAAAGAGGACTATCTCACAAGGGTGCATGTAACAAGAACGAGACTTAGGGAGGACTAAGTCTATGTGACCAGGGAGCCTGGTGGCCTTGGGCTTTAGGAGGTCTTTGCATAGGGGTGATCCTTACATCAGTAGACAGGTATCAAGGAGGTGGCCAATGTGTGTAACCAGAGCTTGATGAAGCTGGTCACCCCTGAGGATGATGAACCCGATGAGCCAAAGTCAGTAGCACAGAAGCAGACCGAACCCAACCCTGAGGATTCCCTGCCAAAGCAGGAGGGGACAGCCAGTGGTGAGTACCCTGACCAGAGTCAGAGTCCCCGTTTCTGCTGCTGGGAAGACAGAGGTCCCGGGACTAAACCTAAAGTATCATTTACATATGTTGAC
D3_G3 113161081 113165281 4201 GCAGCTGCACCCAGAGCCCATGCTCTTCACCCTTGCCACCTCAAAAGACATGACACATTGCCCTTGATCTCCAACTGGGATCAGCCACCATCAAGTCATTATTGGGAACATGGTAAGAACATAAGAGCACCGAGCTGCACAGTTGGTTTGATTCTTAGCATCTGGCCCTTTCTCAGGGAGGATAGGTCAGGAAAATGCTAGTTTATTAAGTACTGGAAATTTCTACTGCATAAGTCATTGCCTTTAAACAGTCCTTCCAATGCTTTTTGACATGGTTTTCTTTTATGCTGATTGGAGATAGACTTTGCCTCTAAAGCCCTGCTGGTCTTATCTCCTGGACCTCTGCCTCAGTGTCTCTGACAGCCTCAGGGGGAGTCCTCCTTTTCAGTTAGTCAGAGAGTAAATGGATGCACACCCTGTGCAGATGGCTGAGGGTGACAGAGCAGGGTCTGGAACCTACATTTGGGCCAGAGAAACGCCATAGCCATGGCACGTGCTTACTGTGCTTGCTGACTCCTTGACGGGTTAGCAGACAGCCTTCTGCCAGGTCACAGGGCCGCCTCCTGTGGGTTTGGCTGGTAGAAGAGAAAATGAGCTACCTTGCTGGACCTATGTTGGGTACCAGGTTACAGCTGTGCCAGAGCCAGAGCAATAAAACACCTGGAGACAGAAGAGCACATGGCAGGAGCATTGGTGGAGCACTGTTGGTTCTGTGGTAGATTTCTCACCAGCAAGAGGGAGACGTGGCCAGAGCAGTAGCTTGTGTACTTTTTGACAACTCCTGGAAAGAGAAAATTTCGGTAGGTTAATGTAGGCCTTGCACAGGAAAAGCTCTCTTTCTAGGATAAGCTAGAAGTCTCAGTAATAGACAGTTTGTGAGCTTGTGCTGGTATGTGAGCTTTTTGTTGATGGTTCTCATTTTAGAAATGTTGCACAGAAGGGAAAAGTTACAAAGCAGCAGGATTGCCTGCGCCGACGATGAGCAGTGTCACATTTTTAACATTACACAATTGAAATGATGCGTCAATCCCACATCTTGATTTTCTGTGTCGGAAAACTTTCTCTTCTTGTTTTTGCTTGGTTTCCTTCCGACTTTGTCTTGACATGAAGGTTGGTGTCTCTGAACTCCCATCAGCAAGTAGAAGAGTAGTTGCCTGGGCTGAAGGGACAGTGGGCCTGGGACAGATCCTGGTTGCTCTGGGAGACGGTGGAAATACTCTAGAACTGAATAGAGCAAATCCTTTGTGATTGTACTTAGAACCACCCATTTATATACTTCACAGTGGTAAAGTTGTGTTAATCAAAATTTTGTGGTGTAAATTGTATTTCAGTTAATATATATGCAGAGGTGGCAGTCCTGCCCCTTCCTTTTTGCTTCTGAGGCAGCAGTGAACTCTCTGGAGAGGAGCTGATCCACTCTGGGGCGTGGCAGCAGCTCTAGAGTGCCCTGTGAGCTGGTGCGTTGGTAGTTTAACGGGAGAATTCTCCACTGGCACGTGGGAGCCCTGGGTTTGATTACCAGCCAGTACAGTGTCCTTATCCTTTTAACCAGCTCTTCAAAGCCACCTTCAAGTAGCTGTCTGCTGAGGAGAACATTACCCTAAACCAGAGTACATTTCAGCAGTTTGCCCTGGATTTTACTACCTCATAAACAGCATTGAAAGAGATGAACAGCAAACTTTATAGTAGTTTCTAGAAATGGGAACATCCCATTTGAAGCTTTACATTTATTCTCAGCCTTGCTCACCTTATAGCTAATCACATTCTTTTCTAGGACAGAGTCCTAGCATGCTAGTAGACAGATGATTCAGCCAAGAAATGGGCAAGTTTAGCCCATCCTTGTCTGCTCCTTCTATTCTGCCCAGGACCACCTCTCTGTCACAGGTGCCTCCTGTCTGGTCTTCCTCTTTGAGTCTCTTGCATGCTCAGCTGATGCTGATGCAGCCTGTTCCTCTGTGTGTCTGCATGTATCCAAACATACATGTACAGTTCTAACCCTCCAAACATACATGTACAGTTCTAACCCTCCAAACATACATGTACAGTTCTAACCCTCCAAACATACATGTACAGTTCTAACCCTCCAAACATACATGTACAGTTCTAACCCTCCAAACATACATGTGCAGTTCTAACCCTCCAAACATACATGTGCAGTCCTAACCCTCCAGAGCTGATTCTTCCTGCCAAAGCACAGAGCTCCTCCTCTGCACTCTCTGCCCCAGCCATGTCCACCTGCAGCTCCCCATTGCCCTGCCATTATGGGATTGCAGTGCAAAGTCCTTTCCCTGACACTGTCCTTGTGGTATTCAATGTGCCTGGCCTGATCCCACTCCACCACCACCTCACCTACCCACCCAGCCAGCTCTGTCATCTGCTACTTGTCTTGGCTGTTGCAGCACTGATTCTGGCATGTTTGGCCCTTAAACTGCTTGGCCTCCTTTGATCTCAGCCTTCCTAGCTTCCACACTTGGCCTTGATGCTTAGCCTTTCCAAAGCTTAGTTTCCTTACTTGTTGAGTGGGGTAACCCTTGTCACCTAATTTGAAGGGTGGCTGTGAGTTCCAAAATAGATGTTTGCTTGTATAACAAATACTCTTCACAACAAATGCTGTAGTATTTTTTTAAACATGGGTGCTCGTTGACTTAAATTGTAATCCACAAACCCTTTGGCTGAAAATACTGGGAGTCAATGCATTTGAACACCTTTAGAGCACTTACAGCTAGCCAAAGCCATCTCAAAGCCTGTTGGAGGCATTATGTGGAGTTTTGTAAACTCTGTATTGAAAGCAAAACACAGTTGTTCTAAGAATACCTCCTTTGCAGCATGAGGTAGTTAAGTCCTAGGACATCAAGAACCATTGTAAGTCAGAGCATAAATATGTGTTCCCATAGCAAAACCCTCTTGCTGGGCCTTCTGCAGTCTTGTTTCTCTTCATTGAATTCTAAATGAGTAAGTAGCAAGTGAGAAGGGAGGCTATACAGAGGATTCCAGTAGAGAGCTAGTGGCAGCTCCAGGGTGCTTGTAGTAAAATCCACCTGTTGGCAAATCTGACTCTGGCAGGATTTGTCAGCTCTATCTATGGGTGCTGCAAGTACAGACAAATCAGATGCAGATCTGCCTGTGAGAACAGCTACAGAGCAGGGTTACACTGACACTGGGGGATGGTCGCAAGGGCCTGTACCTGGACAAAGGAGAGGGAGCATGGGCAGTGTGCAGGCGCAGCTTCCCAGAGGTCTTGAAACAGTGTGTTTGTTTCAAACCTTCGGACTGTAAAGGAAATGCATGTTCCTGAAGAGGTGGTAGAAGGACTGCACTTGAAGTGCATCACCCAGGACTCCCCACTGCTAGCTACAGTGTGCAAGTGGACTGTAAATGGGTTGTTTCTTGGTGTTTTTGTTTTGTTTTGATGTATAAATATACACTTGTATCTCTTGTATTTTGTTTTTACACACACACACAAATGGAGTCCTTACAAGCTTGAATTTTTTCACCAATAGTACACATCTTTCCAGGTTAGTCAGCACTAATCTGCACTAATTTATTTTTTTAATTGACATTATTTTAAAGTGTACAACTTACTTGTTTTAATATCTTTTGACATATCCATTTCCAAAACATTTCTACCATGCCCCAGTGAGATCCTCATACCCTCCCCAGCTCTGTGCTGCCTTCAGCCCTGTGGGCCTGGCCTGCCTGTTGTGAGCATTCCATATAACGGAATCGTACAATATGTGCCTGATCATATCTAGCTTCCTTCACTTCACTTTTCAAGGTTTCTCCATGCTAGCATACATTAGTACTTCACTTCTTTTTATAGATGAACACTGTTCCATTGTGTGAGTAGATATTAGAGTTATTTCTTCCACTGTGTGGATATTTGGGGCTGTTTCTGTACAGTTTTTTAAAATCACAATATATGCTGACTTTCCCTCTTAGCCAGCATTGTATAATTAGGTATATTAATAAAGCCAGTCTCTGGACTGGTAATTCAAATACGTCTTTTGTCTTTGAGGATGTAGTTCATCATCTCCCAGTTCATTAAACTGTGCTTCCTATTAATGCACTGACCTTGTGTCATTACATCAGATAGATAAAGCTCTAATCTGTTTAACCAATCTATCATAAATCACTTAGCTACTTCTAATTCCATCTTAATCCTATAATCCTTGCTAAAAAGAACTTTCACGCAGAAGAAAAT
U5_15 113142856 113157905 15050 TACGAAAAGCGGAAGGTTGCAGCGCTGGAGATCGAGAAGTAAGAGCTCCTGGGACCCCGCCCTGGCTTTGCAGCGCCTAGCGGTTCTGCTTGCCCGCGGCGAGGGTTCGGTATTGACCTCTCCGGTTTCAGCTCTTAGCACATTGCTTTAGAGCGGGAAATCCAAGAGCCCTATCTTTGCTAGTCTTAACCTCCTGGTGCTCCCAGATAGCAGTGAAAATGAATTGACTTAAGGTATGTGCAGAACCTAGCGCAGTACCTGACACATTCAGTGTGGCCTCAGTCAAAAGCCAGCTAGATCGGAGAGTGGCCTCTCTGAGGAGGTGGAGAATTTGCTTATGGTGTCCCGCCTTCTCTTTGCAGCTTCTGAAGTGGCCAAGTGTAGAAATAGGTCAAAGCACGTGATCCAATGCTCAGAAGATTGTCAGGCCACCCTCCCTTGCAAGTGAAAATGGGAAGATTTGCCCTTCCCCGCTTCTGCAATAGTATACGTGTGTGTAATAGTGCACTGGTGTTTCCAGGTGTTCGAAATAGGGAATGTTTAATTCGGTAATGTTTTGCTGAGTATGTGAGAGAGCACGTGTTTTTCCCCCAGCCAAATCTTAGTAACAGTCAGTTGAGTAGGTGGTTTCAGAAGAGTAGAAAGCAGCAGCCTGTAAAACTAGAAAAACATTAGGAGTTAAGACATCCAACTTGGTAACAGCGGACCATATGTGTCTATGTAAATTTAAGTTAACCAGAGTAGTGACACAGGCTTGAGATTTGGCACTTGGAAGGCTCGGGCAGAAATACTGTACTCGTTTGAGATTAGCATTGGTCACGGGGCTAGATCCAGTCTCAACAACAACAACAAAGTAATGAATCAGTACAAATTGTAAATTCAGCACGTCAGTTTCACTACCCATAATCTGGGTGTTCAGGAGCCAACCACTACAGCTGCACAGTGCAGACTAGAGAACATTTCAGTCATTGTACAATGGTCACATGGCCAGCCCTAAGCTATGGAGTGGTGCTCACTCATTGACTAGGATAGACTCTTTACTCAAAGTTTTTTAACCTCGGTGCTGTTGATATTTGGGAAGCACAATACTTGGTTGTGATGGGCAGTTCTGTAGCTTGTGTGATTTTTTTTTTTTTTTTTAGTAGTACCTCTGCCCTTTACCCACTAGATGCCAGTAGTACTCCATCAGTTGTGACAACCCAAATTGTCATCAGACTTTGCCAAATGTCCCTTAAAGAATCAAAATCACACTAGTTGAGAACAATTGCTTTGCCCTAGACTAATGGCTTTGGGCTTAGGTAAGAAGACCCTTCCATTTGTTTGCAGTACTCACGCTAGCGGTTTCTTTCCTCAGCCGCCGCCTTTTTTTCCCCTCTTTTCTGTTTACTGCCTTGCATTGCAGTGCTTAGCACAGTTCTGTTGTCATGCCGAATAGTGTGACCCAAAGATAGTGTCTAGGTATGATTGTGTGTCCGTGAGTTCTGTTGGTTTTGTGAAGTTGCAGTGTATATTAGGTTTTCATTGCTGTATCAAACACTCGAGATTTAAATGGACAGGGTAGTATGTGGTCAGTTGGACCTGTAGCTTTTGGGCATGATGAAGCCCTTCAAGGGCACACACCAAAAGGAGCTCTCAATAAGCCTAACTCTCAAACTCTGTCAACTCCGAATGAACCAGACAGAGGGCTACCTACACCGTGCATACACGGGCCTTTGAGAAACGGTTAAGATTCAGACAGTGGCACACTGACACCAGTTTTTTGCCACCCACTCAGCGTCACAGAAGTATCTGCTTTTATCCTGGCTTGAGTCATCTGTTAGGTCCTTGAACAGAGGTGTTCACAGCATAGCTGCTTCCGGTCAGTCTGTGGAAGACTTCTCTGCAGGTGGTCGTGTAGGGGCTTAGTTGTTAACCCAGTTTGTTTTGTATTAGACATTGCCCTTGATTTGTAAAATTCAGAGAAAATTCCTAGGGTGGTAAGGGACTATGGCCTCCTTAAGAGAAAAAACATTTGATTTATCCTCTTCTCTTAACACAGTGAGTGCCTAGTGGCATTTGACACTTGTACACAGGAACAATAGTTTTGCAGTTTTGATAGGAGAGTAACATTGTAGCCTAAGGAACTTGCTTCTCAAAAGTGGCCTGCAGACAGCTACTGAAGAGAGACGCTGGCTTCATCCTTGTGTGAGTTAGAATTGGCCCTCGAACAAGATTCCTGCATGACTGTTGTACATGTTAAAGCTTGGCAAGTGCTAACTTCAAAGACCTTCTGTTCTGTGCATAGAATATTCGATATTTGCATATATTCTTCATCAGACTAACCCTTGGTCAAGTAGCCTATTAATCGGTCCCCACAGATACCCCATCAAAGAAAAGTTAGAGCATTGACTGTTGCGTGTGGCGTGTGACAGCTCGTGTGCTGCAAAAGTGAACATGCTTGCCCTGTTCTTAGTTGAGCGAACCCCTCCAAGACGCCTGTTCTTAGTTAAGAGGCCACATGGAGTGTTGGTGTTGAGCACTAAAGCCTGGGAGCTGGGATTCCAGCTCCTCCTAGTCGCTAGTGAGGTGCGCCTGAGCAAGCTAATTAACCCCAGTGTCCTCATCCACAGACTAACAACAGTATTCACTGGGGCCTGGTGTGCGTTTTATTCCGGGAGCTAATGCAGACGTGGCTAATGCAGCCCTAGACACATCGCAACTGTTATGTAATGTGCAAACAGCTGTTACATAATTATTTTTAAATATTTATAATTGTTTTATATCAGTACTTCTCTTGACACTCTTTGGTTATCAGAATAATGGCCTCCTAAAGATATCTTAATCCCTGGAACCTGTGAATGTTTGAATTTAAGATAGCAGGTATGAGCTTGAGGAGATGGCTCAGTGGGAATATTAGTTATTTTTCTGTTGCTACAGTAAAAGCCCATAAGCCACAATCAACTTATGGAGGAAAAGAGTTGTCTTAGTTTATGGTTTCAGAGAGCAAGCCCATATTGGCAGTGGATGCACAGCAGCCCTCAGCTTAGAAGAAGCCGAGAGCTCATTTCTGTCCACTCACTTATATAAAGCAGAAGAGCAAACTGCAAGTGGGGGGAGACTGTGTCTTCCTCCAGTGACATGCTTCCGCCAGCAACACTCCATCCCCTAAAGGTTCCAGAGCTTCCTCCCAAACAGTGCCACCAGTTGGCAACCAAATGTTTTCGGTATGCAAGCTTATGGGAGATGTTTCGCATTCAAATATCCTCGCTACACCAGCATGAGAACCTGAATTTGGATCCCCAGGCTCATATGTAAAACCTGGGCTTGGCAGCCTGCACCTAGAAATCCAAGTGCCTGGACTTAAGTCAGTCATTGTAACTAAACAGTGAAGTGCAGGTTCAGTGAGAAACCCTGTCTCAAAAAGTAAAGTTCTACTTACCTTTCCTGTGGAGGAGACAGGTGTTGGCTTCTGGCCTGCACATGCACTCATGTACACAAGTACAGCTGCGCAGGCTCCTACTCTACATCACAGAGACAAAGAAGGGAGAAGCATAGCAGGTACAAAGTTGCTAATCGGGTGATTTTATTTATTTTTATTTTTTTTAAAGTTCATATTATTTATTTAGAATTTAATTGCATCATGCTGTGGACTTATATAGAAAAAAAATGATGAAACTGATAGACCAATCGTTTCCAAAGAGTTTTCTTTTAAAAAAATTATGCTCATTAAGTAGAACTTAGGCATTCAATTCTTGTAATCTATAAAATCTAATTTCCCAGGTGACCTGTTTTTATATCGGGTGATTTTAAAATGGGAGATTAGCCTAGATTACCCAGGTGGACCTGGTGTAGCCCTAAGCATCCTTTAGTGTGAAAGAGGGAAGCAAGGAGAGTATCAGAGTCTCCAGCAGCCATCATTACATTAGCCTTGAAGTTGTAAGGAGCAGCTAGTAAGAGAATGTGGGCATCATCTGTAAGCTGGCAAGGTTTTCCTGCTCTCCAGGAAAACCAACCTTTCTAATGCAGTTCCTCATGTTGTAGCAACCCCAACCATAAAATTGTTTCATTGCTACTTCATAACAGTAAGTTTGACTGTTATGAATCATAATGTAAGTGTCTGATGTGCAGGTTATCTGATATGCAACCCCCAAAGGCCTGTCCACTCACACTGCTGTACAGCTTCCAAATTACAGCAACTTGCTCACACCCTGATTAGTTCAGTAAGGCCCATAAGTTGTGTCCTAAGCCTCTAAGTTTGTGGCCATTTGTAACAGGAGCCAGTAGAAAACTGGTACAACTCTGGGAGAGACTAGTGATAAACTCTGAGTGGTACAATGTTTGTCTAGAACTCCAGACCACTCTGTTGTTCTAGATCTGCTGCCTGTCTGAGGCCTTGAGCTCTGTGGAAGCAGGAACTCAGCTTCATACCATGCTGTCTCTTAGTAAGAGGCTGAAGGCCTGGCTGACAGTAGCTTGTCTCTGGCTTTCCCAAACCAAGCAGGAAGCCCTCAGCCTCATAGACAGCTGAGCCTAGTCGTCAGAGTGAGATATGATTAGGAGCCCATTTAAGTACACCTCCAGTGAATAAGATTCAAATCTCAGAGGCAGAACAGGAGTGTGCTTTGTGGTTTTCAAGGAGGCTGGTGTCTCAGGCTTCCTTAGTTCTGGCTGGAACTCCCCATTGGGTGGAGAAAAGCTGAGGGATATTAAGTGTATTGTGAGCTTTTCTCAACCCCTGTTACGTGCAGTCTGCCCCTGCTGCTCTAACAAAATACCACAAGCTAGTGGCTTCAGTAATATCCATTTATTGCTCACAGTTCTAGGGGCCTGCCTGGCCTTTTCATAGGTATTTGCAGGGAGGTGGGGGGTGGGGGAAGGGTGTGGCTAGCGCCTCATCATGTGAGTATGGAGCCTAAAGGGTACTCAGTCACTATGATCATGAGTATGTAAAGTTCCATCTGCCCCATCCCCTGGGGTAGAAGTGGGATGCAGAGGGATGGAGAGAAGCATCCCTGTGGTTAGCCATTGTTTACCCACCCTGCCTCTCACTGCCCTATGAAGCAGATGATGCTAACCCATTTCACAGAAGAGGAAGTGGAGACCTCTTAAATCATCTTTCCAAGATTTACAGCTGGGTGTATCTGTCCTAAAGGGCATCCCCACTAGCTGGGTATGTTAACCCTATCTCCAGACAAGAAACCCCACTCCTGTTAGTGGGTTCCCCGACCCAAAGTGGGGGGAAATGTGTGTATAATGAATTTCATCCTTGGACATCTCTGTAGTGATATTAGTTGCTGCTTTCAGTTCTACAAAGCCATCTTCTCATACGACAGCCAGTACTGCATTTGGTATTCCTGTGGGAAGTAAGATGTCTTATAGTTATTGCAGGTCCTCAGATGCTAAATGTCCAAGGAAAGGCATGTGTGGTTCCACTCTGCTAGCATGGTGTGACCACCTCTAATAGTACACGTGGAGTGCCCGCTGGGCACTAGACCTGAAGAACTTTCTGCCACTGCCTCTGTCAGCATGGTGCCACAATTTCACAAAGGCGAAGGCACTCAAGATTTTTCCTTGATTGGTGGTTTAGTCCCTCAGAGCTCTGGGGTGTCTGGTTGGTTAATATTGCTGTTCTTCCTATGGGGTTGTAAACCCCTTCAGCCCCTTCAGTCCTTTCTCTAAGTCCTCCATTGGGGATCCCGTGCTCAGTCCAATGGTTGGCTGTGAGCATCAGCCTCTGTATTTGTCAGGCTCTGGCAGAGCCTCTCAGGAGACAACTATATCAGGCTCCTGTCTGCAAGCACTTCTTGGCATCCACAGTAGTGTCTGGGTTTGGTGTCTGAATATGGGATGGATCCCCATGTGGGGCAGTCTCTGGATGGCCTTTCCTCAGGCTATGCTCCACACTTTGTCTCTGTATTTCCTCCCATGAGTATTTTGTTCTCCCTTCTCAGAAGGACTAAAGCATCTACACTTTGGTCCTCCTTCATGAGCTTCATGTGGTCTGTGAATTGTATCTTGAGTATTCCGAGCTTCTGGGCTAATATCCACTTATCAGTGAGTGCATACCATGTGTGTTCTTTTGTGACTGGGTTACCTCACTCAGGATGATATCTTCTAGTTCCATCCATTTGCCTAAGAATTTCTTGAAGTCATCATTTTTAATAGCTGAGTAGTACTCCATGCACTTGGAATTCTAAAAGCCTATCAATGTGGTGCCCTTTGAGAACCCAGGCAAAGTTAGGTACCAGAGCTCTGAGTGCTACTCACATAATTGGAGTTCCTGGGCATGGCCTAGAGTGGTTTGAGGCAATTTGTGGAGTTTGGAGTTTGGGCTCAGTCCTGCTGTTCATAAGCAGATTGCTTAGACCTGGGGTCAGAGGCTGGTGCTTGCTACGTTCTGCCTACAGACTGTTCTGGTCTGAATCTCAGAGCAAGTTCACGATGAAATTTGAGTTTCTGTAGAGTTATGGCTGGGGGTGCCACATTCCTGTTCAACAAGAGCCAACCCCTCCCCACCATCCTGCTGGCATGCTCACCAAGGCTTCCCACACCAGTACCCCCACTGGCTTTGTTTGACTCCCCTGTCTACCCACTGTGAAGATTGCCTTTTGTTTTTGTTTTTTCGAAACAGGGTTACTCTGTGTAGCTCTGACTGTCCTGGAACTCATTCTGTAGACCAGGCTGGCCTCAAACTTAGAGATCTGCCTGCCTCTGCTTCCCAAGTGCTGGGATTAAAAGTGTGCACTCTTGCCACCCAGCAAAGATTACATGTATGACTTCTGGTTGAATGTCTCTGTGCCTTGGCTTACTGTTTATTTATTTATTTATTTTTAATGTGCCTTGAAAACATTATGCTGGGTGAGAGAAGCAGGCAGCTATGAAAGGCCAGAAGTACTGTGTCTCTAGCGACAGCAGATTGTGGTTGCCAGAGGTTGAGAAGAAAAAGCTAGAGATGGAGTGACAGCTCAGAGGCACAGGGTTTCTTTAGAGCTTATGGAAATGCCTTAAAGTGATGGAGCTCTACAAGTCTACACGTGATAAAAATCACTGGGCTGTGTACTTGCAAGTAAGACTGGCGGCTTGTAGATCATATCTCATCTTTGAAAGTAAGAAGATAGACGGTACATCATTGGGAGAGGGCACTTACTAATGGTCACAGTTGTCACCTACAGTCAGGTCCCCTTTTGTCCCAGCCATAGCCAGTGAGTGCTCAGTATGGTTTTTGGTTAGGGAGCAATATCAGACTTTTTGTTTATTATGTGAATGAGTGTTTCCCCTGCATGTCTGCACCGTGTGTGTGTAGTGCCCATGGAGGCCATAAGATAGCCTGGAACTGGAGTTACAGTTGTGTGCTGCCATTTGAGTATGGGACTCTAACCCATGTCCTCCGGAAGAGCAGCAACTGCTCTTAACTGCTGAGCCATCCCTCCAGCCCTTAGGTTTCTTTAATGCAATATTTTTATTCCTTGATAATGTCATGCATGTGTACCATGTATTTTTACTCTACTCATCCCTGGCTTTGTCCCCTAACTCAGTGTGTGTTCTGTGAGTTAAATCCCAGGCCTTGTCAGAAGACAGTTGGCCTGGCCTCAGAGGCCTGTGCTCATTTCCATTCAGTTTTCTGGTGATGTGTGAGCAAATGGAAACCAACTTACTCTGGCACTCGGTGGAGCAGATGGAGACATACTTACCCAGATTCTCTTTGGGAAATCACTGCATGGATGTGCCATCTGAATACGGATGTCAGTCACAGGGGGAGCTGAGACAGAGAATTGTATTTGCCCCAGGCATAGGCTGCAAGCTTCACAACAAAGGCATGAGTGTCAGCTCTGGCTTACCTTTCTCCTCCTCGGAGCCAGAGGGAGCCAGGCTCCTCAGCCAGCGTGCTGAGTGAGCAGTGTCTTGGTGGCGTGCGTAGAGCGCATTATCTCCTGGTTCTGACTTGAGCACCTGCAGTGCAGAATATGTGCTACTCCTTATCCAATTCTCTTTTTAAAAGTGAAGTCCTTGTGATTCTTTCCCAAAGCTGTGTGGCCTTGGGTTGCTTAGCTTCTTCATCTGTAAACTAGAGTAAGTGCCAGACTGGGCGGCAGCTTTTAGGTTTCAGTTTGAGTACCCATTATCTTAGGATTATCATTTGCTGTGGTGAAACACCATGGCCAAAGCAGCTTGGGGAGGAAAGGGTTTATTTGGCTTAGTTTCCACGTCACTGTTTGTCGTCAAAAGAAGTAAGAACAGGAACTCAAACAGGGCAGGAACCTGGAGCTGACTCAGACCATGGAGGGGTGCTGCATACAGGATTGCTCCTAGGGGCTTGTTCAGCCTGCTTTGTTCTAGTACCCAGGACCACCAGGGGTGGGGTGGGGCGTCCCCACCCACAATGGGCTGGTCCCTTTCTGCCTGATCATCTGAAGGTATTTTCTCAACTAAGGTTCCCTCCTCTCAGATGACTCTAAGCTTGTGTCAAGTTGACATAAAAGTAGCCAGTACACTAGTGTAAACAGCCAGTGCTTGCCTGGTGGGCAGTAAATTCTTTATCTCCACAGTAGAAGGCTTAATTCAGAATGTCTTGAGGATGTAGCTTGTCTGCACTCGCTGTGTGTGTGGAGGGGAGATGTCTAAACACTGAGCAGCAGGTGGATGGCCTACAGAAAGGGCTTGTTGGACCATTTTTTCCCAATATGTAGGGAAACCAGGCAGTAGCAGCATCTCTTCTTTGGAGTATAGAACAGTAAATCCTGAGTCCTTTGACTGGGTCACCTGACGGGCTGAGTCTACACAAGAATTGTTATAGAATGTGGTCACTTTCCAGCTAAAAGGGCCTCTGGAGAGAGGAGGAGGAAACTGTGTTACAGTTTAAAGGACATAATACCTTGTTGATGTCAAGGGTTCAAACCTGTGATCCTGAGAAGTGGACTTACTCTCCCTAAGGTTGTTCAGATCTTGAAGTTGAGGATGATGTAGCTACAGTAACTGACCAGGGAAGTCTGCAGCATAACGAGAGTGCTTGCTGACTTACCAAGCCTTGTATAGCCTGTGATGTCACCATACTGTGTTCCAGAGCCTGGAGGTATCAGTGCAGGCTGGGACTATGTAGCACACAGTGTGGCTCCAGGTTTTTTCTTGGCTGATAGCAATCCAAAAATATCCTATGGAGCTGTAGTTCCCTCTGCCAAGGGAGCAATCAGTATAGCAGCTTCTTTGATATCATAGGCAGTTGTTAAACTCAGTGCTAGCCCACCCTGATGCTTATGTCTTTTGGGCGTCTCTACCAGACTCCTATACCTCCAGCCAATTGCAAGCAGAAGCTCTTAAGCCACTAAAGGACATGGTGCTACCAGGGAATCGGCTTGTTGAACCTTTTTTTTCCCAATACTTTGTAGGGAAACCAGGCAGTAGCAGCATCTCTTCTTTGGAGTATAGAACAGTAAATCCTGAGTCCTTTGTGTCATTGAAGGACCCCAGGGATAGGAGAGTTTCTAGGCCAGATATTAACTTCAAAAATGAGTTCAGCCAAAGACCCCCCACTTCTATCTCCCAAGCAGTAGATGAAAGCCGAGGCAGCCTGTTGTCTTTGAAGAAGACTAAGCCTGAAGCTGGGGAACCTGCTGTTGAACTTCACTTACTCTGCTCCCCTTGGGGTTGCTTTTCTTCTCTGCACTGTCCCTGTGAAGTCATGAGACCAAGGCACTGGCTGGCTGAGGGCACAGTTTTAGAGTGCAGCTGACCCTCAGCAGGAGCACTTCAAGTCCATGGTGTGGGTGTGTGTCTGTGTGTATGCGCGCGCGCGAGCAAGTGCATGCACGTCTCTACAGTCAGCAGCCGTGGCTATAGAGGACTGGGCTCTTCTCAGTGTGCGTTTTGAGTTTGCAGGAAAGGTGCCGTTGCTCGTGCTAACTTGTGGTAAGGTTAGAAGGGCCTCAGCACTGTCAGAAGCTACATCAGTTAACCCCCAGGTCATGTTTTCCCATGCAAGCAACATGGCAGCACAAGGCTTCACCCATATTTGCCCTACAGCTGTGCCCTCATCATCTCTGCCAGCCTTCGAAGACTGACTCCACTGGCGGGTGTTTACTGATTGGCCAGCTGTTGGATGCAAAAAATTGGTCTGGAGACCGCTGGTACTAGAATTGCAAAGTGGGCAGTGCCCAAAGCCCTGATCAAGCTTTATGGAGGTAGAAGGTGGTAGATGGTGGCACCAATCAGTACACTTCTGGGCACTAAGTGCTTCTGAGTGCCAAGGAGGACTAACACCGCACACCATGAAAGTGCAGGAAGGTGTAGAGGCAGGGCATCTGAGGAGGACAGGCCTGAATGTGAGAGGAGCAGGCCCCCTAGGAAGCTGCAGCTGGTGGAAGTGGGAGAGGGAAAGTGGGCAGGCTAGAAAGTCATGCGGCCTGTTTTGACTGCTAAGGGTGGCCTTGATTCATGAAACAAGATTGGCCCAAGGGTTGCCCTTGTGCTGTTTGAGCTCGTAATACTGATGAGAAGGTGCTAAAGTAGTTTCCCCTCCAGGGGGCGCAATTGCTTTGCACTTGTTTTCCCAGAAGATACCGAAACTTATACTTAATGTAATGGTCCCTGTGGTCATGGGTCTTTAATGGCCTTTGTTGTGACCTGGGGTGACTGAATTAAGCCCTGATAAGTTTCCAAGTTGGTGGGAGAAAGGTGCCACTGAGCTCATGAATTGCCCCCACCATCCATCTTCTTTAAAACCTCCTGTTATTGAAAGTAGTGGCTCTGGCACCAAGGCCACATGCCTTCTCCCCTTCCCTGTAGATCTTTGTGGGAGCCTGTGCTGTCTTCAGAGCTTCCTTACTGCCTCTCAAATTCATCCCCCGCCCCCCAACTACAGATCATTCTTCAGGATCCCATCCAGCCGCTGCAGGCCACTTTCCATGGCTCCTCATGGCCACCAGAGGGAGATGGGAGGGATTGCTTTGCCAAGCCTTCAGGATTGCCAGCTGTTTGCCCATCTTGCCTCAGCCCAGATGAACACCTCCTCACACTTCCGAACCCTCTCCCAGGCATACTCACATAGGACCACAACATAACTCGCCGATTAGACCCCAGCTTTCCTGCCTTCCTCACCTTGCTGTCCACTCTTGATGGGTTTGTACTGTCATCCTCCACCTACCCCAGCAGAGCATCCTTCAGAGCCAGAGAATGAGTCTGTGCAGGGCTGACATCTGGGAGGAGTGCTCCCCAGCTGCTCCATGAATGTCCAGGAATCTGTAAAGGACAGGAGAGGAGCATGTCTCAGGGATGACTGGGAGGGAGACTGGCTCTCCTCTTGAGTCCTGGCCTAGCCTGGACGGTATCCACATTCCAGGTGCTGCTGCGCCTTGTGCAGGCAAAAGCAGAACTCAGCTTCTGGGCAGGAGTGGGAGGCACAGTTACTCACTCTCAGTAACTGTGTGTGGTATAGCCCCATGTTCTTGATCCTTCAAGAAGACTCACGGGTTCTGGATCTCTGTGGAATTTAGAAAATGCTTTTCCATGAGGAACATTTAAAAACAGGCCAAAACCAAGTCATTTCCTTTTTTTTCTTTTAATATACTTAAAAATTTATTAGGCAGTGTGAAATTTTCATCTCTTAGAATTAAAAGGATTGCTACTGCATTGGCCGGGAATCGAACCCGGGCCTCCCGCGTGGCAGGCGAGAATTCTACCACTGAACCACCAATGCTCCAGCTGTGAGCAGCTGTGTGGCACCTCCCTATAACCTCATCCCTGGGCCTCCATGTGTATATGTTGAGTCATAGCCCAGTTTATGATACTGCCACATCAGCTTAGCTTCAAGAAGAGCAGCAAGCTCCAGAGCCAGAAGGAAGTGAGGGGTGAGTGTAGGTCTGTGTGCATGTGAAGTAAATTTGCCTTTGGGCTTTGAGACAGGAAAGAGAGCTCCACTCCCTCCTCAGTCAGCAGCAAAACACAGAGACTGTGGGCGAGCCTCCCCTCTGCCGTGGAGCTGGTGTGCTGCTCTCAGTTTTCACACTGCGTTCTGCTGGCGACTGGCCCAGACCAAGGGCAGCACTGTGGAGTTCTTTCAGGTGGAGATGAGGAAGCCAGACTCCTGCAGCCAGTCACACTTGTCAAAGAGCCCAGCAACTCCCTATGAACTCTGAGCAGAAATCTGTAGTCCTTGGGCTGCCTCAGGCCTTGTTTGGTTGAGGGACCAGGCTCCTCTGGCATGAGTTCTGTGAGGAAACTGACCAGAAAGGGACCCACACACCCCCCAAACAAATAAACAGTAATAAAGCAAATAAATTTTAAAACATAATTTTTTTTTAAGAAAAGAAAACAAGCTCTGCATTGGCCGGGAATCGAACCCGGGCCTCCCGCGTGGCAGGCGAGAATTCTACCACTGAACCACCAATGCTCCAGCTGTTTGGTGTGGTGTCTGTAGAGCTCTTCTCAGGGCTGTTTCATTGAAGAAACACTGGGCTTCACCTGGCTGGTTTGTCCTGTTTGGGAAACCGCACAGGATTGGTTCTTTCCCAACCTTCTTATAAGCTTCTGAAGTCAGGGCCTATGATCTGACAGCTCCTCCCACTTAAAAGCCCTTGAGTCATCTGTAACCCATAATGATGTCCTTTCCTACTGTACATGATCCTGCCTTCCCATTTCTTTTCAGTAGGCAAATGGAGCAATACACCCACCTTCCTTTCCCTGGGCATTGTCTGTTAATGTTTCTAAAGTAATACCTCAGATGGGACTGCCCTGTCGCCAGTCTCCTGGACAGAGATAGCGTATTCTGTTTCTGTGACATCACTACTCTATTTTGCTACAATTTTGTGTTTGTGATTTGATTTTGCCATGTGTCCCAACATAGATACAGAGGAGTCCTCAGATGCATGAGTGCAGAACTGAGCAAGTGTTTGATAAAAATGGGTATTAGCTTTTTTTAAGACAGTAATTTACATTCTCTCAGATTCCCAGAAGTAAACTGGCCCCACTACTCCTCACTGAACGCTGAGCAGGGCAATGGTTAGGACCTACCCAGCAGCAGAACCGAGAGGACCTGCCCTGGAGCCCAGACAGCAGAAGTAGCCCGGGTTTGTGTGTCCCATGCTTTCTCTTTCCTCTTTCCAGGCTGGTGCGGGACTTTGTGGCCCAGAACAACACCATGCAAATCAAGCACGTGATCCAGACCCTGTCTCAGGAGTTTGCCCTGTCCCAGCACCCCCACAGCCGGAAAGGGGGCCTCATCGGTCTGGCAGCCTGCTCTATTGCCCTAGGCAAGGTATGTCTTCATTCTGATTGAGGTGACCAAATACCTTCCTACCTGAGCCTCAGCAGGACCATTACAGATGTGTATTTTATCAAGACTTCTGCATTTAGGACTACTAGCAAATATCACCGTGTGGCCTGGCAGCCATGTCCCCATAGTGTGGTTCTACTTCTGGAAGGTTGGCTTGGGATGAGTGTTTTTAGCTCAGCTCTCACAGAGGCCTGAGCGTCTCCAAGGGAGGGGACTAACCCTTCTGACTAGTCCTGGCTGCTCGTTACAGGACTCAGGGCTCTACCTGAAGGAGCTGATAGAGCCAGTGCTGACCTGCTTTAATGACGCAGACAGCAGGCTGCGCTACTACGCTTGTGAGGCCCTCTACAATATCGTCAAAGTGGCCCGAGGTGCCGTGCTGCCGCACTTCAATGTTCTCTTCGATGGACTGAGTAAGGTAACTTCTGATTCAGCTAAGAACAGCCCACCTACCTGACTTGACTTTCTAGGACCCTGAGAGAGAGCTTGGGACAGATGCAGGCAGAGCAGGAGCAGACACTGCTGCAGGGGACACTTAATGCCCAGGTCTGATTTTTCATAGACCTGTATCAGTGTATCGTTAAGTCCCGTTCACCCTCATTCCACTCTGTGGAAATGTCTGCCTGCTGTACACATTATCGGAAAGGCTCATAGTTTGAGAAGCACTAACCTCCCAGGCAAAGGTAACAATGATGACTCCACAGTACAGGCTGTCCCTTTGAAGGACAGTCATGACAAGCTCCCTGTGCTAAAGAGTGATCCCCTATAGACCTTTAGGGTCCCTATTGCTGTCCTTCTTGGCTCTCAGTCTGGTGGGTTGCCTTTCCCCTCACCCTGGTGGGGATGCTCTCTCCTCAGCCTGGGGCAGTCACCCTACTCAGTTGTGCAGAGTGGCCCCTGTAGAATGAACAACATGACCATTTCTCAATGCCACCCTCACGGCTGTCTCGGGGGCCCATGAGAGAACCAAGCCTTTTAAGATAAGCGTGCCCTGGGAGCAGCCAGTGGGAACAACCGTGTGACCCAGTTCCAGCATGGCCTGGGAACCCCAGCAGATCTTGGGTTACCCCTGAACAAATGGGAACTCTCCTGTAACTGGTTGTAACTACCTTTCTCAGTCAGACACTGGGAAAGACACCACGTGGTGTGCTGATCTGCATCATGGCCTTGGCTGTTGCTTTGCATTCGGTCTCTAGGCTTACGTCTCACTGTGACTGAACATTGCCTCTGTTTCTCTGTTTTGGTGCCTCATAGTTGGCTGCTGACCCAGACCCCAATGTGAAAAGTGGATCTGAGCTCCTGGACCGCCTCTTAAAGGTACCCCACTCCAACCTTCTTGTATTTTAGACTTTATTCCCTCTGCGTGTAGAGTAGAAATTCTGGTGGTTTTCCTCATGTAAGTTGTTTTTCTATATAGCACACACATATTAAAGCTCACTGCTTGGTATGCAGTTTCTGTGACATATGTAAAGCTGTGTTACTACCACTGTCAAAGTACAGAACTGGGCTGTCCCCCTAAGTGAAGATCTTCTGTTTGGGGTGGGGATTGGATATTTTATGTATATAGGTGCTTTGCCTGCTTGCATGTCTATGTCTATGTCTATGTCTATGTCTATGACCTGTGTGCCTGGTCACTGCAGAGGTGATAAAGGGATGTCATATCCCCTAGAACTAGAGTTCCAGCTGGTTGTGAGTCTCTGGGGTGCTGAGAATCTAACCCAGATCCTCAAGAATAGCAGCTAGTGCCCGTAACTGCTGAGCCAGCAATTAAGAATCTTGTTTTCATACCCCACTCAGAATGATGAAA
D3_15 113161081 113176130 15050 GCAGCTGCACCCAGAGCCCATGCTCTTCACCCTTGCCACCTCAAAAGACATGACACATTGCCCTTGATCTCCAACTGGGATCAGCCACCATCAAGTCATTATTGGGAACATGGTAAGAACATAAGAGCACCGAGCTGCACAGTTGGTTTGATTCTTAGCATCTGGCCCTTTCTCAGGGAGGATAGGTCAGGAAAATGCTAGTTTATTAAGTACTGGAAATTTCTACTGCATAAGTCATTGCCTTTAAACAGTCCTTCCAATGCTTTTTGACATGGTTTTCTTTTATGCTGATTGGAGATAGACTTTGCCTCTAAAGCCCTGCTGGTCTTATCTCCTGGACCTCTGCCTCAGTGTCTCTGACAGCCTCAGGGGGAGTCCTCCTTTTCAGTTAGTCAGAGAGTAAATGGATGCACACCCTGTGCAGATGGCTGAGGGTGACAGAGCAGGGTCTGGAACCTACATTTGGGCCAGAGAAACGCCATAGCCATGGCACGTGCTTACTGTGCTTGCTGACTCCTTGACGGGTTAGCAGACAGCCTTCTGCCAGGTCACAGGGCCGCCTCCTGTGGGTTTGGCTGGTAGAAGAGAAAATGAGCTACCTTGCTGGACCTATGTTGGGTACCAGGTTACAGCTGTGCCAGAGCCAGAGCAATAAAACACCTGGAGACAGAAGAGCACATGGCAGGAGCATTGGTGGAGCACTGTTGGTTCTGTGGTAGATTTCTCACCAGCAAGAGGGAGACGTGGCCAGAGCAGTAGCTTGTGTACTTTTTGACAACTCCTGGAAAGAGAAAATTTCGGTAGGTTAATGTAGGCCTTGCACAGGAAAAGCTCTCTTTCTAGGATAAGCTAGAAGTCTCAGTAATAGACAGTTTGTGAGCTTGTGCTGGTATGTGAGCTTTTTGTTGATGGTTCTCATTTTAGAAATGTTGCACAGAAGGGAAAAGTTACAAAGCAGCAGGATTGCCTGCGCCGACGATGAGCAGTGTCACATTTTTAACATTACACAATTGAAATGATGCGTCAATCCCACATCTTGATTTTCTGTGTCGGAAAACTTTCTCTTCTTGTTTTTGCTTGGTTTCCTTCCGACTTTGTCTTGACATGAAGGTTGGTGTCTCTGAACTCCCATCAGCAAGTAGAAGAGTAGTTGCCTGGGCTGAAGGGACAGTGGGCCTGGGACAGATCCTGGTTGCTCTGGGAGACGGTGGAAATACTCTAGAACTGAATAGAGCAAATCCTTTGTGATTGTACTTAGAACCACCCATTTATATACTTCACAGTGGTAAAGTTGTGTTAATCAAAATTTTGTGGTGTAAATTGTATTTCAGTTAATATATATGCAGAGGTGGCAGTCCTGCCCCTTCCTTTTTGCTTCTGAGGCAGCAGTGAACTCTCTGGAGAGGAGCTGATCCACTCTGGGGCGTGGCAGCAGCTCTAGAGTGCCCTGTGAGCTGGTGCGTTGGTAGTTTAACGGGAGAATTCTCCACTGGCACGTGGGAGCCCTGGGTTTGATTACCAGCCAGTACAGTGTCCTTATCCTTTTAACCAGCTCTTCAAAGCCACCTTCAAGTAGCTGTCTGCTGAGGAGAACATTACCCTAAACCAGAGTACATTTCAGCAGTTTGCCCTGGATTTTACTACCTCATAAACAGCATTGAAAGAGATGAACAGCAAACTTTATAGTAGTTTCTAGAAATGGGAACATCCCATTTGAAGCTTTACATTTATTCTCAGCCTTGCTCACCTTATAGCTAATCACATTCTTTTCTAGGACAGAGTCCTAGCATGCTAGTAGACAGATGATTCAGCCAAGAAATGGGCAAGTTTAGCCCATCCTTGTCTGCTCCTTCTATTCTGCCCAGGACCACCTCTCTGTCACAGGTGCCTCCTGTCTGGTCTTCCTCTTTGAGTCTCTTGCATGCTCAGCTGATGCTGATGCAGCCTGTTCCTCTGTGTGTCTGCATGTATCCAAACATACATGTACAGTTCTAACCCTCCAAACATACATGTACAGTTCTAACCCTCCAAACATACATGTACAGTTCTAACCCTCCAAACATACATGTACAGTTCTAACCCTCCAAACATACATGTACAGTTCTAACCCTCCAAACATACATGTGCAGTTCTAACCCTCCAAACATACATGTGCAGTCCTAACCCTCCAGAGCTGATTCTTCCTGCCAAAGCACAGAGCTCCTCCTCTGCACTCTCTGCCCCAGCCATGTCCACCTGCAGCTCCCCATTGCCCTGCCATTATGGGATTGCAGTGCAAAGTCCTTTCCCTGACACTGTCCTTGTGGTATTCAATGTGCCTGGCCTGATCCCACTCCACCACCACCTCACCTACCCACCCAGCCAGCTCTGTCATCTGCTACTTGTCTTGGCTGTTGCAGCACTGATTCTGGCATGTTTGGCCCTTAAACTGCTTGGCCTCCTTTGATCTCAGCCTTCCTAGCTTCCACACTTGGCCTTGATGCTTAGCCTTTCCAAAGCTTAGTTTCCTTACTTGTTGAGTGGGGTAACCCTTGTCACCTAATTTGAAGGGTGGCTGTGAGTTCCAAAATAGATGTTTGCTTGTATAACAAATACTCTTCACAACAAATGCTGTAGTATTTTTTTAAACATGGGTGCTCGTTGACTTAAATTGTAATCCACAAACCCTTTGGCTGAAAATACTGGGAGTCAATGCATTTGAACACCTTTAGAGCACTTACAGCTAGCCAAAGCCATCTCAAAGCCTGTTGGAGGCATTATGTGGAGTTTTGTAAACTCTGTATTGAAAGCAAAACACAGTTGTTCTAAGAATACCTCCTTTGCAGCATGAGGTAGTTAAGTCCTAGGACATCAAGAACCATTGTAAGTCAGAGCATAAATATGTGTTCCCATAGCAAAACCCTCTTGCTGGGCCTTCTGCAGTCTTGTTTCTCTTCATTGAATTCTAAATGAGTAAGTAGCAAGTGAGAAGGGAGGCTATACAGAGGATTCCAGTAGAGAGCTAGTGGCAGCTCCAGGGTGCTTGTAGTAAAATCCACCTGTTGGCAAATCTGACTCTGGCAGGATTTGTCAGCTCTATCTATGGGTGCTGCAAGTACAGACAAATCAGATGCAGATCTGCCTGTGAGAACAGCTACAGAGCAGGGTTACACTGACACTGGGGGATGGTCGCAAGGGCCTGTACCTGGACAAAGGAGAGGGAGCATGGGCAGTGTGCAGGCGCAGCTTCCCAGAGGTCTTGAAACAGTGTGTTTGTTTCAAACCTTCGGACTGTAAAGGAAATGCATGTTCCTGAAGAGGTGGTAGAAGGACTGCACTTGAAGTGCATCACCCAGGACTCCCCACTGCTAGCTACAGTGTGCAAGTGGACTGTAAATGGGTTGTTTCTTGGTGTTTTTGTTTTGTTTTGATGTATAAATATACACTTGTATCTCTTGTATTTTGTTTTTACACACACACACAAATGGAGTCCTTACAAGCTTGAATTTTTTCACCAATAGTACACATCTTTCCAGGTTAGTCAGCACTAATCTGCACTAATTTATTTTTTTAATTGACATTATTTTAAAGTGTACAACTTACTTGTTTTAATATCTTTTGACATATCCATTTCCAAAACATTTCTACCATGCCCCAGTGAGATCCTCATACCCTCCCCAGCTCTGTGCTGCCTTCAGCCCTGTGGGCCTGGCCTGCCTGTTGTGAGCATTCCATATAACGGAATCGTACAATATGTGCCTGATCATATCTAGCTTCCTTCACTTCACTTTTCAAGGTTTCTCCATGCTAGCATACATTAGTACTTCACTTCTTTTTATAGATGAACACTGTTCCATTGTGTGAGTAGATATTAGAGTTATTTCTTCCACTGTGTGGATATTTGGGGCTGTTTCTGTACAGTTTTTTAAAATCACAATATATGCTGACTTTCCCTCTTAGCCAGCATTGTATAATTAGGTATATTAATAAAGCCAGTCTCTGGACTGGTAATTCAAATACGTCTTTTGTCTTTGAGGATGTAGTTCATCATCTCCCAGTTCATTAAACTGTGCTTCCTATTAATGCACTGACCTTGTGTCATTACATCAGATAGATAAAGCTCTAATCTGTTTAACCAATCTATCATAAATCACTTAGCTACTTCTAATTCCATCTTAATCCTATAATCCTTGCTAAAAAGAACTTTCACGCAGAAGAAAATGTTTTTACAAACATCTGTGGTTGTTTCTTAAAGATACATTTGTAAATTTTTAAGGCTTGCTGCTGAATGCCAGGCTCTAACCCCAGCAACATGAAGGCTGAGAACCCCTGCCCTAATGTGATCCAGTGTCCATTCAGGGCTTATAGTTCCCCGTGGACTTGTGATTTATTTTGTTGGACTTTTGGATTTGTTTTGTTTTGTTTTTTTCTCCACTTAGAGCCAGGAACAAAGTACATATAGTTCACTTGACTGAATGGTCATTATATTCTGTCTGTCTTCTTTCCTTCCTCAAAATGTTAAGAGACTGGATCGGAGCTGAAGAGATGGCTCAGTAGGTAAAGCGTGAGGCCTAGAGTTTGGATCCCCAGGACTGACATAAAAGGTAGACATGGTGGCACACATCAGTTCTAGGGAGGTAGAAACAGGATCCCCAGAAGAAGTGGCTAGCTAGCCATGTCTAATCAGCAGGCTCCATATTCAGCAGAAAACATATCTCAGTACAGAAAATGAAAAGGAGGACACCTGACATCTGCATCTGGCCTCCACATGCAAACATAGGGTCGTCCACAAAAGTGGACTTTCACACATGTATTCACACAACACACACATACTTATGCAAAAAATTATACTGAGGAAGATACTGGAAATCACACAAAGGTCCTGTTTTCCTCCACAAACCACCTCCCCAGTAAGTGACTAGCCAAAGCATCCGTTGGTAGAGCAGATAATCCTGTGGCAAACTGCCTCACGGTGAGTTTCTACCTGCACCTGTCTTCTTTCTTCTTGAGACAGGCCTTTGCTGTGTCACCCAAGCCAGGATTCAACTCTGCATCCTCCCATGTCAGCCTCTGCAGTGCCAGAGTTGCAGGAGGGAGCGCCATTCCTGCCGAGTCGTGTCTGTCTGCTCTGTGTTGCTCATGGAAGGGGACTGGGTGGAAACAGAGGCTCTGGCTGAGGCGATTGGAGATTCAGGCTTGGTATCCTGACATTTTATCCACAGATATGTAGCTTCCTATAAGAGAAGGAGGGTGGACTTCAGGGGTACGGACCCTAACCGTGGGTCAGCCTGCCTTTCCCATCACTCGCTGCATCCTCTTTCCACCTGCCTCCAGGCCCTGCGCACCATGACATAAGTAGGGTGAATGCCACAACAGGCTTGGCCTGCTGCCATAGCCTTCCCTCCTCCACTCCTGTGACTAGAGAAGGCAGGTGGCAGTGTGGGCCTCTTACTTAACACAGAAATAAAGATCCCCTTTACCAGGAGGAAGAAAGACCATAGGCTATTTTTGGAATAGGCTAAAAACTTGGTTTGTTATTTTTAGAAAATATTTTATTTGTAAACTTTAAAACTTTTGAATGACAGTAGGGACAATGTTAGTCATCATCTGTAACAGAACAGCTGGATTGATGCTGCACTGTAATCCTTGGGCTATGGAGGCAGGAGGATTAAGAAATCAAGGTTGATCCTCCCTACATGGAGAATTCAAGGCCAGCCTGGGCTACATGAGACCTTGTCTTTAAAAAGTCAGAATAAAAGAAACAAAACCTCACATAAGAAATATCTATGGCTCCCTAATGTTTGATATAAATGGCTGAATGAATGAATGAGTGACAAAGAAAGGACAGCTCCTCCTTATAGAAAATTCCAGCTAAAAGCAGGAAGAGTGACTGGAGGTGTGGCTCTAGTCATGGCGCACTTGCTTAGCATGTGCAGGAACCTGTAGAATGGGGCACTTCCCACGTGAGTCCATAGTGCTGAACTGACCCTGGGAGGGCCAGTGGCTGCAAAAGCACTTCCAGTGTGGAGACGCCTGAGCTCCCTCCCAGCCTTCCATGGCAGTGAGGCATCTCTTAAATGTTCAGGCCCTGGTGAGTGAGCGAAAACATCTTACTCTGCAGTCAGACGATTTCCTGCAGTTCCTGGCCTCTTAGAGCAGCTTGCCCTCCTCAGAATGCTGCACAGTGACACCCAGCCCTGGGCCTGTTAGAGCAAATCTTCTGACCTTGCCTGCCTTCTTCACCTCTATTCTGACAGTCCTGGCACCGTCAGCCTGTCACAGTAAGTGAGCTAACATCTGTTGCCTGTTTACAAGTGTTCCTCAATGCATCCCAACAGCCATGGAAGCATTTGCTACAGAAATGAATAAGCTGCTTTGTCAAGAACTTGAACATTCACCTTTCAGCTGCTTTCCTTTATTTTATTTTATTTGCGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTACATGTGTACACATGGGTGTGCAACAGAAACCAAACCCTTGGCTTCATTCATGTTAGGCAGATGCATCCCTGAGTGACTTTTCTTGGCTTGACTTGGAGAAATTGTTTGCTGTGTTGATTCTGTGTTGGTTCTGACAGTGAAAGCATTATAAATGTATTCTCCCAGCAACTTTAAAATCAGGTTTCAATTTCCATTAGCTTCTCAGGTCTTTTCCTTTATAATTTTTGCCTGTTGGCCTGGTTGAGAAATTGTCACCATGCACCCTTGTCAAGAAATTTTGAACTCAAGCCTGACTGAGAAGCACTGAAAATTTAGAATACAGGGGGCAGGTAACTGTGACAAAAATCCCAGGCAGAAACTATGACAATTTTTTCTCCGTCTCTGTCTGCCCCCTGCCTCCTCTTGTTCTTTCTCAGTGTGTGTGTGACTCTGGGAAAATCACAGGCTCCTGCTATTGTCTGGTTTAGAGCAGTCATGGAGGTATCCTCAGTTTCTCAGCCCCACACGACTGCCACGCCATAGTCTATATATTCTCCTCAGTTTAGAAGATCACTTTAAGTGTACAGAAAATGAATAAAGAGATCCTTATGTATATTCTCTGAGCTGTCTGGAAATATGTTAGGACACTGCTGACCCCATTTGTCCCTTCCTGTCCCTTTGTAGGTAAAACTCCACATTACACCAATTGCTGTCCTCTGAATCACCTCTAATCTTGACAATTATGAAGGGCTGGCTGGTCACTTTGCTGACCACCTCTCCACATGAGTTGGACTCACATTTCTCTCATGCATCCTGAAGTTAAGCACTTGGGAAAGATGCAATCGAAGTACTTTGTCTGCAGTGCATCCTGTTGGGGCTGCATTGGCTCAGCACTGAATGGTGGTACTGACCCCTTATCTGAGCACCTCACGCTGCTGACCCCTCCTCCTTTCCTTCATGCTCTGAGCTGTGGCCATTGCCTGGCCAGTACTGGGGTTAGAAGAGAGCCCACTGGCAGCCTTCCAGATGCGCAAAGTCTTGGCTCTTTAGATAACTTAATTAAGCGCCAAAGAAAAAGGTTGGGATTATCTCAGTCCTGTCCTGCTTGAGTTTTGCAGCAGAAAGCTAAGTATAGTAAAGGTTTTGAATTGGCCACATGCTAAGGGACTTGTGCAGAGTTCAAGGTTACAATTCTTTCCCAGAATCATTTTAACCCTTTTATTGAGGTTTTGTAGACTCTACATACCCAGCTGAACATGTACAATTAGCAACTTTTGTTCATTCACTGAGTTGTATAATTATCACAGCCAATTTTAGGACATCATCAACAACCTAAAGTCCTTGCCCATCACACCCCATACTCCCAAAATTCTCCAGCACTCTGTAACCTCTAACCTACCTTCTGTCTCCAGACTCGTCTATTCTAATCGTTTCCAGTGAATGGAATCTTGCTATGTAGTTTTGGAATTGGCTTCTTTGACTCAGCATGTCAAAGTTCATCCATTATATAACCTGTTGCTCTTTATTGCTAAATAATATTTTAGTTTGTTTATCCATGCATAGGCATGTGGGCTCTGCCCACCTTTTGACTATGGTAGGTGGTCACACTAGCATAAGATACAGGATACAGACTTGCATTGCTCTTGGGTGGGGCTCTTAGAGGGCACACAGGTGCCCACAGCTGCTGGGCACCTGTGTCTAACTTCTGAGGAGCTTCCAGCCTGTTGTACAGCCTGTGGCAACACCACTTCACATTTCCACCAGTGATGTGTACCTAGCCAACACTCGCATTTTCTTGCATTTCGTCATTAGCCCTCCTTGTGGATGAGAAATAGCATCATATTGTGAACTTGACCTGCATTCCCTGCTGGCCACGATGTTACATAACCTAAGTCATGTACAGCCACTGCCCTTGGACCTTCAGACCTTTCTGAAATGTCCCATTTGTATTCAGCATGAGTGTGTCCCCAGCTTGTGAGAGCCCTGAGCCTAGCTGAGCACTGGGGCCTGTAAAAGTGCTGGATCCTTGGCTTCCTTCTCAGGAGCCTCAGTGGAGGAGTGGGTGCTGAGGAGGAGAGAACAGGGTCTTGTCTCTACAGACAAGTAGGCAGGCTTCAGGAAGCATCACCTTGTCCCTCTTCTTCCCACAGGAGGTCCAGGTTCCTGTGACTCCAGCTTTGGAAGTGGCATCAATGTCTTCACCTCAGCCAAGTAAGTGCTTTGTGAAAAGCCAGTGGTCTAAGTCTTTCTGGGTGCAAGAGATTGCAGCAGAGACCCAAGGAAACTGTCTGAGGCCACTCTTGGGGGAGTTTCTGATACACAGAGGAGATACTTGAGGAAACCTGAAGGGCCACAGGCACCCTCTCCCCGGTGCCTCTGGACAGAAGGCCTTTGGGAAAGATGGGAAGCCACTGGAGGTCTGTAGATGCACATCCTAGAAACCCAGCCGTGTGTGGTGATGGCTTTGGGGCTGCAGTTCCCTTTGCCAACATCTTTTCTTTATCCAAGGCAAGGCCGACTCTGGGCAGGGGAGGCATGGAGAAGAAGAAGGAAGGAAGGGCACAGCAGGCGAGAGAGTGATCCAGGCACAGGCACCAGAACGGTCCCACCTTCTCCCAGGATAGGTGTCATAGGACAGGCTTCCACGGGGGGGCAGTGCAGGCCAGGGAGCAAAGTCATAGCCTGCCTTGCCAACCCCTTGGGAGAGAACTGTCATGGTTCTCCCGTGGGCTGTGTCTGCTGACCTGCCTGCTGGAGCTGCTTCTTTGAAGCATTAGCACCTGTGCCTAAGGTGGATGACATTTCTACAGTGATTTCCTCTGAACTCAACGTTGAGCCATTGCCTGGGGAGCCAATGGAGAAAATGTAAAAAGTCAGCCCTTAAATATGATCCTGACTTCAATACACTTTAATGGCAGACAACACAGTAACCAGCAGATTTCTAGGAGACAGGAGAACTGTAAAGGGGTAGGGGACCAAGCCACTGTGAATGGTGAAGTGCTCCCACAGCCGGGCTCTGTGCTTACCTTGGTCAGACCATTGGGTCTGCTAGTCCTGGGGTTGACAGAACCATTATATCTATTTTAGGGATGAAGAAGATTGAGGAAATAGGCTACTCTATACAGAATGGTTTTAGGGGAAGGTCGTGTGGCTGGGGAGAAGGGACAACAGCTTAGACTGAGAAGCTGGCAGGATGGAAGATGTGTTTGAGAAGGAGGCTTGGCAGCTTTTCCTATTTGTTTTGTTTTTTGTTTGTTTTCTCGTGTCTTTTTATTTATTTATTTTTATTAGATATTTTCTTTATATACATTTCAAATGCTATCCCGAAAATTCCCTATACCCTCCCTCTGCCCTGCTTCCCTACCCACCCACTCCCGCTTCTTGGCCCTGGCATTCCCCTGCACTGGGGCATATAAAGTTTGCAATACCAAGGGGCCTCTCTTCCCAATGATGGCCGACTAGGCCATCTTCTGCTACATATGCAGCTAGAGACAGGAGCTCTGGGGGGTACTGGTTAGTTCATGTTGTTCCACCTATAGGGTTGCAGACCCCCTTCAGCTCTTTGGGTGCTTTCTCTAGCTCCTCCATTGGGGGCCCTGTGTTCTGTCTTATAGATGACTGTGAGCATCCACTTCTGTATTTGCCAGGCACTGGCATAGCCTCATATGAGATAGCTATAACAGGGTCCCTTCAGCAAATCTTTCTGACATATGCAATAGTGTCTGGGTTTGGTGGCTGATTATGGGATGGATCCCCAGGTGGGTTAGTCTCTGGATAGTCCATTCTTTCATCTCAGCTCAGAACTTTGTCTCTGTAACTCCTTTCACAGGTATTTTGTTCCCTATTCTAAGGAGGAACAAAGTATCCACCCATTGATCTTTCCTTTTCTTGATTTTCTTGTGTTTTGCAAATTGTATCTTGGGTGTTCTATGTTTCTGGGCTAATTCCACTTATCAGTGAGTGCATATCAAGTGACTTCTTTTGTGATTGGGTTACCTCATGAAGGATGATATCCTCCAGATACATCCATTTGTCCAAGAATTTCATGAATCCATTGTTTTTAATAGCTGAGTAGTACTCCATTGTGTAAATGTACCACATTTTCTGTATTCATTCTTCTATTGAGGGACATCTGGGTTCTTTCCAGCTTCTGGCTATTATAAATAAGGCTGCTATGAACATAGTGGAGCATGTGTTCTTATTACCAGTTGAAACTTCTTCTGGATATATGCCCAGGAGGGGTATTGCTGGATCTTCTGGTAGTATTATGTCCAATTTTCTGAGGAACCTCCAGACTGACTTCCAGAGTGGTTGTACAAGCTTGCAATCCCACCAGCAGTGGAGGAGTGTTCCTCTTTCTCCACATCCTTGCCAGCATCTGCTGTCACGTGAATTTTTGATCTTAGCCATTCTGACTGGTGTGAGGTGGAATCTCAAGGTTGTTTTGATTTGCATTTCCCTAATGATTAAGGATGTTGAACATTTTTTCAGATGCTTCTCAGCCATTCGGTATTCCTCAGTTGAGAATTCTTTGTTTAGCTCTGAACCCCATTTTTAATAGGGTTATTTGAATTTCTGGAGTTCAGCTTCTTGAGCTCTTTGAATATATTGAATATTAGTCCCCTATCTGATTTAGGATTGGTAAAAAATCTTTCTCAATCTGTTGGTGGCCTTTTTGTCTTATTGACAGTGTCCTTTGCCTTACAGATGCTTTGCAATTTTATGAGGTCCCATTTGTCAATTCTTGATCTTACAGCACAAGCCATTGCTGTTCTGTTTAGGAATTTTTCCCCTGTGCCTATATCTTCGATGCTTTTCCTTACTTTCTCCTCTATTAATTTCAGTGTCTCTGGTCTTATGTGGAGGTCTTTGATCCACTTAGACTTGAGCTTTGTACAAGAAGATAAGAATGGATCAATTCGAATTCTTCTACATGATAACTGCCAGTTGTGCCAGCACCATTTGTTGAAAATGCTGTCTTTTTTCCATTGGATGATTTTTAGCTCCCTTGTCAAAGATCAAGTAACCTTAGGTGTGTGTATTCATTTCCATTGATCTACCTGTTTGTCACTGTACCAGTACCATGCAGTTTTGGCAGCTTTTCTGATGGACAGGATGGAGCAGATGAGAGGGATGGGAAGGGCGGCCTCTAGGTGTTAGCTAATGCTAAACCAGATTGTGCTGGCTCATTCCTAAGTTGGACTGCAAGGAGAAAAAAAGTGTGACTCAGACTATCTAGACTCCACCCAGTCATGCAAGGCATCCTCAGGGAGGAAGCTCAGTGTGGACACTGGGTTTTGGAACTCAGGGTTGGAGGAATGGGCAGGCATATAGGGCATACGTGAGTCCGGGAGGTCTGAGCACTGGGCTCGGAAGAATGGTGGAGTCTGTAAGGGGATTTATGAGCTCCCACTTATAGCCAAAAAAAAACCCTGTCTGACTTACTTAGCACTGTACTCTGGGCTGCAGAGACTGTCATGCTTCAGGGGGTGACAGTGAAATGGAGGAACATATACGGTGTGACTGATGGACTGCAGGGGTGGCACAACCTTCTACCACTTCTCTTTCAGTTTGAAAACATGCTCAGCTGGACAGGCCTACAGAGACTTGATTTCTTCTCTACAGGTCAAACCAGCGAGCTGGAGCTAGTTTAATTCACCATACCTGTCACTCAGGAGACAATGCTAAACCTAACCTTTTAAGAACACACGCAGGGAAACAACACACCATGTGCTCCACTGGTGCAGGAAGACCATCTTGTGGCAGCATCGTCGAGTGCAGCCCTGCCTGTGCTTAGAAGCAGCAGCCACAGGAATTATGAGAACAGATCGGACATTCAGAGCCTCTGGCCAGCTCCCTCCAGGGCCACTGAGCTCCCACAGATGGCATCGTTCAGGGTGTCACAAAACAAGCTGCCCTCCCATCTTCTCATGTGTTGCTTATCCAGAGCACTACCCAGATAGCCAAGTACGAGCAGTGGTTAGAGGGAAGGTTGTTCCTGGTCACTGGCCTCTTAGTGGTCACCAGCCTTTAGAAAGTCTAATGACAGCTGTGTAGGAAAGTACACACCCACACAAAATTCCGAATCCATAGACAGTCGGGGAGTCAATGCACTAAAGCCACAGATGCCTTCTGCCCCGGTCTGGGGCCCAGGCTCGGCCACTAAGAGAGCCACTGAGTAAACAGGTAACATCTCTGTCTCAGTGGATAGACAGTCAAGCAACCCCCGTCAAAGGGGTCCAACCTCCTCTCCCCTCCACAGTGCTGGAGCTGTATGGGAGGTTGAAGACAGCAGAATGGAGAAAGTGTGGTAGAAAGCAAGACAAAGCTGAGGGAGGATTTCACCACTGCTGTCTGTCTGTATGCCAGGTGCACCTCTCCTTTGGAGAGAAGCCCTCTGGGGTTCTCATCCTGTGGGCTGTGTGTAAACTGTTGGGGTAGTGACAGCATTGACCCCAGAGAGGAATGGGATGTCAATGAGTTAGTTACATATGTGAAAAGCCTGGAGCAGTGCCTGGCGGACAGCACACACTTGGTTGCACTGGCTACCTTGGTTATCACAAGAACCTCCTTATCCTCATAATCAAAACGAGGAGAGGGGACAGAGAGGTTAAATTTTTGTTGGAAGCCACCCCGCTAACTAGTGATGAAGTGAAGGTCCAAGCCTTTCTGGCTCCATATCACCAGCATTTAGCTTGCCGGATTATTGCTGGATAGCTCTAGGAGGGTGCTCATTGGCCTCTCTGACACATTTGGCAGGTTTTTGGACAGGTGTCACTGTGCAGACCTCCCCCCTGACACCTAGGGCCTTGCCAAGAGCCATGGTGTCACCAATGACCATTCAGGACTATTGTCCTGGTGTGGTTGTCTTCCCTGTGCCACAACCTGCAGAAAAGTCTAGAAGCTGATGCTGCCCAACTTTGAATGACACTGCCAGTTAAAAAAAAAGGCTGCACTGACCTGATGTCTTAGAAAGGCAGCACTGGATTCCTAAGCTCTCTCTTCACAGTTACCTTTCTTCAGTTTGATGTCAGCTATAATGTGAGTGGAAAAGAAAGTTATGCACTTCAGAAATACAGTGCTGCCTCCCAGAAAGACCCGCTCACTGGGTGCTGTGGCGTCAGAAGCATGGCTGGGCGATCCTGTGCTTTAAGCGGCAGCAGTGCAGTACACGTGGATATTGTAGTATATGTTCATGTAAGACTCATTTTTTGCTGAAGATGCCTTGAAATAACTCGGAATCTCTTAGGAGTGACTTGTCTAGACATATTGGAACCGGTATAGAAATGTATTTTAAACCTCCTGTGAGTACTATTCTGTTCATGATAGCTTAGCCAGAACCAAGGACATGCATCTCAGGCTTGGCCCAGTAGAGGGAAGCCGACCACTTTGGGCAAGCACACCCCACTCTGGGAAGGTCTCACAGCTCCGGTTCTCCACAAGCACGGGCAGAGCTCAGCAGCCAGCACCACCCACCAGAGCCGCCTGCTCAAGGGCAGGTGGGATCCGGAGCTCACTGTGCTGGCCACAGAGATAAGTGTGCAGCTGCTTCCCTCTTCCCGTGACCTTCACCTTGAACTAGCCGAGGGAAAACAACTCAGGAGCATGTCTCCAGCTAAGAGAGTGAGTTCTTAGCCCTTGGCCTCTTGACTTGGGTGCATCTCACTCTGCCTCTGGGCCCAGGACTCCTCCTCTGTGCATTGGCAGATGGCCTGAAACTTGAAGTTCCTTCCATGACCTCATGATTGTTGGTTGAAGCTAACACCTTGCTAGGGATTGGGGGAAGAAGTGTCATTGAAGAGTGTCATCATCTACAGCGCTGCCAGCTTGCTTTCTTTACTATGTGGTCTTGACATGGCACCAACAACCTGAAGGGATGGCCAGGGCTGGTTCAGCTGAAGTGTAGCAGTGGTCTTCAGGAACACGCACGCACACACACTCGCACACGCACACACACAGCATTCCGACTGCCCTGTGACTCCTGCTGGAAAATGGACCTACTGTAGACCCTAGGGCATGGGGCTATCAAAGAGTGGCTGAGAAAGGGCAGTTACCCTTCAGTATCCACCTGCTTCGTTAAGGCCCTGGACTGTGGCAAGCATCCACTTTACCACTGAGACAGCTGTTCTAGCCATAAGATTGTATGTTGATATGCTAATGCCGTGGCTTAGTTAAAACATGAAAGCTAACTTCGGCTTGGAAACTAAAAATTGTCGAAGCCCATCCGTGCTTCAACTGTGTTTCTGTTGGACAGAGAACAGGATAAAGGGCTTGAATGGCCACTGTTTCTGCCACCCTGGCTCTGCCTATCATTTGCTGCCAAAGCCTTGACAGTTTGAAATGTTCAAAATCCATCAGGAACTCCTAGCCATGTGACTCCTGGAATAGCACAGTGGCTGCCTTCCTCTGTGCAAAGGCTCTATTCTGGGTTCTGTCACTGTGTCACATACTGAGATCATCCGATCCCCTGAGAATGGAATGCCCACACTCAACCCTGAAACAGGCACCAGAGAAATACCAGTGTGTATTAAACAGCAATTCTGCCTCGTAGTAATAGAGCCACGCCCCTTAGAAGTCATGAGCTTCAGAGAGTCTGCAGGTGCATGAGGAAAGCACGGCCATC
GF3 -1 -1 1 CTTGGTGGCGTGCGTAGAGCGCATTATC
GF4 -1 -1 1 GTGGCGTGCGTAGAGCGCATTATC
EX52 -1 -1 1 CTATCTCACAAGGGTGCATGTAACAAGAAC
EX32 -1 -1 1 CACATAGACTTAGTCCTCCCTAAGTCTCG
GR3 -1 -1 1 CACGACTCGGCAGGAATGGCGCTC
GR4 -1 -1 1 CAGACACGACTCGGCAGGAATGGCGC
Comments:
Created
Target: 2803Ensembl ENSMUSG00000010936 -- 113158186 -- 113160933 ENSMUSE00000312148 -- ENSMUSE00000212587
creating candidate regions
attempting to insert candidate regions into db
done inserting candidate regions
running aos on us and ds
running aos on gaps
finished running aos
AOS Produced 8 oligo candidates from u/d regions
AOS Produced 14 oligo candidates altogether
inserted results of aos runs
Aligned target to NCBIM37 assembly: chr: 8, start 113158186: end 113160933
Found 11 RP24 black6 bacs on NCBIM36
Found enough RP24 bacs: not looking for RP23
Entered all non-repetitive oligos
Sequence count unchanged by blasting
finished aligning oligos to bac
REJECT (1) gap pair G5:8:113151686:113152685_635 G3:8:113164433:113165432_805
REJECT (3) gap pair G5:8:113151686:113152685_635 G3:8:113164433:113165432_756
ACCEPT (0) gap pair G5:8:113151686:113152685_635 G3:8:113164433:113165432_799
REJECT (1) gap pair G5:8:113151686:113152685_621 G3:8:113164433:113165432_805
ACCEPT (0) gap pair G5:8:113151686:113152685_621 G3:8:113164433:113165432_756
ACCEPT (0) gap pair G5:8:113151686:113152685_621 G3:8:113164433:113165432_799
REJECT (1) gap pair G5:8:113151686:113152685_616 G3:8:113164433:113165432_805
ACCEPT (0) gap pair G5:8:113151686:113152685_616 G3:8:113164433:113165432_756
ACCEPT (0) gap pair G5:8:113151686:113152685_616 G3:8:113164433:113165432_799
DESIGN COMPLETE
U-type: U1
D-type: D1
Creating display features: mapping to reference assembly
Created display features
Inserted short and long range genomic sequence arms

webmaster@sanger.ac.uk

Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SA, UK  Tel:+44 (0)1223 834244