High Throughput Gene Targeting: Create Design

This custom vector design tool is provided by the EUCOMM consortium as a service to the research community. When using this tool, the user agrees not to submit more than five designs per day for creation without prior discussion with the High Throughput Gene Targeting Group at the Sanger Institute.

Design Type Oligo Select Method Artificial Intron Design
5' retrieval block size U block size Min 5' spacer Critical Exon Min 3' spacer D block size 3' retrieval block size
 
       
Subtype Domain Disrupted
Gene Build Gene
Start Exon End Exon
Target Start Target End
Primer Length Design Comment
Created by am9
Valid After Annotation
not done
oligos on fwd strand oligos as ordered View gene and design in Ensembl UCSC BLAT recombineering primers
Design ID: 199322
Chr: 12
Strand: -1
Status: Ordered
BACs: RP24-571K16 : RP24-404K19 : RP24-342O5 : RP24-67O19 : RP24-137G6 : RP24-366K10 : RP24-487D21 : RP24-201F1 : RP24-282A24 : RP24-122H10 :
Instance: Plate 129: Well D08: BACs RP24-342O5 RP24-67O19 RP24-571K16 RP24-404K19
Instance: Plate 199: Well F10: BACs RP24-342O5 RP24-67O19 RP24-571K16 RP24-404K19
Oligos on GRCm38:
Type Start End Length Seq
G5 112926534 112926583 50 GTTCCTCATTTAGCCAACAGGGACCTCCTAAATACACCAGCCACCAGACC
U5 112920848 112920897 50 TGATCCACCTTAAAACAAAATTCTGGGACCCCAGGATGGACTGTCCCATG
U3 112920784 112920833 50 TGGGCCACCATTCTCTCCTCCTCCTCCTCCTTCTGCCTCTGGCTCTCAGA
D5 112919921 112919970 50 ATTCCAACTCTATAGCATCTGATTCCCTGCATGGTGGGCACCTGGCATGA
D3 112919861 112919910 50 CACATGCTCAGGACAGCACTGCCCTCTTCGTGGCCACAAGCTTTGTAAGG
G3 112916055 112916104 50 AGCAAATGAGAGGACGAAGTCAACGGGTACAGACTATGGCCAGTGAACGT
Oligos:
Type Start End Length Seq
D5_D3 114158122 114158131 10 GCAGGGTTCC
15_E_15 114143073 114174109 31037 TATGTCTGTAGCTGGACCACAGTTCATTCCCAAATTTCTCTTCTTCATCTAGGCAGCAGGATTTGTAGACAGGGGAGTAGGAGCAATGTTTCCAGTCAGACGGTCACCTTGAAGGCTTCAGCAGTTCCAGGGGACAGACACGGATTTCTCTTCACTCGGCCAGGGAAAGAAAACCCAAGGCCAGTAACAGCCTCCGGGTGACAGTGCATGCAGATAGCTAGCCACATCTGGCTGACCACATCTGGCTGGCCTTCCTGAGGGATGAGCCTCTGTGCATCTGACTGTCCAGCTCTGCAGAGTGGGCGAGCTAGTATAGGAACAGGGTGGCCCTGGGTTGAACCCTTGCCCATGGGAACCCTGGTGTCAGCTGAATGGCCTATATTCCCCTACAGTCAGTGGCCACAACGAAAGTGGGGCCAGCATTTATGACCCAGTAGGGACTCCAGACAGAGGGGACTGTGGAGTGAGCAAGGGAATCTGGGCCTGTTTAGTATTGCTATCAGCATGGGCTAGCTGTAGCCAGTCTGTCCCCATTCCTGCTGGGTAGCAGGTTACCTGAGTGAAGACTAATTCTCAGTTACTGACCATGCCAAGCTTGAGGAGGGTATAGTTTGCCAGAGAAGCCTGGAACCTGCAATGGACTTGAGACACTGGACAGTAGATGTGGCGGGAGGTGCAGGCCTGCAGCATGTGTGCATGTGGGCCTCTAGAGACGCCAGCTCTACTCATGCACTTGGTGCACACCTCACACGTGTGCCACTCCCACTTCAGCCTCCAGCAGCACCTTACCTTGGACAGGCAGATGGTAAGACTTTATCCTATGAGCCCCACCTGGTCTATGGGGCCTTCCCTGGCACCATCCATGCATGAGCATTCCATACACACCCTTTAGGAAAGATCTAGCAGCAGACACAGACGCACCACAGGCACACACATAGACACACACACAGACATACACAGACAGAGACAGACAGACACAGGCACACACACACACTCACACAGACACACACACACAGGCATGCACACAGATACATACACACAGGCACACACACACACACTCTCACACAGACACAGGCACACACACAGACATACCTACACACCCACACAGACACAAACACAGACACACAGACAGACACACACACACACACAGGCACACACACACACACAGGAGCACACAGACACACATAGACACATACACACACACAAACACACCCCTCTGCTTGTCCTAAGACTGTGTTCTCATGGTAGCAGGACTACCGTGACAGGCCCTCAACCCAGGACTCTTGGCTGCTGTTGCCATTCCTATCTGTTGTCCCTAGCTATATCTGGACTGTGTATGTGTGCTCACGTGGAGAGAGATGTATGGGTGTGTGTAGGTGCATGCGCACTGTGAATACATACGGAAGCCTGAGCTTAACCTTGCAGAGCATTTCTCTGAAGCCATCCACCTTTAGTTTGAGGCAGGGTCTCTTGGTCCGTAACTGCCAGGGCTGAACTCATCTCCCGTGCTTCTGCAGCAAGCGCCGTACCAACTGGGCTCTCTCTCTTCAAGTGCTGGCCATCTCCTGAGGGTCATCTTCTAGTTGCACTGTTTCATTTGCGGTCCACATATCTTCCTTTCTGCGGCTTCTCTGGCTGCCAGTGCTTCTGAGGAGGCATCTGCTTTGGGCGCGGTGAGCAGCCTCGCTCTATGGATGGTGACTGAGAATCCTAACGTCTGCATGCAGGCCTCTCTGCAGTCCGTTCTTCAGGCTGCTGCTCACAGGCCGGGCTTCCCGTCACTCTGAGGGTCTTGGCTGTAGTCTGCTCAAGGACCATATAAAGTCATTTAAGAGACCAGTGGGTAGCATTCTAGAACAGGGGAGGGTGATATTCATTCCCATCATGCCCTTGAGGGCCTCAAATTATCAATTAGGAAGAAACTTGAAGCCTAGGGGGTGTTTTTTAGCCAGCATAATGGCGGGAACGTAACTTTCAAATCTTATTACCGAGTCAGGATGAAGACCACGCCTCCTCGGCAGGCTTGCGACGGGACTGCCCAGTGCCTGCGAGTGTTGCTGCTGGTCTAGCACTTCTCTGAAGAGCCTGGTGGGAAGACTCATCACACACTGCAGTATTAGAGAAACAGCACAAGGCATCTCCAGAAACAACCCTGGCAGGAACCAGACCAGCTTTTTACCCAGCAAGAAGTATAGTGAGTCCCCCTCCTCTCAAGAGCCAAGCATTCTTTCTGCTCTCCTAAGCTGTGGATGCTGGCCTTGCTATGTACCGTCTGCCAGCCTCTGCCAGAGAGGGCAAACACCCTGTGCACTGCTGGCAGTTGGCTCCAGGATTGGCTCCCAACGCCCAGCCCCGAGGCCACCACTGCTTAGTCCTTATAGTTTCTACTTTAGATATAAAGACAAGAGGGCCGGGCGGTGGTGGCGCATGCCTTTAATCCCAGCTCTTGGGAGGCAGAGGCAGGTGGATTTCTTGAGTTCGAGGCCAGCCTGGTATAGAGTGAGTTCTAGGACAGCCAGATCTACACAGAGAAACCCTGTCTTGAAAAACCAAAAAAAAAAAAAAAAAAAAAAAGACAAGAGGGCACTGGCTAGAAGTCTGTGGCATCCTTGGGCTTCCTTCTCTCAAACTTGGGGTCTCTTAGACTGTGAATTCATTTTTGCTGAGCACTGTCCCATTTCATAAAGCCCTCTCTTTAGTTAGGAGGCCAGGTACACACATTCCCCAAACCTTACTCCCCAGGAGGGTTCCACTAAACGGGTGTCAACTACTACAGTAGGACTCCAGCAGTGCCTGAGGCCCAAGTCACCCACTGCGCTGAGGTCAACAGAACCACCTGACCTCTTAAGACCCCACATCAACATGACCCAACCCTCAGGCCATGTCCCACTTCCACCTATGTCCCAACTGCACATGGAGAAAAGGAACAGAACCCAAAGAACAGGGAGGCCAAAACGTTTAAGTTATTAAATCAAATATACAGAGTGATTCATTTAATATGTACATATTTACAGAAATGCACTTTCACAAGGAGGGTGGCCGGGGCCGGCAGGTGGGCAGCGGCCTGGTGCCCACGGCAAACGCTGACAGCTGGGAGGGGGTCTGTGTGAAGGCACTTGTCACAAGCTTCAATACTGCCGCCGTCCCGGGAGGGAAACCGAGCAGTTGGGAAGGGCACTTCTGAAAGCACAGTTGGAGATCTCTGGAGAGTTCTGGGCAGGAGGAAGCAAGGACAGCAGGCTGGAGGGGCTAGCCAAGGCATGGGCCAGGTTTACGTGCCAGCCTTAGGCCACACCAGTGACCTCCAACCCCACTGACAACCACAGGCGCCACCAACAGCTATGTAACCGGCATCACACGGGCCACCACGGGTCCCACTGACAGTACGCCAGCCCAGCAGCCAGTGCCACTGACAGCCACAGGTCCCACTGACATCCACAGGCTGGGCCAATTGCCATGGGTACCATGGACAGCCACAGGTCCCACTGAGAGCTACAGCTAAGACAACAGCCACAGTCCCACTGACAGCCTCGGGCCATGCTGTCAGCCACAGGTCCCACTGAGAGCCACGGGCCACACTGAAAGCCACAGATCTCACTGAGAGCCACAGCCCAGCCCACAGGTCTCGTGGGCTTTTGGGCCTCGAGCTAGAGAGAAACCCAAATGAGGAATAAAAAAGAAGATTCTGTAAACAGCGACGGCCTGTGGTAACAAACATTATACGATTTGGTGAGGACACACACACACACACACACATACACACGCCCTGCTCTCCTGCCACAGTGCGTGCGGACGCGGAAACTTTACAAAAATAGCAATGATCCGAGAATACTCCGTTGTTTTCCGCCTGACAGCCGTTGAATAATTTATACAAGGTTAAAGAAACGTAAAAAATAAACATTTGTTTTTTGGTTTTGGTTTTGTTTTTTACACAAAATAAAGAAACTATGCACACGGCCTTGGCCTCCTATGGTCCGGCAGGCAGCGTGGTGCCAGCAAGGGTTCTGGGTGCCAGCCTGGTGGCTGGCTATTCCCTGCCAGCACGGCGCACGTCCTTGGTACTTCTGACGGCGCGGTTGTCCACTTTGGGCCCTGGAGCCCAGCGGGCTGGCCTTCCGAGGGAGCAGCTGGGGTCTTTGGTGAACTTGTGTGAGATGAACTTCTCTGCCTCTGGGGAGTCCCCATCTCCACGGCTCAGCTCTTCATCCTCCTCGTCCTCCCCACCAGCCCCATGGCCAGCTGGCCCGGGCAGTGCCTCGCCTGCCCTGCGGGGCGGCGGTGTGAAGTTTTTGCACTGGTAGAGTATGTCCTTGTGGCCCCCAGTTCCCAGACCGCTGCCGCCTGGCCGCTCAATGGGGTTGCGGATGGGATTGAGCGGGGCCCACTGGTTGTTGGCGCTCTCATCCCGTGGTAGCCGGCTCCTCTCACGTTCTTTCCTGCGCTTTCGTGTCCACCATACGCAGATAACCACACAGGCGAGCCACAGCACACTGAACACGCTGCACAGCACGGGCACCAACAGACCTGGGTAGAAGAAGAGGTAAACATCCTGCGTCCACATGGGCCAAGCAGGGACTCTTCTGGTTTCCAGAATGAAGCTGGGTAGCAGCAGACACCTCTTCCCTCTGAGCAACATCCACAGCAGATTCCCACTGGTCTTGAGTCTGGGAGCCCCTATCACCCCAGCTTACCTGTGGAAGAGCCACCCATAACAACTGTTTCCACCTTGACCTCGGTGACAGCCAGCAGCAGTGAGCTATTTCCTCTCTGAGTGATAGCAGCCACGATGGCGTGGGCTGTGCTCTGGATCAGGCTGCTGTCAGGCAGGTCCCTTGCAGGGCTGAAAGACTGTGGCAGAGGATGACACTGGGGGACGGCCCAAAGGTACCCTTCCTACATCCCAGGAGCCTGTTATAGCCACTGCCCAAACTCTGATCGGGTCCTAGCCAGATGTACAGAGGGCTGCCATGGGTAGAACTGAATCAGTGCTGTGCTACACACGGCCAGGACCTGACAGGGCTTGGAGACCAAGAGACGGGAAGCTCAGTGCGGTTGGATCTTGATGTAGAGGATGCACCCGCCAGATAGATAAGGGCCTGGCCCTGCCCCTGTCAAACCCCTGCATCCTGTATGGGGACCGCTGGACAATACCAAACAATACCAACCCCAGAACTCTCTCTCTTCTTGCGTGCTGGGACCCGACCTGCACCCAGGCCATTTCCTCACGATAAAACCCAAACTCACATCCTTGTTGCCTTCCCATCGAGCAGCTGACCCTACGGACTGTCAGTGACCACCTCGACAGCCTGATGTTCTTCTCTTATAGCTCTGGCCCCTACCCGCCTGCCGCACGCAGTCCACGTGGATACAGCTTCCCCACCCAGCCGCACCCAGCTGTGGAGGTGCCCAGAGGGATGCCAGATCTGGCTCCTATCTCAGTTCCCACTGCCCCGGGTCTCCATTCCACCATGTAAGTGCCTCCCCGTCATCTTCAACTCTGCCACTGCCCCGCGGGATGCCAGAGTGTCACTGCCGCTGAGGGTCTAGAGGCCTGCTCAGTTCAGGTCACCACCCACACTCACCACAGCCACCTCCACAGCACTGGCCCCCGAGGATGCTCGATCACAAAGCAGCAGGAGGAGGCGGTCGTGTGCCGCCGCCCTCGTGGCAGGCAAGGCTCGGATTCCAGAGCAGATAGCGCCCACGGTGGTGCCCTGGGCAGATAAGCAACAGGTTAGCGGGGTTTAGGGCCAAGATCTGAGGCCATGTCTCTGCTGACAAGGAGCCTACCCTGCTCTTAACCCAGTCTGTCTGAGGCAATGGGAGGAGCTTGGAACGGCCACCGTTGAGTTCGAGCCCCTGTTCTGGGGAACGGGTAGGCTAGTTCGGAACATCCAGAGGGTGAGGATGGGACACATCAGAAACGGGAACTATCCTTTGCATGTCAATCCAAAGTAGGGTGGCCCGCAGCACCCCTGCAGTCTAGGCCCCAGGAACACTGGGCACGTTAGCAGCCCAGCCTGGACCCACTCTCTCTTGCCCAACAACGCCTCGGCTCAGTGCTTTCTCGTGTGATCCACCTATCTGCACAGCCACGGGCTTCTGGACCTACGTGAGCTGAGCCTTGAGAGAGCGAGCAAGCGGACTATCACTCTAGGGGTAAACCTGGGAATCCTGGGTCCCCCAGGAGCACTCACCTGAGGCACTTGATCACGGTTGAAGCGCAGTGTGAGTCGGGCACAGTTGTTGTCCAAATGACTGCTCCGTGGCTGACAGGGGGTGCTGGGTGGCAGAGGCTCCTCCGCTGTACACTCCCCCCAGTTCTCACAGGGTGGCTGCAAGCACTGACCCACGGCCTTCTCCTGACATTGCTGCCCTGGGGGGCACTGGGCACTCGGATCGCTGGGCTGACCAGAGAGCAGGCAAGGCTTCCATCCGCACCATACCTGGGAGAGACGCGCAGGAGACACATGGGAGCGGGAGCACAGTCAGACAGCACACAGCGCACAGTCAGGCAGCACAGAGAGAAGACATCAAGGAGTAAGTTTCAAGTCAATGTCTCTAACACCCAGGGGCCCTAGGGAAGCAGGCAAAACTCCAGTCCAGAGAGAACTTTCTGCCAAAACAGAAAGAACTAGGCAGAGCCTGGGAATGGACAGAGAAGAGAGGCAGGCCCAAGACCCCTCCCAGCTCATCCCCTTAGGATGGCCCTCAGAAGTGGGCAGCCTTATCAACCCACACCCCCACCCCTGCATCAGCCTCTTGATAGCTGAGTGAGCCTAAAGGCTCAAGATTACTCAGGGTCACAGTGCAAGAGGGGCGGAGGAGGGGCTGGCCCCACCTTGCTACAATCCCGGTGGCCATCCAGGCAGCGGCAGCTGTTGCAGTCTTCCATCCAGGAACTCCCATGCGGGAAGGACATTCCCCGGGACCAGCAGGGCCTCGTGAATATGACCACTGTGGTAAGAAGGAGGAGGCTCAACAGAGTGTCCAAGCGCTGGAGGGTGGATCTGGCCCACGCCCTGACCACGGGCACAGACAGCCTACCTTCCTGGCACCTGGGGCCAGAACGACCTGGTGGGCAGCTGCAGCGGTACCCGTTGATCTCATCCACACACGTGGCTCCGTAGGCACAGGGCGAGGACTGGCACTCATCAATGTCTGCAAGGAGAGCGGCTGTGTTCTTAGGGGTGTGCACCCCACCCAGGGACCAGCGTGTGGGCGAGGCAGAGGGCTGGAAGGCAGTACCTCAGTCCACCTGTCGCACAGCTACCTAGGCTGTCTGTGTCTCTGTCCATCTGAAGCCTTCTAACTCTCAGTCCCTCGCCCTCCTCTACTGCCTCTGTGCTGTGAGCACTCAGGGACCTCTGTGCTCCTCTCTCTCTGAGGTGGCCATGTACACAGAGGCATCCTCACAGCCTGAGGGGGCAGGAGCATTCCACCCTGTAGCCCCTCTCCCTCTTCCCAAGATGCAACTGGCTCTTCAGGAAGGAACTAGGCTCTCATAGGATGCAGACATGCTCATGGGAGGCAAGGGAAGGCTGCGGCCATGTCCCTGTCAGGATGTGGATGTTTATGCCTCCCGGCTTTCGATACTGAGATTGTCAGGAGAGGGCCCCAGACGAAGCCCCCAACCCCAGCCCCTTCCATCCACCTAGGCTGCTTACTGATACGGCAGTCAGGACCCGCAAAGCCAGGCGCACACTCGCAGCGGAACCAGTTGACGCCATCAACACAGATGCCTCCGTTATAGCTGCAAGGGAGAGGGTGGCCATAAAGGGTCCCCTAGGATGGGCCCTGCCCCCCACCAGCCTCCTGGGCCGCCACTCACCAGGGCAGAGGGTTGCAGTCATTGGTGTCTGGATTTAAGGGGAAAGACAGGGTGGTTATTTCAGCACACTCTTGCCCAGAACACCTCTGCAGCACATCTCTGTGTCTGAGGCTCGTGGGTAGACACTATCCTGTCCATACCAGCCTGGCACAGCCAGTGGAGAAGTACGAGGAAGGCTCAGGACCCCAAGGGAAGCCTCCATGGGGTGGGAGCTATAGTTGGAATGGGACCTATGTCTTAGCAGGAGCCCAAGCCTGCAGAGTGGTGGATCAGGGTAGGTAGAAGGACCCTGCAGATATGGCACAGGGACTGAATTACAAAGTGGCAGAGCAGGTCTCAAGAGTGTGGATGTGTGAGGTAGGCAGGTGGAAGAGTGGTTCTTCCTGGAAGTTGGAAGAAGGGATGGGGGTGGGGCTGGGTGAAGTTAAGCAGAACCCACAGGCCTCCCCCACCTGAAGCCCCTCCAGCTCACTATGTGTGCAGGTGCGGCCCTCCCAGCCATCCCGGCAGATGCAGGAGAAAGAGTCTCCGCTGCCCACGCAGGTGCCTCCATTCACACAGGGATTGGGCACACAGCTGCTGTTCTTGGCTGCAGGGAGGGAGGGGGGAGGATTGAGATGCCTGGGGCAGACCACAACATGGCTGGGGTCGGCAGCCCAGGGCTAGGGGAGGCAGCCAGCCTGGGTAGGGTGCTCACCGATGGTGCAGGTGCTGCCCTTCCAGCCCGGAGGGCACGCGCAGCGGAAGGTGTCGCCGCTGTCATAGCATGTGCCACCGTTGCTGCAGGTGTAGGCGTCACACTGGAACTCGCCTGCAAGCACATGGCCGCTCAGTGGGCGGGCCATATTGACCCCAGCAGGGTCCTGGCAAGCAGCCCCTCCACTCGCTCGCTTGCTCATTTGCAGGGACCCCGGGGCACTTACGTGAGTGGCAGGTCTTGCCCTTCCAGCCATCGTCACAGGCACAGTAGAAGTCATTGACCAGGTCATAGCAGCGGCCGCGGCTGTGGCAGGGGTCGGGGAGGCAGTCGTTGGGATCTGGGGGGAGGACGCCGGTCAGCGGGGGTCACCGGCGCTGGGGAGGGCTTCACGGAGAAGAGCAAGAGCTGGGCCCAAGCACATGGGAGCCTGGGATTCCACCCCATGACTTCAGGCCCATGTACACAGTGCTGAGTAGGACATAGGGGTGGAGCCAGGCCTTAGCCAGTGGGGGCGGTCCGGGTAAGGCAAGGGTGCAAACTCACTGATGTCACAGAGTTCTCCTTCCCAGCCACTGGGGCAGAAGCAGCGGAAGGAGTCCACTTCGTCAATGCACGTGCCCCCGTTGCGGCAGGGCTGGCCCATGCAGTCGTCAATGTCTGAGGGAGAGGATGGGTGAGCTGTCCCTGTGGCTGGCCAGCTTGCCCCACCCCACCAACTCTGCACACCACTCACTTTCATGGCAGTAGGTGCCTGTGAAGCCGCTGTCACAGATGCAGGAGAAGTTTCCCCCAGGCAGGCTAACGCAGTGCCCGTGAGGGCCACATATACCAGAGGGTGCGACACCGCGTGCCCTGGACCCTGCCTCGAACCCGCAGCCATCGATCACTGTGGCAAAGAGATGGACAGGGGTCAGACCCATCTCCACCGGGGTACCCACCCAGCCTGAAGGGTTGCATCATGTACCTCTACATGCCCCGCCAGGGCATGTGTCCCTGGGCACTGAGCAGTTCTTGCCACCAAAGTCTTCTGGGCAGGCGCAGTAGTAGTCACCCTCAAGGTTGTAGCAGCGAGCACCGTTGAGGCAGGGGCTTGGTTCACAGAGATCCATGTCCACCTGCAGGTAAGGAGTGGGGGATGTATTTGTGAGTATCCAGCTCTATATAGAAGCACTGTTTCGTATAGACAACCAGGCCTCTCTGCCTTAGACCCAGCGGTGCCAAGCTGAGCTTGAAGCTCCCACCCACCCAAGAATGTCTGAGCACCGTCAGCTGGACGGAAACACCTGTGGGCCACCAGCCCCCTCCTGCCGCCCTCGCCTCCACAGCAGCCAAGCTTCCTCTGCCTCCCACAGACAGCATCCGGTTTTGGCTCCTCCCGCCGGCAGGAAGGCCAGCTTCTGACCCCCATGTTGCCAGGCTGCCCTCAGAGCCAAGAGAGGTCCTTCCTACAGCCAGCACCACCATGCTCTGGGGACCCGAAGTCAGAGGCCTCTGCCACGGGCCACTAAGAAGCCCACAAGGCCAGAGCAAAACCATGTGTAGCTCAGGACAAGGGAGATCACCCAACAGGGGTCAGGGTAGCAGCCGTGTGGAAAATCACCCGTTTCTTCCCAGGCCCACCCTTGACCCATGATGTCCACACATAAAATATGCAATTCTGCCTTTGGGGGTCCTTCTTGCAGGCTTCCCCTCTGCACGGTCCCATACAGGGAGTGAAGCATATAAGATTGTTGAGACAAGGGACAAGCCTGGCTTTGGTGACCCTCCTAGACAGGGCTCCCACCAAAGCCCCTCTAGGTTATTACCTCACAGTGCAGCCCAGAGAGGCCCCGTGGGCAGTGGCAGCGGAAGCCATCCACCAGGTCCTCACAGATGCCACCCCGGCGGCAGGGGCTGCTGGCACACTTGTCGTACTCTAGTTCGCAATGGCGACCTCCAAAGCCCCGCGGGCACACACACTGGTACCCATTGACCAGGTCCTAGGTGTGTGGACAGGTGGGTGGGTGAGCGAACCTCATACAACCCTGCCTGCCTCCTCCAGCCACATTCCACCCTCCCAGACTTGGCAGCCCCCTTACCTTGCAGGTGCCCCCATGCTGACACTGCCCATGGCAATCGTTGATGTCTGGAGGCAGAAGGGCATGCGGGTGGGGTCAGGGGGGCCCTCTGTGCTCCCCAGCCCCGCCCACCGGCGCCGCCCACCCATACTGACTGATTTGGCAGTTGATGCCCTTCCAGCCCGGGAGGCAATCACAGTAATAGCCGCCAATCAGGTTTTTGCAAGAAAAAGCATTAAGGCACGGCTTCCCTTCACACTCATTGGCGTCTGTGAATGAGACAAGGGAGCTGTGGGGCTCGGGCCCCACTCACCCACTGGGCCCTGCACCTGACGCCCGCAGCCCCAGCAGTGCCAGCAGCAGCAGCAGCAGCAGCCACATGCACAGCACACAACCCATGCACAGACAGTCCCCCCCAGGGAGCCCTTACCCAGCTGGCAAGTAGCCCCCACCCACTGCTCCGGGCAGATGCACTCGAAGCCGTCCACCTGATCCACGCAGGTACCACCCGCTGCACATGGGTTAGAGGCACACTCATCAATGTCTGCAGTGGGGGAGGAGGAAGAGAGAGAATGAAAAAGAGGTAGGTAGGTAAGGGTGTGGCCAGCAAATGAGAGGACGAAGTCAACGGGTACAGACTATGGCCAGTGAACGTGGGATCGTGTCTAGTTAGTGTAGACCCATGGACAGAGGACATGGGGTGTGGTCAGTGAGTAGGGACACAGTACACGGGGTCTCAGTCTGCAGCAGGGAGTCACAGTCCCATGTAAAGCAGCAGGAACCGATTGTTTGGCTGCAGTGTCTGCTGTGCAGCGGATTCAACCACTCTGTCCACACCCCGAAGTGCTACCCACTCCTACCTTGTGAAGCCCCCAGACACTCACCGAGCGCACAGGTGGGTCCGTTCCATCCTGACGGACAGTGGCATTCAAAGCCAGATGGCACTTCGTGGCAAGAGCCCCCATTGGCACACGGGTTGGAGGCACAGGCGTGCTCAGCTGCAGAACCAGAACATGAGTGGAGCGATGCCCACTGAACTTGAGCACGCTTCCCCGAGCCCACCAGACCCAGAGTTCACAGGGGTACAGCCCACTGTACAAGGCAGTGAAGAAAGGCCTCAGCCAGGCTCCCCGAGAGACAGCATTCCAACCTACCCCGCTCGCAGTTCTTGCCCAAGTAGCCATCTGGGCAGGCGCAGAGGTATTGGTCAGGCTCAGCATTGATGCAGGTACCCCCGTTGACACAGGGGTGGTGGCTGCCACAGTAGTTCAGGTCTGGGCACAAGGGTAGGGCTCTCAGGGATGGGCCCAGTGTCAGAGCTTAAGGCCTGGCCCTGCCCACTGCCCACCATCTCTCTACCTTTGTCACAGAGCAGGCCACCCCAGTTGGTCTCACAGTCACAGTGCCAGGGCTCCACACAGCTGCCATGCACGCAGCCAGGGTAGGGGACACACTCGTCACAGAACTTGCCCTGCCAGCCGTAGCTGCACCTGGGGGACCGAGCGACGAGGCCATCAGCCGGGCAGATGAGGAAGGGGCATGGGAGGCAGGCACAGAAGTGCAGGCTACCCCTACTGGGTGGTGGTCCCAGAGAACAGCTCTGAACCAAGCAGGGGTTACGGCCTGCCGGCCAGTCTCGCTGTCACAGGCATTCCCGGCCACTGGCCGAGATGGTCAGCCCAGCTGTCCCGTCACTCCCCCTGAGCTATTCTAGGACTCAGCTCTGAGCCAGGCGCCTGGAAGGAAGGCCCAGCCGGGGGAGGCCCAGGGGTACAGTGCCAGGTGCTGCTCACCAGGTGCTGCTGGGACACAGCAGCAACTGGGATCTGAGAGGGATGAAGAGGCATCAGGAGAGATCCTAGCTACCCTGGTCCAAGGGCTCTGTGACCTTGGGTGCCGCCCATATCCTCACTGCTACTCAAGGGCAGAGGTTTCTCTGACTCCTAGGACAGTCCAACCCAGTGGCTGCCCAGCCAGCCCTATGGGAGCGCCACACTGAGTGGGGCTGAACCCAACACATAGACCCGAAGACCTCGTCAGAGGCCGTAATCTTACGACCTGGCTCTGACCACACTGGGGACTAGTGTAGCCTCTGGGGAGTCCCTCAGGATGTAAGTAGGTGGCCAGCACAGAACCAGCAGGTGCGAGAGTACAGGGCTCCAGTAGGGCTGCCCTCTGGGCCCTGGACAAGACTCTGGGGGCCCCTTCCTTAAAGGCTAAGGTCCTGTGGGGCAGGAATGACGTGCAGGCCACGTCACTTCCACGCTGACACCCGCCACAGGAGTTATTTTTATAGAAGGAAAAACCACAGCCCTTCCTGAGCTGCCCTGGAGCCACGCACACAGGCACTTATCAGCCCGGCTCACCCAGGCTCACATAGGGAAACTGAGGCTGGCTCCAGGGTCCAGCCCGGAACGTCCAAGGCAGGTCCACAGTAGGCCTCCCCTGTCTCTACTTGGGAGTCTTCTCTCCAGGTGATACGGGGAGTCGAGGGGCAGAGAGGGCTGGGACTAGCCTTGGGTCATTCACCAGGGAACACCAAGGCTAGCTTTGAGCCCAGACCCCGTGAGCCCCAAGGGCAGGTTCTCCACCCTGGGCGGGCCATCCCACACCAGACCCCACCTTGTGGCTTTCCTGCCAGCCGTTCCAGGGCCTGGGGAGGGTGGCAGGAAAGCACGGCCATCTCCGCAGTAGCATCCGGCTGGGGAGGGGTGTCCTCTGCTGAAACCTGAGCTCTGGACAGCAGGAGGCCACTTGGCCTCACCCTCTGGCCCAGGGAGAGGGTGGCACTCACCTACCACCCCCTACCCTTGCTTTCCTCCCCAGGGCTCCTGCCTGTGTGCTACCCACAGCCTTTCTGCACGGAGGGACGGAGGGACGTTGCCTCATCTTTCATCTCCCTCCAGCACTGACCACTTTGGGATGCTGCTGGTATAGCCGCCAAGATACCGTAATATACCTTGGGCTACAGAGTGAGTGTGGGGTTAAGAGTAGGCTCCTGTGTTTACCACCAGTGGGGCACATCTGCCCAGAACCCACGCCCAACTCCAGCACACTGCTCAGAGCCGGGCTGTGAAAGACTGCACTGGGGCAGAGGGCTGTGTGGATGGACGATTTCTGCTGCCTGTCCCACCCCCCATCTCCCTCCTTGGATGTGGCTCCTGGAGTAAGAAGCCAGCCCATCCTGAGACAGGTGCTCCTTGCACTGCCTTGAGTCCTGCCAAGACTGTCTGAAACCACACTGTGTGCAAGTGGCACCTGGGATGTCTCCACTGCACACCCATCTCTTTCTGCCCAGGGACCAGCCTAGCTGCTGAACACATCACTAATGCCACTATACAACCCCTCCCCCAGCCCATCTCAACTCCCCAACTCCCTGGCCAGCCTCTCCCGACCAAACAGTACACGTCCCCATCGTCCTCATCCGAAAACACACGAGGTATACCCACTGCTCAGAGGGCACCCAGGGACAGTGAGAACCAGGATGGCAGGAGGGCCTTGGCAGGCCTACTGCTGTGGCTCCCCTGAGTCTAAGATGCTCATCTCTAACTCTTTTCCTACACCCTCCAACCCCCTGGGCCCCCACGTTCCCAACTCACACATCCCAGGGTGCCGACCTTTGCCTCTCTCTATCCTCTACCCCTAACTTAGCCTCATCACCTCCATCACCTTCATGAGCCCCAATGGCTTCTACTCTGCTCTGGGCTGCAGGATCCCCTCTCTGTCCTCCTCACCTGTCTGTCTACATGCCTCCAAGTGCTGCAGGCCAAGCCATTCCCAGCCCCTCCTCTCCACCTGACTCTGTGCTGCCTTAAGGCCAGGCCTGTCCAATGCGCCCTGCTTGGCACACACTAGCCCGCCTCTCTGACAATCATCCCTACCTCAGCCACCACAAATCCATGGTTTAGTGGCTCAAGCTAGCAGGTTTACAGCTCCTGCTTGACTGCACCCCCCTCCTCCTAAACCAAACTCATCATCAAATTCCTATTCCTCAGAACGTCTGCAGGTCCATCCCACCCCTCCACCCCACTGGCCCATTGCTCTCTTCTTCCTCACTGCCACGCTGTGTGGTTCTCCTCAGCCTCTCTTGATAGGGCTCCTCTTCCCCCTAAGCCTCTCTCTGCAGAATCATGTCAGTTTCTCCCACTAGCACGCCACGGTGACTTCCTACTGTGTTCACCTGGGCACCAGATTCCTCACATTTATGTAGTGCTCATATGTATGCATACCACACACACACACACACACACACACACACACACACACACACACGCTTGCATGCACACACACTTGCACAAGCATGCACGCACACACATACCCCTTAGCCTTTGCTTCTTGGTGATGTGACTACCTGGCCACCTTCCCTTGTCCCCTTCTAGCTGTCCCATGGAGAAAATGTCACTGGACATGCCACATGCTCAGGACAGCACTGCCCTCTTCGTGGCCACAAGCTTTGTAAGGGCAGGGTTCCATTCCAACTCTATAGCATCTGATTCCCTGCATGGTGGGCACCTGGCATGAAGCACCTACTTCGTGGCCTACTAAAGCCCGCAGGGTGCCCCAGCTGCTGCAGGCTCTACAGCAGCTCGGGTGAGGAAGGGAAGGGCAGGCATGGTGCTCACCTGCACTCCCCAGGCACAGTGCATCCCCCGTGGAGCAAATTACATCCTTGTTTACACACGGCTGGAACAGAGGGGCAGAGAGAGGCACAGCTGCAGCCAGCCATGCTAGCCCTGCCCGGTGCCCGTGCCCAGCCCCACACTGGGAGACAGACCCCTCACCTTCTTTGCATTCTTTGCCCATCCAGCCATCCATGCAGGCCTTGTTGCCGTACTGGTCGCAGGTATAGTGGCCAAAGAAGTCGTTGCGGGGCCGGCAGAACTTGTTGCAGGTGGCACTGTAGTAGTTCTCATCACAGCGTACTCGGATCTGCAGCTCCAGGTGTGCCACGTGGCCGCTGAAGTGCAGGCTCTTCCAGCGGTCCTCGGGGTTGATCATGCCAGCGTGCGACACCCGCTCAATCAGCAGCTCCTCTTTGGGAGCAGCCGAGTTAGCTGGCGGCAGCAGCTACCCGTCAGTCCCCCAGGGGTGCCACGCGGGCCCTACCAGGCAGCTTCAGGGGCAACAGGGCAGCCAGGCAGAGGAAGGCTGCCAGCCCTGCAGGAGCCAGGGGCGGAGCGGACACTGTCCAGGGCCCCACGAGAAGGCTGGGCAGAAGCTCTAAGCAGGATGCTTGAACCCTGTAAGCTGGCACCACTGCTCCTCTCCCACAAAGGGTCACGAGGGCCATATGCTCTAAGCTTCCTTCCACATTCACAGGCACCACACCACCCATGGGCCACCATTCTCTCCTCCTCCTCCTCCTTCTGCCTCTGGCTCTCAGAAGCACCCTCCCTACTGATCCACCTTAAAACAAAATTCTGGGACCCCAGGATGGACTGTCCCATGGGGGGGTGGGGAGCAGCGCACTGAAGCAGGCTACCTGAGCGGGCTGCACAGCACCCACCACTGCTGTTTGGGGTTTTCTATGGCAGCTGGGCATACAGTCCTGCTGCTCCACTTTTTCTTCCTGTTGCATTAGTACAGGCCCAACTGGGCACCCAGTGCCCTGGGCTTTGCGTTTTGGTAAGGCCCCCGATTGCCTTCCTTGGACCCTGGCTGACCCTCTACTCTGAGCTTCCTGCTCTCCCCTTTTCGCCTATCCTTGGCGACATCGCCAGGACTCGGGGTTCATCCTGATCACGGTGCATTGCTCTGTAAGATCTCAAGGGTTACGTCTAATCATAACCTGGGGTCTGATCCATCAGCCACCCCGCATCTCTACCTTTTGAGAATAGCCAGAACTCCTTAGCCCCTCAAGCTGCCTGTCTCAGCCTCTTTGTCTTGATGCAAGCAGCACCCTCTTTGTTGGCCTTTGTTTCGGCCTTGCAAACTCTGTCCACAGGGCAGCCAGGGCAATGCATCCCCAGGAAGAAGCCGGCATCCTCCCGGGCCCAGGAGCTTGCTCGGCCTGAACCAAGCCTCGCTGACTGCTTCGTCTCCCAGTCACAAGACCTCCACCCAGAACCTCAGATACTAGCTTGGATCCTTCACTCTCTGCTCAAGGGGCTTCTCCGTTTGTCTACAGAAAAAGCTCTGCCTCTCCGCTAGAAGGCTGAGATGACCCCCGCCACACACACAGACTGTACACAGAACGGCTGGCTTTGAAGTGGTGACCCTCGAGCTTCATGTTCTAAGATAGCGAGAACGTCACAAAGCCAGAGAGAGCCACTTGAGGGTATCTCATTCCATGGTGTCACCAACATGGGCCTCAGAAGAATGCACTGACGACACCAGGAGTGAAGGAATAGTATGAGCAGCTCTGCAAAGCCACAGGCGTGCGTGGAGAGCCTCTTTCACCAGAATAAGACCTTCTAGTCATACGAGCCATCGCCCCCAGCAGACAGAGGGCCATGGGCCTGGCCACAAGCACTCTGGCCCAGGGGACCAGAAATTCTTGCTGGCAGCCTCCCTCCACCCACCCACTTCCCCCAGTACAGGGCATACTCACCATCTGGAGTGGTGTCATTGTCCCAGTCCCAGGCCTCCACGATGAGGGTGAAAGAACGCTGCAGACACAGGAGGAGAGCTGGTCAGGTGCCTGGGGCTCCCTCCCACCTGCTGCTATTCAGGATGGGGGCAGGGTGCATGGCCCTGGCCTGTGTGTCTCTGGGATGCTCAGGCCTTATAGAGAACTCTGCTCCACGGCTTTGTGGTACCCTCCCTTCCCCATCCGTGTCCCCAACACTGGCCCATCTCCTCTACAGACCCCATATATCCCAACTCGGAAATGGAGGATAATTATCCCTGGCTGCACCTCTCAGGAAGTTTTGGCTCCTTGCTCTTGGGGTCCCCAAGGCCCAGTTCAGCTCCACCCTGTGCAAGCTCCTGAAGTCAGCAAAGGGTGAAGGGAGGGGTTCAGGCATCTGTGGGCAGAGCACTTCCGTTGGGAATACATCCCTGCACCTCAGAGGGCTGAGCTGAAGTTGAAGATTATGTGGCACTATATATATACTTGAAGCCCACTTGACAGGGCTGCGTCCTGGCTACTCAGCAGTCATTCTACCAGTCACACAGAAGTGCTTACCATCAAAGAGCATACAGTCAGCCTCCTAACTATCCCCCAGGACAAGGCTGATGGAGGTCTCTTGCTGTACAGGTGGGGGACACTGAGGCCCAAGAGCTGCTGTGCTAGGCACAGCCTCAGTCTGTAATCATGGCCAGCCCTCACCATCTGTCCCTCCTGCCCCAGGCCATGGCGATGAGTGCTGCTGTGAGCTGTTACCTTGGCAACATAAGGCCTGCCCCTATAATAGGGCAGCCTGAGCTCACCGTGACCTCAGGCACCCCTTCCTCTGCAGCTCGACTATGCTGAGGAAACCTCATGTTTTCCTGGATGGCTGAGAGCACCAGCCATTCCTCAGCCCTCAGAGCCCTCCCTCCAGACTCACTGGAGCCCCATCTAACCTGGGCTTTCTAGAACTTATCCCACTGCCATACCCAGCCTCACGGGACCTCGTGTTAGGAGACCCTGTCCTTTTCCTATCTGTTGGCAGCTCAGCATGAACACTCTCACTCCCTACTCTGGTACCTCCTCTGAGCACCTGTCGTCACACATAGGGCCCATGCCATGTGAGCCAGGCCAAAAGCAGAGGGCCACTGGTCCCCTGGCTCCATGAAGCCACTACCAGGTTTCCTTTTTTCTTTTCTTCTTCTTTTTTTAAAAACATATTTATGTATATAAGTACTCTCTCTTCAAACATACCAGAAGGGGGACTCAGATCCCATTACAGATGGCTGTGAGCTACCAAGTAGGTGCTGGGAATTGAACTCAGGACCTCTGGAAGAGCAGTCAGTGCTCTTAACCGCTAAGCCATCTCTCCAGCCCACCTTTATTGCCATCTAAATCCCCCTTTAGATCCTCTTCCTCGTTCGCTCCCCTGCTCCCCCTTCCCACCCTGACTGCTCCTCTCCCTGGTCTCTCGGCAAGCATAGGGCTTAGAGGCCTAAGAAATCCCCACTGTGCTACCCTCATGTGCCTGGGTGCAGAGCCTATCTGGGGGCCCTCTCCATACCACCCTAACCACCTGCAAAGCACTCCTCAGAGCCTCCATTTGTCCAAGGCTAGCTCCCTGGTGACAGGCAGGGTCCCCAGTCCCTTCCCAGGCAGTCCCTTCCCTGCCCCTTCAGTTCTTTACCCGCCCACTCATTATAGTGCAGAACAGAGTTCAGACTGCCTACAGCCCCTGCATCAACAGATGGAGCCAGAGAAAGTGAGGGACAGGCCCAGGTCACATAGCCCCAGGAGAAATAGGCTTTAGCCCAAGGGAGGAAGCACTATGAGGAGGAGGAGGAAGAAGTGGAAGAAGAGGAGGAAGAAGAGGGGAAGAGGAAAAAGAGGAGGAGGAGGAGGAGGAAAAAGAAGCAGGGGAGGAGGAAGAGGAGGAGGAGGAGGAGTCAGAAAGAAGACCAAACAGGGCTAAGAGATCGAGGAATGCAGAACAGAGGGGACCATAGCACAGGGCACCAGAGGACCCCCCACCCCACGGTGGAATCATCACTGGTTCCCATCAAAACAAGTGACCAGTAAGATCTGAGGCTATCAGGTTTTATACTCGCTCAGCTGCTACATAGGAACAAGGAGCTGACGGGCTGTGAGAGGACAAGGCTAGGCTGGGCTTAAGATCTCTGCCACCATCACTACAGGCCAAGCCCACCAGCAAGGTTCGGAGGCAGTAGCCACAGGGCAGGCGGTAAGATTCCCTGCACACACCTGCGCTTCGGATGATCCAGGAACACTCCCAGGAAACCCACCCCAGGCGCACAGGTAGGGTTACCACCACCTCAGCCTGAGCCCTGGGCTCCGGTTACCTGCTCCCGCAGGGACGTGGCCCGCCCGCTCGCCCGAGAGGGCCTGTCGCCCGCCAGCTGGGCTCCCTACACCTGGATGGCAGGAAGTCATCCAGGGAGAACCTGAGCCAGCAGGCAGGCGGCACCTGTGGCTTCTCCCCACCTGCCACAGTGGCCCCCCAGCTCCTCCCTTCCCCCAGCTTCCAGTACCATATCCCTCACTACAAATAGCTCTGTGCACCCCTTCCTGGGAAGCCAAATCCTACTGGTTGACAGAGGGACAAAGGCGACTGGGCTGGAAGCCTGTAGGATCTTGGGGCTTTTAGAGTGGATGGGGGCTGGGAAAGCTGGAGGACCATGGGTGAGACAGAGAGCTACCACCTGCCCAGGTTTCCCAGAAGCAAGAGAGAAAATCCTGGTCCCTCCTCCTAGGGCAGTCCTCCTGGGCCACCTGCCTGTCAGACTCTGGAGTTCTATATCCTACAGCCTCGGCCCAAAGCCTGGCCCCAGACACACCCCCAGCCAAGTCCATCACCGTCTGGTCAAACTCCAAGTCTAACTGTAATTCCCCCCCCCAATCTAGCCCTTAGACAGAGCTAAAAGGACAGCAGAGGACCATGGGAAAGGCAGACCAAGGGACAGGTGTGCCCCCTGGCCCCATAGCCAGGGTTACTCACAGCCTAGCCTCAGGTACAAGGCTTGTTCTACTCTCTAGCTGCCTTTCTTGGCCCCTGACAGAGCTCAGCACTTGCTGCCAATGTCCGGAGCCCTAAGCACAGACATATTTCCTGAAACCAGAGCTTTGGAGAGGCCTAGGCCTCTGTCGCCATTGTCACCCAAGGGATAACCCTCTTAAGACTCCAGGTCTCTGGGTCACAGGAAGAGACAGTAGGTTAGCCCATGCTAGGGTTGGACAGGTGCACCCCACATCAGAGACCAGCTGAGGCCTAGCCTAGGTGCGCCGCTCACCCACTGCTGGGAAACCCAGGCTCCCACCGTGAAGAGGGGAGCAGCAGCCTGTGTGGCCCCTAGCATGCCTCATCGTCTACTGCAGCTAGCCCAGGATCAGAATGGGTATGCGACATCTAGTTCAGGATGGGTGGATGGGCAGATGGATCAGAGCCTTTGCCTGGCTCCCCAGCAACTCTCAGTGGACCAGCCCATTTCCTATTCTGTCCAGACACCATGATAGTACCTTTCCTGCCAACCCACAGGTACAGCACCCACCCCTCGCCCATCTCACTACAGCTCGGTTTCCCATTCACTCCTGTGGGCCCAGGGACAAGGGCCAGATCCACTTCCACGTCTGAATCCTCCACTGGCCCAAGTTAGCACTTTCTGCCTCAGTCCCCGCCGCCCCCCCCCCCCGTGTTGCTGGCTACAGAGAGCCCTACCATAACACATACTATGTGGCCTGGATCAAGACACCCAACCTATGAGGGAGACGGTCGGGTACAGAATGAAATAGCACCTGCCCCTAGCTCCAGCCAAGGAGGACTCTTGGTCTTATGGGGATGCTGTGGGAGGCATGTGCCTCAGCGTGGGTTGTGATGAAGAGACTGGTGCTCATCCCAGTCCCAAAAGGCCCGGAGGGCAGCGGGGTCCTTTGATGTACATGCAGGGCACACATTTTAGAATAGCCCACTTGGGTCAGGCCCTCTCTGCCTGTGCTCCCGGATCTGTTCCAGCACCCTCTTACGCTGGAACAACCTTACAACAACCGTCAGTCCTCTGTCCTATGGGACAGTCCTCCCTGACCACCTTGCCTTACCTCCCTCCCTCAAGTACACACATGGCCATGTGCTGGACAGCCAGCAGGGGGAGAGGAAGAACTTAAGCAGGAGAAAGCTACATTGGGGAGTTCAGTAGGGGACATGCTGGGCACCCTACAGCCTCAGCTAGCTTCAGGAATCCTAGTGGAAAAGGCCTTGCATCCGTCTCAGGAGAGGGGAAGCAGGTTACAGGACTGCTAGCTCAGCTCTTCCAGCCTTAGAAACCAGGTCCGCCGCCTCAGACCTGCCTCTCTCTCTATCACTCATGACCCCAGAAGCACCACCAAGGAAAGAGACCGGAACAGGGCTGCACCCTGGGCTCAAAAGGCAAGCTGGTCAGACAGAGGGCCTGTAGTAGAGACCTCTTCTCTTTTGGCATCCTTTCCCAAGCACAGCCCCACTAGACAGGCCAGCGACCACCTTGTTCCTCATTTAGCCAACAGGGACCTCCTAAATACACCAGCCACCAGACCCCAAAGAAAAGCCTCCGCTTTCCTCAGAACTCTCCATCAACCACCTGCTCGGGCCACGGATCTCAAGCATGCGTGGTGAACGAGGCCTCCCCGCTGCTGGGTACAGACAGGCACCAGAGCCACTCCAGGGAAAACGTACATCTCCCGAGGACATCTGCAACATGCACAGCCTGGCGGGGGTTGCTGCGGCTTTCTGCATCGAAGAATCCACTCAAAGAGGCTCTGAGATGGATTCGAAGCCACAGCTACCTCGGTGCAGGCACAGGAGTTGTGAGAAGCCCGTGCCTGCTCTTGTCCACCTTCTAACACCGTCCCATCTTTCCACAGGGCCCTCCACCAACCCAAGGAACCCAAGTCCCAGCTGGTTCTTGCTGTCCCCAGGTACCAAATGCTCCAGTGGGCGCCTGGATTCCCAATGTACCCTGGCTCACGGGACAGAGATGAACTTGTGGCAGATCAAGCAGCATGGCCGCAGGGCTGTTGCCAAAGAGCGGAAATACCAAGGTACTGGCATCACAGCACCAGCTCCATGCCTGGCAGCCAGGACACGCAGCAAGATGGGAGACGGGAGAACCAGACCTGCCCCCAAACACAAGGTACCCTTCAACCTCCAAACTTCCATCCATGCTAGAAACTTCCCTACCCCTGAGGCATCTTGGGAAAGCATCTGGGAACAGAAAGCTAAAGTGTCCCCAAGACCAAGTACCAAGAGTCGAAGGAAGGCAAGGGCCTGTCCCATCCCGTTCCACACCAACCGGCTGGCCAGCGGGGCAAAGAGCCACAAGGGACACGCGTTGGCCCGCCACATTCCTCCAGGCCCTCCCTGCCCCCCACACCCACCGCTGCCAACTCGAGCAGAAAACACATCCTCAGGTAGCGATTTGGAGCCACGCTGGCTTGGGCCCAAGTGCAGATGACAGGCTGTCGGCCCTGCTCAGACCTGCCTGCTGTGCTGCTGTGGGGGCGAGGGGGGCAGGGCCAATAGTAACTGCCTAGGGCCTCTCCCATGCCTGCCCCTGCCTTTTTCCGTCTCAGGGATAAACTTCCTATCACAAGCCCCCAGGGTCAAGGCTACCTGGCTAGGCAAGGGTATCCCTCCCTACGTATGGAGCAGGAGCCTAGGGAAAGGTAAAGATGGAGGCACAAGCTGGGTGGCCTTGGAAGAAATAATTGTCCAGGGCTCAGAGCAAGAGCAGAGCAGGGCAAACCCTGCCCACCCATGCCTGACCCCCTAACCAAAAGTCTCTTTCAGGACCAAGGTACCAGGCAGACCCATTCCCATGGCTCTTGGTATCTGAACCAACCGCAAGCCCTCAGTCAGGAAAGCCCTTGGGCCATTGCTTGATACCCCCCCTCTACTCGCTAGTCTCAGGCCTCCAGACCCACCTTTACCAGCTGTTTTTAATCTCACACTCAAGACTATGTCCATATTCACATCTGCACCTAACTAGCTTCACACCTGCAGACAATCAGGTGCCGGTACAAGCCAGGTCCAGAAAGTGAATAAAAGCAAGCACCATAAGACTTCCTGATCCCAGGCCTTTATACCACAGGCATGCTACCTGTCTCCCCCAAAGCTGGATCCCCATGACCCTTCTTCCCAGCATGCCCAGACTCGGGTTCTTGCCTGACCTGACCACCCCTAAGCAGACAGGGTGCTTCCCAATTCCAGAAACTAAGAAGCACAATAAAACATCCGCAAACAGCAGTGCCACAGAGGGTTACAACTTGGAGCCTTGTTAGTGTCTCTTCCCTTTCGGAGGAGGGGTCTTCCCATCTCTAGCAGCTTCTGCCAACACACACAATCAGGCCATCCCCGCGCAGGTCCCAGGCGCCTGTCCGTGCCCCCGGGCATCCAGGAAACTGCAGGGCAGGAGCAGGCTGGCCGCGGGCCCGGACGGCTCCGCCAGGGCCTGCCCCGGACCAGCCCCAGCACGCGCAGCGCACATGCCTGCACAGCCTACCGGGCCGCAGGCGCCTCGCACCTCCCCACGCACTGACACGCGCAGGGCGACGTAGGCACACTCCGAGGGCCGCCGTGCACGCGGACCTTGGCCTCCCAGCCCCGCCGCGACCCCAAGCCTGTCGGCCCTTGGGAACCCCGCGCGCCCACGTGGCCAGGCGCGAACCTGGCCGCAAGAGCACGCGCCCCAGGCCCGCCCGCGGCGCGGCGCCCCCTGCCGGCCCCGCCCCGTCTGGGCGCGCGCGGCCCGCACCCGCGCGGCCGCAGGTGCTGAAGGGACCGCGGCGGGCGCCGAGCGCGCAGGGAAGCAGAGTGCGGGGGAGGGGCGCACGTACCGGCCAGGCGAACTGAAAGGGAATGACGACGAGGCCCGGGTCCTGGTGGCCGCCGGTCCGAGACCGCGCGCGCGCTCGGTCCCCCGCAGCGCCCGCCGGCGGCAGGTAGAAGGAGTTGCCACCCAGCACGGGCGTGGCGCCGTAGCCGTAGCTGCAGGGCCCCGTGGGCGTCACCTTGGCCTGGTACTCCTTAAGGCACACGCGCACGTACGTGTCGCACTCGTCGCGGCCGCAGCCCCCCGCGCGCGTCGTCCGGCCGTCGCCGTCACAGCAGGCGCCGCTCAGCAGCTCCCCGTTCACGTTCCGCAGCGCGCTCAGCTGCAGCTCGAAATAGCCCATGGGCCGCGTCGCCTAAAAATAAGGCAGCGCAGAGTGCAGGGAGGCGCGGGCCGGGGTCGCCGAGCCTCCGCCCCGCCCCCACCCTTGCGCCGTTCCTAGGGCTCCGGACCGCGGCCGTTTGTGCGCCGCCTGGCCCGGAGGAGCGGCCCGGCCCGGTGCGCCCCGTCCGCGCCCGTCGCCACCGCGCGCCCCGCTCACCTGCACGCACAGAACCAGTAGCAGCAGCAGCCGCCGAGGCAGGCGTCCCCAGCCGCGTGCCCGCATCGCCGCCTCGACCCCGCCCGCGGCCCCGCCGCCGCCGCCGCCGCCCGCGCCCGCTATAGCCGCCGCGCCGGCCTCCAACGCCCGCCCGCCCTCCGAGCCCGGCGGCGCACAGGCGGCGGCGGCCGCACAGGCGGCGCGGGCGGGGTCGAGCAGTGCGCGCGGGCTGCGCGGCGGGCGTGCAGGGGAGGCGGCGGCTCCGGCTTACTGCAGCCGCTCTCCGGCGGCCGGCCCGGCTCCCACCCGGCGGCGGCGGCGACGGCGGCGGCGGGTCCTGGCCTCGGCTCTGCGCGCCCGCGCTCCCGGCACCGCAGCCAACAAGTTCGGGACGAGACTGACAGCTCGCTCGCCCATTCGTCACCCGCGCACCTGCATATGCATGAGGGGGCGGGGCCTCGCGGTGGGGTGGGGCCGTGGGGGGTGTTGGGGGCACCCCGAGCTTTAAAGGAGGCGAGGGTGCGGTCTATGCGCGGGGCGGCGGGGCGCGGGGCCACCGAGCTGTGGCTTCTCCTGCGCCCAGGCTCACTGAGGTGGGGCCTTTTCTGCTCCAGAATTCTCGCCCGGGTTAACAGCCTGGGAGTGAGTGGGGCGCCCCCTGAGGTCACTGCCTTGGTCCCCTCCCATCAGAGCGCAGCCACTCTCGCGCTGCTCTTGGTCCCAAGGGAGATACTGCCTGCTGCACACATCAGGATTTTGCCCCCACGCAGAGCGGGTGGGGCACTGAGACTTGAGTGAGCCCAACTCCTGGTGCGCCCCCTTCCCCCAGGAATTTCCCCCCAACTCCGCAGCCTCCTGTTACTTTCACGCCGGCTACAGGGGGCGCTACTCCCCTCCGGCGCTCAGCCCTCCCTTCCTCCAAGCGCACAGGTTGAGTAGCCAGTCAACAAATGCTCCTTCCTGCAGGCTGTTCCCAATTCCAAACTGAGGTGGTGGCCATCGCTACATTCTCTTATCTTCAAGGAACGTGCCGGCCTGAGGTTCAAATTTAGGGGAAAAGAAACGGGCATAAAGGATAGTGGACCATGTCAAGAGAGCTACCGGAAGAGGACTTTCCAACAGTCTGGGAGTATTAAGTCACAGAGCCTGGGTGTCCCAACCCTCCATTACCATTTCTTGACCCTGTTCCTAGGTGATCATTTCCTCTTCCACACGTCAACACCAAGGGTTCTTTGTCTACAAGCTGCCTCTCTCCCACTCAGCAGGGCCCTTTGCAATTCCAGTGGTTAGCCTCCATGATTGGTGATGTGCTACTCTGCCCTTACAAAAGTCTCCCGAAGGCTCCTCACTCTAGTCTCCCTTTCTAGTCCAAGTCACTGCCAGCCAGGATTTCCGCAGAGAGGGAGAAGTTCTGATACCGGTGAATCAGAGCCACAGTAGAAGGAACTTGGGTCAGGGCAGTGCCAGGCAGCCTACACAGGGAGCCAGGCCATCGAAAAGCCTTGATCCAGTTTGCCTGCCCTACCACTGTGAATGGCCGTCCAGGATCTCCTGCAGAAGCAGTAGGCCTGAAAGGGTGAACCAGTATCCCCCATACTTGCAGCATACCTGGCTCTGTCTCAAACTGCTCCCACTCCAAGGAGTGGAGCACTCGCCCAGGGAGCCCACACGCAGGTAGGGTAGGTGATAGGGCAGACACAAGCCAGGCCTGGCTACACACAGAGCCTCCCCTCCTCCACACCAAATAAGGGAATTGGTGCATATTAAGAATCTTTCTGTTGTTTGCATCCTTTAAGTGACATCCCCTTAGCAAATTCAGCTTCCCTGTCCCTCTTGCTTGGAGACAGGAGATCACAGAGGACAGAGAGTCTGAGCTTCCAGCTCACCTAAGTTCACCACCACCTCTGAGGCACTCAGCCAATCTTTGAACTAGGCAGCCACAGCCCTGGCCTACCTGCAGGGGCCTCTGTCTAAAGATGGATGATGGCTTAGACATATACTGTAGACCAGCAAACCATGAGCATCCAAACCGGGGGTGGGGGGGCATGAGACCCCGATGGTAGGGCCAGCAAGGTGAGGAGAAGGAACAACATGCCAAAGTTCTGGGGCTGAGAGAACCTGACAAGAGCTTGTGAGGACAAGATAGCCCAACCAAAAGCAGGTGGCAATCCTGCAGTCAGTCTTCCTACTGAAATCAATGAGATGTCACAAAGACCAGGGCTGGGAAGTGCCACACCATGACTTAGGAGGTCAGGGTGATGTGGTGCTGTTGGGAGGCACAAGCATAGTCAGGACAATGACTAACGGTGCAGGGGCTGAGGAGAGGGAGTTTAGCATGAAGCTGCAGCCCCTCCCTGTGTACCTCTGTTTCCCTGCTGTCAGCCAGCTGTGGGGGGATGGGGTGGGGGGCAGGCCAGCAGGCAGAGCCAGGGTACGCTGACAAGGACTTCTGTGTGGCTGCCTGACTCAGCCTACCTGCCCTGCCTCCCAGCTCAGAGCTGTGGGTGCAGTGGCCCAGGGGGGGATTCTTCCTATCTGGCCGAGACACGGGGGTCACCTTATACACTGGCTCAAGGTGGACATGCCACCAGCATACCTTGGAAAGCGGGGAGATGTAGTCCGCCTCTCCTGTCTATCCAGGCACTTTGTGAGGGAGAACAGCTGGCAAGTATCACGACAGCAGAATATTCAATATCTGGGCTGCACCTGCTATGTCCAGGTGTCATCCCACAATGGTAATAGCCTCCTCCTCTTCTTCCTCCTCCTCCTCTTCTTCCTCCTCCTCTTCTTCCTCCTCCTCCTCCTCCCCTTCCTCTTCTTCTTCCTCTTCCTCCTTTTCTTCTCCCTCCTCCTTTTCCTCTTCTTCTCCCTCCTCTTCTTCCTCCTCCTCTTCCACCTCCTCCCCTTCCTCTTCTTCTTCCTCCTGTCCTCTGGGAGCCACAACCTTGCCTGATGGTGACCAGGAAACGCTCAAGATGTGAAGGTGGTTACTTGCATTGAGAGGTCCCCTCCCATGGGAATCCCCTCCCTGCACAGAGTTCTGCAGCCCTCGGGCAGAACTGCCATGGACACCCGTCAAACCTCGTGCTTTCCTTCATGCTGTACTTGGGGGCTCAGGATCCCTGACCTGACCCTGTGGGGTCAGATGTTCTGTCTTTTCAGGAAGGCCTGCATCACCCGCTGGGCACAGCACCCTTTGGTCTCCCGCATGGTAGCTCGCTCTAAGACCCCCAGCACTGGGGTCAGGACCTTTTCTGAATGGGTGCTTAGCTTGAGCTGGAGAGGCCCAGAGGGGCCTCAGGACCAGACTGAAGGATGAAGCAGCCCAGGATTTGGACAGAGCTGGCTGGACTCTGGAGTGAGCTATGCTTCCGCCCATGTCCTGTGATGCTAAATATAGCGTCCAGGGAGGGGAGTTTCCGGTTACAGCCCCCCCACCCCAAGCCGGGAAATCGATGCCAGCTCCATTAGGCCCAGGAGTGGTGCCTGCTGACCTGCCCGTCAGGCTGCAGATCTGAGTGAGGGACTGGACTCTGCCCAAACCCAGGTGCCCTGACTCCTAACCCATCCTTCAGGCCACCAGAGCCCTCCCCCACTAGAAGCCCCTCCGGCAGCAAACACCTAAGGGCAACCCTAGGAGGCACAGGACTCTGATGGTGGGCGTTCGGCAGTTGCAGAAAGTCAGGGAAGGACATAGATGGTACACTCCTGTCCCGGAAACATCAGGGTGAATCTGGGTCACTATGCCCCCTCCCACATATTTAGCTCCTGGACACACACTACACACCTAAGGACCCTTCACCAGAAGCTGTGTTGCTTGTCTGACTGGGCCCCACCTAAAGCTGCAAACATTTGCATACAGGTGGTGCTATGTGAGCAAGTCCACATGTCACAGCCTCCTCAGGGTGGTGCCTCAATGTCATACCCACCTGGGGCACAGGGAGGAGGTGAGGCGGGTGTCCCTCATCTTCCAGGGCGGGGAAGGGGACTATATGAGGAGAGAGAGCACTCATTCCAACCCAGCATGCCTATCTCAATGTCTACAATTAGGACTCCAACACTTCAGCTCTCATCCAAAGGTTTGCTGGAACACAGAGCCCCAGGGCATGCTCAGATAGCTCATCACCTGAGCTCCACTGTAATGAATGATGAGGGTGGGAAGGGATATACCCCTCCAGGCTACCTCACTGCCTGGGGATGTGGGGGAATGGTAATCAGTGAGTGGTCCATGACCCAAGGAAGTCATAGAAGATGCTGACTGGAGGGTTTGAAGCGGGGCCACTTTTCTGAAGCCTGACCTTACCCTGAGACAGACTGATCCCTCAGATGTTGCCCCAGCATGCCTTTCCTAAATATGTGCCTGTGGCTCTCGCAGCTGGCTAGGTGGGACAGAGTGCTCTTTAATCTATGCTAGGCACTCTAGGGACCTGTAGAATGGCTCTAAGCTACGCATGTAGGCCCACCCTCAGGCCAGAGAGCCTTAGGCCAGCAGCACTGTGAGCTGTCACGCTAAGGCAGTTCTGCGCAAGAACCAGGCTGCCCACGCCAAGACGGCTGCTCTGGATCCCCATGATGACCTAGCCTACAGACGTGGACTTACGTCCTGCAGGCCAAGTGAGGTCCTCTCCCAACTTCCGATGGCTCAGAAGTCATGGGAAGAGTACCGGAGACACCAGACACAGAACATCACCAGATCCAAGTTCCTGGACACTGGGAGTGCAGTCCTGGTCCAGCCCCAGACATGGCAAGGTCCCTGTTTCTGCCCAGATCAGGGAGTACATACTCTGGCATGGGCAGTACTGTGCCCATTTCCTCTCAGCTGAGGCCAGTCTATCTCTGCTCCTGCAGACACAGTTCATGTTACGCATGAGAATAATTAAGAACATTTTAATTAATGCTTTGTAGACATTATCTGTCTTATCAGACAGACACCATTAAGTCATAAACCTTTCTCTTCCATATGACTACCCCTTTCCACATTTGGTCTATGTATCTACCATCCTCCGTGAAACCAACAACCCGCCCACCTACATCCCTCTTTTCCATCCGGGCCCAAGAAACTTGGGGGTAGCTGATATGGAACTTGATCAGGGATCCAAGGCTAAACACCTAGCCTGGTTCCCTCATGAGCTGGCTACTCTGCCTGACAGTACTCCAGGCTTGCTGTGCTAGCCCGCTGACAGCCATCTGCCTCCCAGGTCATCCACTTGCCCCACCAGAGGAGGACCAGAGGGTTTCTATGGAGACCTTGCTACCCTCCAAGACACAGTGCCTCACCCCAGGTCACAGTGCTCAAAGCCAGCGGACATCAGTAAAACTTACACAAGCTTTATTGGGTGCGCAGGGCAGGAGGATGAGTGGATGGGATTAGGCCTGTCCAGCCCCAAGGTCTCACTGGAGACTCAAATGGGGAACCACCTGGCTAAAGAACCAAGAGATAGCGTAGATAACCCCGAGAGTCTTGGGGATGTCAGGGTTGTCTGCGAAGGCCTGGGCGTCATCTAAATTCAGATGGATCACTTCGATGAGTTCTCCCTCCTCGGCCAGCCCTCCACCAGGCCCGCCTCGCTGGGCATCTGTCACCTCCGCGTAGAACATGGTCTGCCTGGAGCTAGTCAGTCCTACTCCAGACCTGTCAGGTAGGACAGGGACTGCTGAGAGACCAGTGTGGCCCTGCCAGACACCCTGCTTCCATGCTTCCCGCTCTGCCTTTCTGATGATCAGAACTCTGTGTAGCTTCACCCTTCCCAAATACCACTCCCGGGGCAGGGGTGGGGAGGGTATGTCCACGGAACCTGCCCCCTGCAGCGGGCGAGCCTCATGCATGTTGGGTATGCCGGCTATCATATGGCAGAGGTAGGCATCAAGGGCACTAAAATGATTTTTTGAGATGAATTTGATAACCGTGCTGGAGAGGTGGCTCAGCCACCAGTGGCTAGGCTCATCATCAAACTGTCAAGATAAATATGACATCTGACACTTAGGGGAACACACAAATGCAGAGGCACCTTACATATATATATCTTCGACCTAGGACCTGTTTGGCTAGCTGACTGAATTCATCCCGAGAGAGATACATGGGTAGGCCTGGCCTAATCAGGTGAGCTCACAAGACAGCTTCATGCTCACAATCTAAAGAGCTCTGGCACTCTCTGCTAGCACAGAGACCAGACAAGCTGCTGTGTTGTAAAAAGACGTGTGGCAAGGACCTGCAGGCATTGCTAAGATCTGAAAGTGGCTATCAGCTAGTCAGGAAGTGGCCTCTATCCCATAGCCACAAGGACCTGCTACCTTTGCACCTGGATAGATTGTGGATGTGGCAGGTGTCTCTGAATGCAGCTTATGAGACCCTACATGGAAGATCAGGGACCTTGGACACAGACTGTGCATATACAGAAGCCATGAGGTCACAAGCAAGTGGTATTAGAATCTGTGATAGGCCCTACGGATCTGTTAGGCCCCTGCCCATGTCTCCTGAGT
G5 114164745 114164794 50 GTTCCTCATTTAGCCAACAGGGACCTCCTAAATACACCAGCCACCAGACC
U5 114159059 114159108 50 TGATCCACCTTAAAACAAAATTCTGGGACCCCAGGATGGACTGTCCCATG
U3 114158995 114159044 50 TGGGCCACCATTCTCTCCTCCTCCTCCTCCTTCTGCCTCTGGCTCTCAGA
D5 114158132 114158181 50 ATTCCAACTCTATAGCATCTGATTCCCTGCATGGTGGGCACCTGGCATGA
D3 114158072 114158121 50 CACATGCTCAGGACAGCACTGCCCTCTTCGTGGCCACAAGCTTTGTAAGG
G3 114154266 114154315 50 AGCAAATGAGAGGACGAAGTCAACGGGTACAGACTATGGCCAGTGAACGT
G5_U5 114159059 114164794 5736 TGATCCACCTTAAAACAAAATTCTGGGACCCCAGGATGGACTGTCCCATGGGGGGGTGGGGAGCAGCGCACTGAAGCAGGCTACCTGAGCGGGCTGCACAGCACCCACCACTGCTGTTTGGGGTTTTCTATGGCAGCTGGGCATACAGTCCTGCTGCTCCACTTTTTCTTCCTGTTGCATTAGTACAGGCCCAACTGGGCACCCAGTGCCCTGGGCTTTGCGTTTTGGTAAGGCCCCCGATTGCCTTCCTTGGACCCTGGCTGACCCTCTACTCTGAGCTTCCTGCTCTCCCCTTTTCGCCTATCCTTGGCGACATCGCCAGGACTCGGGGTTCATCCTGATCACGGTGCATTGCTCTGTAAGATCTCAAGGGTTACGTCTAATCATAACCTGGGGTCTGATCCATCAGCCACCCCGCATCTCTACCTTTTGAGAATAGCCAGAACTCCTTAGCCCCTCAAGCTGCCTGTCTCAGCCTCTTTGTCTTGATGCAAGCAGCACCCTCTTTGTTGGCCTTTGTTTCGGCCTTGCAAACTCTGTCCACAGGGCAGCCAGGGCAATGCATCCCCAGGAAGAAGCCGGCATCCTCCCGGGCCCAGGAGCTTGCTCGGCCTGAACCAAGCCTCGCTGACTGCTTCGTCTCCCAGTCACAAGACCTCCACCCAGAACCTCAGATACTAGCTTGGATCCTTCACTCTCTGCTCAAGGGGCTTCTCCGTTTGTCTACAGAAAAAGCTCTGCCTCTCCGCTAGAAGGCTGAGATGACCCCCGCCACACACACAGACTGTACACAGAACGGCTGGCTTTGAAGTGGTGACCCTCGAGCTTCATGTTCTAAGATAGCGAGAACGTCACAAAGCCAGAGAGAGCCACTTGAGGGTATCTCATTCCATGGTGTCACCAACATGGGCCTCAGAAGAATGCACTGACGACACCAGGAGTGAAGGAATAGTATGAGCAGCTCTGCAAAGCCACAGGCGTGCGTGGAGAGCCTCTTTCACCAGAATAAGACCTTCTAGTCATACGAGCCATCGCCCCCAGCAGACAGAGGGCCATGGGCCTGGCCACAAGCACTCTGGCCCAGGGGACCAGAAATTCTTGCTGGCAGCCTCCCTCCACCCACCCACTTCCCCCAGTACAGGGCATACTCACCATCTGGAGTGGTGTCATTGTCCCAGTCCCAGGCCTCCACGATGAGGGTGAAAGAACGCTGCAGACACAGGAGGAGAGCTGGTCAGGTGCCTGGGGCTCCCTCCCACCTGCTGCTATTCAGGATGGGGGCAGGGTGCATGGCCCTGGCCTGTGTGTCTCTGGGATGCTCAGGCCTTATAGAGAACTCTGCTCCACGGCTTTGTGGTACCCTCCCTTCCCCATCCGTGTCCCCAACACTGGCCCATCTCCTCTACAGACCCCATATATCCCAACTCGGAAATGGAGGATAATTATCCCTGGCTGCACCTCTCAGGAAGTTTTGGCTCCTTGCTCTTGGGGTCCCCAAGGCCCAGTTCAGCTCCACCCTGTGCAAGCTCCTGAAGTCAGCAAAGGGTGAAGGGAGGGGTTCAGGCATCTGTGGGCAGAGCACTTCCGTTGGGAATACATCCCTGCACCTCAGAGGGCTGAGCTGAAGTTGAAGATTATGTGGCACTATATATATACTTGAAGCCCACTTGACAGGGCTGCGTCCTGGCTACTCAGCAGTCATTCTACCAGTCACACAGAAGTGCTTACCATCAAAGAGCATACAGTCAGCCTCCTAACTATCCCCCAGGACAAGGCTGATGGAGGTCTCTTGCTGTACAGGTGGGGGACACTGAGGCCCAAGAGCTGCTGTGCTAGGCACAGCCTCAGTCTGTAATCATGGCCAGCCCTCACCATCTGTCCCTCCTGCCCCAGGCCATGGCGATGAGTGCTGCTGTGAGCTGTTACCTTGGCAACATAAGGCCTGCCCCTATAATAGGGCAGCCTGAGCTCACCGTGACCTCAGGCACCCCTTCCTCTGCAGCTCGACTATGCTGAGGAAACCTCATGTTTTCCTGGATGGCTGAGAGCACCAGCCATTCCTCAGCCCTCAGAGCCCTCCCTCCAGACTCACTGGAGCCCCATCTAACCTGGGCTTTCTAGAACTTATCCCACTGCCATACCCAGCCTCACGGGACCTCGTGTTAGGAGACCCTGTCCTTTTCCTATCTGTTGGCAGCTCAGCATGAACACTCTCACTCCCTACTCTGGTACCTCCTCTGAGCACCTGTCGTCACACATAGGGCCCATGCCATGTGAGCCAGGCCAAAAGCAGAGGGCCACTGGTCCCCTGGCTCCATGAAGCCACTACCAGGTTTCCTTTTTTCTTTTCTTCTTCTTTTTTTAAAAACATATTTATGTATATAAGTACTCTCTCTTCAAACATACCAGAAGGGGGACTCAGATCCCATTACAGATGGCTGTGAGCTACCAAGTAGGTGCTGGGAATTGAACTCAGGACCTCTGGAAGAGCAGTCAGTGCTCTTAACCGCTAAGCCATCTCTCCAGCCCACCTTTATTGCCATCTAAATCCCCCTTTAGATCCTCTTCCTCGTTCGCTCCCCTGCTCCCCCTTCCCACCCTGACTGCTCCTCTCCCTGGTCTCTCGGCAAGCATAGGGCTTAGAGGCCTAAGAAATCCCCACTGTGCTACCCTCATGTGCCTGGGTGCAGAGCCTATCTGGGGGCCCTCTCCATACCACCCTAACCACCTGCAAAGCACTCCTCAGAGCCTCCATTTGTCCAAGGCTAGCTCCCTGGTGACAGGCAGGGTCCCCAGTCCCTTCCCAGGCAGTCCCTTCCCTGCCCCTTCAGTTCTTTACCCGCCCACTCATTATAGTGCAGAACAGAGTTCAGACTGCCTACAGCCCCTGCATCAACAGATGGAGCCAGAGAAAGTGAGGGACAGGCCCAGGTCACATAGCCCCAGGAGAAATAGGCTTTAGCCCAAGGGAGGAAGCACTATGAGGAGGAGGAGGAAGAAGTGGAAGAAGAGGAGGAAGAAGAGGGGAAGAGGAAAAAGAGGAGGAGGAGGAGGAGGAAAAAGAAGCAGGGGAGGAGGAAGAGGAGGAGGAGGAGGAGTCAGAAAGAAGACCAAACAGGGCTAAGAGATCGAGGAATGCAGAACAGAGGGGACCATAGCACAGGGCACCAGAGGACCCCCCACCCCACGGTGGAATCATCACTGGTTCCCATCAAAACAAGTGACCAGTAAGATCTGAGGCTATCAGGTTTTATACTCGCTCAGCTGCTACATAGGAACAAGGAGCTGACGGGCTGTGAGAGGACAAGGCTAGGCTGGGCTTAAGATCTCTGCCACCATCACTACAGGCCAAGCCCACCAGCAAGGTTCGGAGGCAGTAGCCACAGGGCAGGCGGTAAGATTCCCTGCACACACCTGCGCTTCGGATGATCCAGGAACACTCCCAGGAAACCCACCCCAGGCGCACAGGTAGGGTTACCACCACCTCAGCCTGAGCCCTGGGCTCCGGTTACCTGCTCCCGCAGGGACGTGGCCCGCCCGCTCGCCCGAGAGGGCCTGTCGCCCGCCAGCTGGGCTCCCTACACCTGGATGGCAGGAAGTCATCCAGGGAGAACCTGAGCCAGCAGGCAGGCGGCACCTGTGGCTTCTCCCCACCTGCCACAGTGGCCCCCCAGCTCCTCCCTTCCCCCAGCTTCCAGTACCATATCCCTCACTACAAATAGCTCTGTGCACCCCTTCCTGGGAAGCCAAATCCTACTGGTTGACAGAGGGACAAAGGCGACTGGGCTGGAAGCCTGTAGGATCTTGGGGCTTTTAGAGTGGATGGGGGCTGGGAAAGCTGGAGGACCATGGGTGAGACAGAGAGCTACCACCTGCCCAGGTTTCCCAGAAGCAAGAGAGAAAATCCTGGTCCCTCCTCCTAGGGCAGTCCTCCTGGGCCACCTGCCTGTCAGACTCTGGAGTTCTATATCCTACAGCCTCGGCCCAAAGCCTGGCCCCAGACACACCCCCAGCCAAGTCCATCACCGTCTGGTCAAACTCCAAGTCTAACTGTAATTCCCCCCCCCAATCTAGCCCTTAGACAGAGCTAAAAGGACAGCAGAGGACCATGGGAAAGGCAGACCAAGGGACAGGTGTGCCCCCTGGCCCCATAGCCAGGGTTACTCACAGCCTAGCCTCAGGTACAAGGCTTGTTCTACTCTCTAGCTGCCTTTCTTGGCCCCTGACAGAGCTCAGCACTTGCTGCCAATGTCCGGAGCCCTAAGCACAGACATATTTCCTGAAACCAGAGCTTTGGAGAGGCCTAGGCCTCTGTCGCCATTGTCACCCAAGGGATAACCCTCTTAAGACTCCAGGTCTCTGGGTCACAGGAAGAGACAGTAGGTTAGCCCATGCTAGGGTTGGACAGGTGCACCCCACATCAGAGACCAGCTGAGGCCTAGCCTAGGTGCGCCGCTCACCCACTGCTGGGAAACCCAGGCTCCCACCGTGAAGAGGGGAGCAGCAGCCTGTGTGGCCCCTAGCATGCCTCATCGTCTACTGCAGCTAGCCCAGGATCAGAATGGGTATGCGACATCTAGTTCAGGATGGGTGGATGGGCAGATGGATCAGAGCCTTTGCCTGGCTCCCCAGCAACTCTCAGTGGACCAGCCCATTTCCTATTCTGTCCAGACACCATGATAGTACCTTTCCTGCCAACCCACAGGTACAGCACCCACCCCTCGCCCATCTCACTACAGCTCGGTTTCCCATTCACTCCTGTGGGCCCAGGGACAAGGGCCAGATCCACTTCCACGTCTGAATCCTCCACTGGCCCAAGTTAGCACTTTCTGCCTCAGTCCCCGCCGCCCCCCCCCCCCGTGTTGCTGGCTACAGAGAGCCCTACCATAACACATACTATGTGGCCTGGATCAAGACACCCAACCTATGAGGGAGACGGTCGGGTACAGAATGAAATAGCACCTGCCCCTAGCTCCAGCCAAGGAGGACTCTTGGTCTTATGGGGATGCTGTGGGAGGCATGTGCCTCAGCGTGGGTTGTGATGAAGAGACTGGTGCTCATCCCAGTCCCAAAAGGCCCGGAGGGCAGCGGGGTCCTTTGATGTACATGCAGGGCACACATTTTAGAATAGCCCACTTGGGTCAGGCCCTCTCTGCCTGTGCTCCCGGATCTGTTCCAGCACCCTCTTACGCTGGAACAACCTTACAACAACCGTCAGTCCTCTGTCCTATGGGACAGTCCTCCCTGACCACCTTGCCTTACCTCCCTCCCTCAAGTACACACATGGCCATGTGCTGGACAGCCAGCAGGGGGAGAGGAAGAACTTAAGCAGGAGAAAGCTACATTGGGGAGTTCAGTAGGGGACATGCTGGGCACCCTACAGCCTCAGCTAGCTTCAGGAATCCTAGTGGAAAAGGCCTTGCATCCGTCTCAGGAGAGGGGAAGCAGGTTACAGGACTGCTAGCTCAGCTCTTCCAGCCTTAGAAACCAGGTCCGCCGCCTCAGACCTGCCTCTCTCTCTATCACTCATGACCCCAGAAGCACCACCAAGGAAAGAGACCGGAACAGGGCTGCACCCTGGGCTCAAAAGGCAAGCTGGTCAGACAGAGGGCCTGTAGTAGAGACCTCTTCTCTTTTGGCATCCTTTCCCAAGCACAGCCCCACTAGACAGGCCAGCGACCACCTTGTTCCTCATTTAGCCAACAGGGACCTCCTAAATACACCAGCCACCAGACC
U3_D5 114158132 114159044 913 ATTCCAACTCTATAGCATCTGATTCCCTGCATGGTGGGCACCTGGCATGAAGCACCTACTTCGTGGCCTACTAAAGCCCGCAGGGTGCCCCAGCTGCTGCAGGCTCTACAGCAGCTCGGGTGAGGAAGGGAAGGGCAGGCATGGTGCTCACCTGCACTCCCCAGGCACAGTGCATCCCCCGTGGAGCAAATTACATCCTTGTTTACACACGGCTGGAACAGAGGGGCAGAGAGAGGCACAGCTGCAGCCAGCCATGCTAGCCCTGCCCGGTGCCCGTGCCCAGCCCCACACTGGGAGACAGACCCCTCACCTTCTTTGCATTCTTTGCCCATCCAGCCATCCATGCAGGCCTTGTTGCCGTACTGGTCGCAGGTATAGTGGCCAAAGAAGTCGTTGCGGGGCCGGCAGAACTTGTTGCAGGTGGCACTGTAGTAGTTCTCATCACAGCGTACTCGGATCTGCAGCTCCAGGTGTGCCACGTGGCCGCTGAAGTGCAGGCTCTTCCAGCGGTCCTCGGGGTTGATCATGCCAGCGTGCGACACCCGCTCAATCAGCAGCTCCTCTTTGGGAGCAGCCGAGTTAGCTGGCGGCAGCAGCTACCCGTCAGTCCCCCAGGGGTGCCACGCGGGCCCTACCAGGCAGCTTCAGGGGCAACAGGGCAGCCAGGCAGAGGAAGGCTGCCAGCCCTGCAGGAGCCAGGGGCGGAGCGGACACTGTCCAGGGCCCCACGAGAAGGCTGGGCAGAAGCTCTAAGCAGGATGCTTGAACCCTGTAAGCTGGCACCACTGCTCCTCTCCCACAAAGGGTCACGAGGGCCATATGCTCTAAGCTTCCTTCCACATTCACAGGCACCACACCACCCATGGGCCACCATTCTCTCCTCCTCCTCCTCCTTCTGCCTCTGGCTCTCAGA
D3_G3 114154266 114158121 3856 AGCAAATGAGAGGACGAAGTCAACGGGTACAGACTATGGCCAGTGAACGTGGGATCGTGTCTAGTTAGTGTAGACCCATGGACAGAGGACATGGGGTGTGGTCAGTGAGTAGGGACACAGTACACGGGGTCTCAGTCTGCAGCAGGGAGTCACAGTCCCATGTAAAGCAGCAGGAACCGATTGTTTGGCTGCAGTGTCTGCTGTGCAGCGGATTCAACCACTCTGTCCACACCCCGAAGTGCTACCCACTCCTACCTTGTGAAGCCCCCAGACACTCACCGAGCGCACAGGTGGGTCCGTTCCATCCTGACGGACAGTGGCATTCAAAGCCAGATGGCACTTCGTGGCAAGAGCCCCCATTGGCACACGGGTTGGAGGCACAGGCGTGCTCAGCTGCAGAACCAGAACATGAGTGGAGCGATGCCCACTGAACTTGAGCACGCTTCCCCGAGCCCACCAGACCCAGAGTTCACAGGGGTACAGCCCACTGTACAAGGCAGTGAAGAAAGGCCTCAGCCAGGCTCCCCGAGAGACAGCATTCCAACCTACCCCGCTCGCAGTTCTTGCCCAAGTAGCCATCTGGGCAGGCGCAGAGGTATTGGTCAGGCTCAGCATTGATGCAGGTACCCCCGTTGACACAGGGGTGGTGGCTGCCACAGTAGTTCAGGTCTGGGCACAAGGGTAGGGCTCTCAGGGATGGGCCCAGTGTCAGAGCTTAAGGCCTGGCCCTGCCCACTGCCCACCATCTCTCTACCTTTGTCACAGAGCAGGCCACCCCAGTTGGTCTCACAGTCACAGTGCCAGGGCTCCACACAGCTGCCATGCACGCAGCCAGGGTAGGGGACACACTCGTCACAGAACTTGCCCTGCCAGCCGTAGCTGCACCTGGGGGACCGAGCGACGAGGCCATCAGCCGGGCAGATGAGGAAGGGGCATGGGAGGCAGGCACAGAAGTGCAGGCTACCCCTACTGGGTGGTGGTCCCAGAGAACAGCTCTGAACCAAGCAGGGGTTACGGCCTGCCGGCCAGTCTCGCTGTCACAGGCATTCCCGGCCACTGGCCGAGATGGTCAGCCCAGCTGTCCCGTCACTCCCCCTGAGCTATTCTAGGACTCAGCTCTGAGCCAGGCGCCTGGAAGGAAGGCCCAGCCGGGGGAGGCCCAGGGGTACAGTGCCAGGTGCTGCTCACCAGGTGCTGCTGGGACACAGCAGCAACTGGGATCTGAGAGGGATGAAGAGGCATCAGGAGAGATCCTAGCTACCCTGGTCCAAGGGCTCTGTGACCTTGGGTGCCGCCCATATCCTCACTGCTACTCAAGGGCAGAGGTTTCTCTGACTCCTAGGACAGTCCAACCCAGTGGCTGCCCAGCCAGCCCTATGGGAGCGCCACACTGAGTGGGGCTGAACCCAACACATAGACCCGAAGACCTCGTCAGAGGCCGTAATCTTACGACCTGGCTCTGACCACACTGGGGACTAGTGTAGCCTCTGGGGAGTCCCTCAGGATGTAAGTAGGTGGCCAGCACAGAACCAGCAGGTGCGAGAGTACAGGGCTCCAGTAGGGCTGCCCTCTGGGCCCTGGACAAGACTCTGGGGGCCCCTTCCTTAAAGGCTAAGGTCCTGTGGGGCAGGAATGACGTGCAGGCCACGTCACTTCCACGCTGACACCCGCCACAGGAGTTATTTTTATAGAAGGAAAAACCACAGCCCTTCCTGAGCTGCCCTGGAGCCACGCACACAGGCACTTATCAGCCCGGCTCACCCAGGCTCACATAGGGAAACTGAGGCTGGCTCCAGGGTCCAGCCCGGAACGTCCAAGGCAGGTCCACAGTAGGCCTCCCCTGTCTCTACTTGGGAGTCTTCTCTCCAGGTGATACGGGGAGTCGAGGGGCAGAGAGGGCTGGGACTAGCCTTGGGTCATTCACCAGGGAACACCAAGGCTAGCTTTGAGCCCAGACCCCGTGAGCCCCAAGGGCAGGTTCTCCACCCTGGGCGGGCCATCCCACACCAGACCCCACCTTGTGGCTTTCCTGCCAGCCGTTCCAGGGCCTGGGGAGGGTGGCAGGAAAGCACGGCCATCTCCGCAGTAGCATCCGGCTGGGGAGGGGTGTCCTCTGCTGAAACCTGAGCTCTGGACAGCAGGAGGCCACTTGGCCTCACCCTCTGGCCCAGGGAGAGGGTGGCACTCACCTACCACCCCCTACCCTTGCTTTCCTCCCCAGGGCTCCTGCCTGTGTGCTACCCACAGCCTTTCTGCACGGAGGGACGGAGGGACGTTGCCTCATCTTTCATCTCCCTCCAGCACTGACCACTTTGGGATGCTGCTGGTATAGCCGCCAAGATACCGTAATATACCTTGGGCTACAGAGTGAGTGTGGGGTTAAGAGTAGGCTCCTGTGTTTACCACCAGTGGGGCACATCTGCCCAGAACCCACGCCCAACTCCAGCACACTGCTCAGAGCCGGGCTGTGAAAGACTGCACTGGGGCAGAGGGCTGTGTGGATGGACGATTTCTGCTGCCTGTCCCACCCCCCATCTCCCTCCTTGGATGTGGCTCCTGGAGTAAGAAGCCAGCCCATCCTGAGACAGGTGCTCCTTGCACTGCCTTGAGTCCTGCCAAGACTGTCTGAAACCACACTGTGTGCAAGTGGCACCTGGGATGTCTCCACTGCACACCCATCTCTTTCTGCCCAGGGACCAGCCTAGCTGCTGAACACATCACTAATGCCACTATACAACCCCTCCCCCAGCCCATCTCAACTCCCCAACTCCCTGGCCAGCCTCTCCCGACCAAACAGTACACGTCCCCATCGTCCTCATCCGAAAACACACGAGGTATACCCACTGCTCAGAGGGCACCCAGGGACAGTGAGAACCAGGATGGCAGGAGGGCCTTGGCAGGCCTACTGCTGTGGCTCCCCTGAGTCTAAGATGCTCATCTCTAACTCTTTTCCTACACCCTCCAACCCCCTGGGCCCCCACGTTCCCAACTCACACATCCCAGGGTGCCGACCTTTGCCTCTCTCTATCCTCTACCCCTAACTTAGCCTCATCACCTCCATCACCTTCATGAGCCCCAATGGCTTCTACTCTGCTCTGGGCTGCAGGATCCCCTCTCTGTCCTCCTCACCTGTCTGTCTACATGCCTCCAAGTGCTGCAGGCCAAGCCATTCCCAGCCCCTCCTCTCCACCTGACTCTGTGCTGCCTTAAGGCCAGGCCTGTCCAATGCGCCCTGCTTGGCACACACTAGCCCGCCTCTCTGACAATCATCCCTACCTCAGCCACCACAAATCCATGGTTTAGTGGCTCAAGCTAGCAGGTTTACAGCTCCTGCTTGACTGCACCCCCCTCCTCCTAAACCAAACTCATCATCAAATTCCTATTCCTCAGAACGTCTGCAGGTCCATCCCACCCCTCCACCCCACTGGCCCATTGCTCTCTTCTTCCTCACTGCCACGCTGTGTGGTTCTCCTCAGCCTCTCTTGATAGGGCTCCTCTTCCCCCTAAGCCTCTCTCTGCAGAATCATGTCAGTTTCTCCCACTAGCACGCCACGGTGACTTCCTACTGTGTTCACCTGGGCACCAGATTCCTCACATTTATGTAGTGCTCATATGTATGCATACCACACACACACACACACACACACACACACACACACACACACACGCTTGCATGCACACACACTTGCACAAGCATGCACGCACACACATACCCCTTAGCCTTTGCTTCTTGGTGATGTGACTACCTGGCCACCTTCCCTTGTCCCCTTCTAGCTGTCCCATGGAGAAAATGTCACTGGACATGCCACATGCTCAGGACAGCACTGCCCTCTTCGTGGCCACAAGCTTTGTAAGG
U5_15 114159059 114174109 15051 TGATCCACCTTAAAACAAAATTCTGGGACCCCAGGATGGACTGTCCCATGGGGGGGTGGGGAGCAGCGCACTGAAGCAGGCTACCTGAGCGGGCTGCACAGCACCCACCACTGCTGTTTGGGGTTTTCTATGGCAGCTGGGCATACAGTCCTGCTGCTCCACTTTTTCTTCCTGTTGCATTAGTACAGGCCCAACTGGGCACCCAGTGCCCTGGGCTTTGCGTTTTGGTAAGGCCCCCGATTGCCTTCCTTGGACCCTGGCTGACCCTCTACTCTGAGCTTCCTGCTCTCCCCTTTTCGCCTATCCTTGGCGACATCGCCAGGACTCGGGGTTCATCCTGATCACGGTGCATTGCTCTGTAAGATCTCAAGGGTTACGTCTAATCATAACCTGGGGTCTGATCCATCAGCCACCCCGCATCTCTACCTTTTGAGAATAGCCAGAACTCCTTAGCCCCTCAAGCTGCCTGTCTCAGCCTCTTTGTCTTGATGCAAGCAGCACCCTCTTTGTTGGCCTTTGTTTCGGCCTTGCAAACTCTGTCCACAGGGCAGCCAGGGCAATGCATCCCCAGGAAGAAGCCGGCATCCTCCCGGGCCCAGGAGCTTGCTCGGCCTGAACCAAGCCTCGCTGACTGCTTCGTCTCCCAGTCACAAGACCTCCACCCAGAACCTCAGATACTAGCTTGGATCCTTCACTCTCTGCTCAAGGGGCTTCTCCGTTTGTCTACAGAAAAAGCTCTGCCTCTCCGCTAGAAGGCTGAGATGACCCCCGCCACACACACAGACTGTACACAGAACGGCTGGCTTTGAAGTGGTGACCCTCGAGCTTCATGTTCTAAGATAGCGAGAACGTCACAAAGCCAGAGAGAGCCACTTGAGGGTATCTCATTCCATGGTGTCACCAACATGGGCCTCAGAAGAATGCACTGACGACACCAGGAGTGAAGGAATAGTATGAGCAGCTCTGCAAAGCCACAGGCGTGCGTGGAGAGCCTCTTTCACCAGAATAAGACCTTCTAGTCATACGAGCCATCGCCCCCAGCAGACAGAGGGCCATGGGCCTGGCCACAAGCACTCTGGCCCAGGGGACCAGAAATTCTTGCTGGCAGCCTCCCTCCACCCACCCACTTCCCCCAGTACAGGGCATACTCACCATCTGGAGTGGTGTCATTGTCCCAGTCCCAGGCCTCCACGATGAGGGTGAAAGAACGCTGCAGACACAGGAGGAGAGCTGGTCAGGTGCCTGGGGCTCCCTCCCACCTGCTGCTATTCAGGATGGGGGCAGGGTGCATGGCCCTGGCCTGTGTGTCTCTGGGATGCTCAGGCCTTATAGAGAACTCTGCTCCACGGCTTTGTGGTACCCTCCCTTCCCCATCCGTGTCCCCAACACTGGCCCATCTCCTCTACAGACCCCATATATCCCAACTCGGAAATGGAGGATAATTATCCCTGGCTGCACCTCTCAGGAAGTTTTGGCTCCTTGCTCTTGGGGTCCCCAAGGCCCAGTTCAGCTCCACCCTGTGCAAGCTCCTGAAGTCAGCAAAGGGTGAAGGGAGGGGTTCAGGCATCTGTGGGCAGAGCACTTCCGTTGGGAATACATCCCTGCACCTCAGAGGGCTGAGCTGAAGTTGAAGATTATGTGGCACTATATATATACTTGAAGCCCACTTGACAGGGCTGCGTCCTGGCTACTCAGCAGTCATTCTACCAGTCACACAGAAGTGCTTACCATCAAAGAGCATACAGTCAGCCTCCTAACTATCCCCCAGGACAAGGCTGATGGAGGTCTCTTGCTGTACAGGTGGGGGACACTGAGGCCCAAGAGCTGCTGTGCTAGGCACAGCCTCAGTCTGTAATCATGGCCAGCCCTCACCATCTGTCCCTCCTGCCCCAGGCCATGGCGATGAGTGCTGCTGTGAGCTGTTACCTTGGCAACATAAGGCCTGCCCCTATAATAGGGCAGCCTGAGCTCACCGTGACCTCAGGCACCCCTTCCTCTGCAGCTCGACTATGCTGAGGAAACCTCATGTTTTCCTGGATGGCTGAGAGCACCAGCCATTCCTCAGCCCTCAGAGCCCTCCCTCCAGACTCACTGGAGCCCCATCTAACCTGGGCTTTCTAGAACTTATCCCACTGCCATACCCAGCCTCACGGGACCTCGTGTTAGGAGACCCTGTCCTTTTCCTATCTGTTGGCAGCTCAGCATGAACACTCTCACTCCCTACTCTGGTACCTCCTCTGAGCACCTGTCGTCACACATAGGGCCCATGCCATGTGAGCCAGGCCAAAAGCAGAGGGCCACTGGTCCCCTGGCTCCATGAAGCCACTACCAGGTTTCCTTTTTTCTTTTCTTCTTCTTTTTTTAAAAACATATTTATGTATATAAGTACTCTCTCTTCAAACATACCAGAAGGGGGACTCAGATCCCATTACAGATGGCTGTGAGCTACCAAGTAGGTGCTGGGAATTGAACTCAGGACCTCTGGAAGAGCAGTCAGTGCTCTTAACCGCTAAGCCATCTCTCCAGCCCACCTTTATTGCCATCTAAATCCCCCTTTAGATCCTCTTCCTCGTTCGCTCCCCTGCTCCCCCTTCCCACCCTGACTGCTCCTCTCCCTGGTCTCTCGGCAAGCATAGGGCTTAGAGGCCTAAGAAATCCCCACTGTGCTACCCTCATGTGCCTGGGTGCAGAGCCTATCTGGGGGCCCTCTCCATACCACCCTAACCACCTGCAAAGCACTCCTCAGAGCCTCCATTTGTCCAAGGCTAGCTCCCTGGTGACAGGCAGGGTCCCCAGTCCCTTCCCAGGCAGTCCCTTCCCTGCCCCTTCAGTTCTTTACCCGCCCACTCATTATAGTGCAGAACAGAGTTCAGACTGCCTACAGCCCCTGCATCAACAGATGGAGCCAGAGAAAGTGAGGGACAGGCCCAGGTCACATAGCCCCAGGAGAAATAGGCTTTAGCCCAAGGGAGGAAGCACTATGAGGAGGAGGAGGAAGAAGTGGAAGAAGAGGAGGAAGAAGAGGGGAAGAGGAAAAAGAGGAGGAGGAGGAGGAGGAAAAAGAAGCAGGGGAGGAGGAAGAGGAGGAGGAGGAGGAGTCAGAAAGAAGACCAAACAGGGCTAAGAGATCGAGGAATGCAGAACAGAGGGGACCATAGCACAGGGCACCAGAGGACCCCCCACCCCACGGTGGAATCATCACTGGTTCCCATCAAAACAAGTGACCAGTAAGATCTGAGGCTATCAGGTTTTATACTCGCTCAGCTGCTACATAGGAACAAGGAGCTGACGGGCTGTGAGAGGACAAGGCTAGGCTGGGCTTAAGATCTCTGCCACCATCACTACAGGCCAAGCCCACCAGCAAGGTTCGGAGGCAGTAGCCACAGGGCAGGCGGTAAGATTCCCTGCACACACCTGCGCTTCGGATGATCCAGGAACACTCCCAGGAAACCCACCCCAGGCGCACAGGTAGGGTTACCACCACCTCAGCCTGAGCCCTGGGCTCCGGTTACCTGCTCCCGCAGGGACGTGGCCCGCCCGCTCGCCCGAGAGGGCCTGTCGCCCGCCAGCTGGGCTCCCTACACCTGGATGGCAGGAAGTCATCCAGGGAGAACCTGAGCCAGCAGGCAGGCGGCACCTGTGGCTTCTCCCCACCTGCCACAGTGGCCCCCCAGCTCCTCCCTTCCCCCAGCTTCCAGTACCATATCCCTCACTACAAATAGCTCTGTGCACCCCTTCCTGGGAAGCCAAATCCTACTGGTTGACAGAGGGACAAAGGCGACTGGGCTGGAAGCCTGTAGGATCTTGGGGCTTTTAGAGTGGATGGGGGCTGGGAAAGCTGGAGGACCATGGGTGAGACAGAGAGCTACCACCTGCCCAGGTTTCCCAGAAGCAAGAGAGAAAATCCTGGTCCCTCCTCCTAGGGCAGTCCTCCTGGGCCACCTGCCTGTCAGACTCTGGAGTTCTATATCCTACAGCCTCGGCCCAAAGCCTGGCCCCAGACACACCCCCAGCCAAGTCCATCACCGTCTGGTCAAACTCCAAGTCTAACTGTAATTCCCCCCCCCAATCTAGCCCTTAGACAGAGCTAAAAGGACAGCAGAGGACCATGGGAAAGGCAGACCAAGGGACAGGTGTGCCCCCTGGCCCCATAGCCAGGGTTACTCACAGCCTAGCCTCAGGTACAAGGCTTGTTCTACTCTCTAGCTGCCTTTCTTGGCCCCTGACAGAGCTCAGCACTTGCTGCCAATGTCCGGAGCCCTAAGCACAGACATATTTCCTGAAACCAGAGCTTTGGAGAGGCCTAGGCCTCTGTCGCCATTGTCACCCAAGGGATAACCCTCTTAAGACTCCAGGTCTCTGGGTCACAGGAAGAGACAGTAGGTTAGCCCATGCTAGGGTTGGACAGGTGCACCCCACATCAGAGACCAGCTGAGGCCTAGCCTAGGTGCGCCGCTCACCCACTGCTGGGAAACCCAGGCTCCCACCGTGAAGAGGGGAGCAGCAGCCTGTGTGGCCCCTAGCATGCCTCATCGTCTACTGCAGCTAGCCCAGGATCAGAATGGGTATGCGACATCTAGTTCAGGATGGGTGGATGGGCAGATGGATCAGAGCCTTTGCCTGGCTCCCCAGCAACTCTCAGTGGACCAGCCCATTTCCTATTCTGTCCAGACACCATGATAGTACCTTTCCTGCCAACCCACAGGTACAGCACCCACCCCTCGCCCATCTCACTACAGCTCGGTTTCCCATTCACTCCTGTGGGCCCAGGGACAAGGGCCAGATCCACTTCCACGTCTGAATCCTCCACTGGCCCAAGTTAGCACTTTCTGCCTCAGTCCCCGCCGCCCCCCCCCCCCGTGTTGCTGGCTACAGAGAGCCCTACCATAACACATACTATGTGGCCTGGATCAAGACACCCAACCTATGAGGGAGACGGTCGGGTACAGAATGAAATAGCACCTGCCCCTAGCTCCAGCCAAGGAGGACTCTTGGTCTTATGGGGATGCTGTGGGAGGCATGTGCCTCAGCGTGGGTTGTGATGAAGAGACTGGTGCTCATCCCAGTCCCAAAAGGCCCGGAGGGCAGCGGGGTCCTTTGATGTACATGCAGGGCACACATTTTAGAATAGCCCACTTGGGTCAGGCCCTCTCTGCCTGTGCTCCCGGATCTGTTCCAGCACCCTCTTACGCTGGAACAACCTTACAACAACCGTCAGTCCTCTGTCCTATGGGACAGTCCTCCCTGACCACCTTGCCTTACCTCCCTCCCTCAAGTACACACATGGCCATGTGCTGGACAGCCAGCAGGGGGAGAGGAAGAACTTAAGCAGGAGAAAGCTACATTGGGGAGTTCAGTAGGGGACATGCTGGGCACCCTACAGCCTCAGCTAGCTTCAGGAATCCTAGTGGAAAAGGCCTTGCATCCGTCTCAGGAGAGGGGAAGCAGGTTACAGGACTGCTAGCTCAGCTCTTCCAGCCTTAGAAACCAGGTCCGCCGCCTCAGACCTGCCTCTCTCTCTATCACTCATGACCCCAGAAGCACCACCAAGGAAAGAGACCGGAACAGGGCTGCACCCTGGGCTCAAAAGGCAAGCTGGTCAGACAGAGGGCCTGTAGTAGAGACCTCTTCTCTTTTGGCATCCTTTCCCAAGCACAGCCCCACTAGACAGGCCAGCGACCACCTTGTTCCTCATTTAGCCAACAGGGACCTCCTAAATACACCAGCCACCAGACCCCAAAGAAAAGCCTCCGCTTTCCTCAGAACTCTCCATCAACCACCTGCTCGGGCCACGGATCTCAAGCATGCGTGGTGAACGAGGCCTCCCCGCTGCTGGGTACAGACAGGCACCAGAGCCACTCCAGGGAAAACGTACATCTCCCGAGGACATCTGCAACATGCACAGCCTGGCGGGGGTTGCTGCGGCTTTCTGCATCGAAGAATCCACTCAAAGAGGCTCTGAGATGGATTCGAAGCCACAGCTACCTCGGTGCAGGCACAGGAGTTGTGAGAAGCCCGTGCCTGCTCTTGTCCACCTTCTAACACCGTCCCATCTTTCCACAGGGCCCTCCACCAACCCAAGGAACCCAAGTCCCAGCTGGTTCTTGCTGTCCCCAGGTACCAAATGCTCCAGTGGGCGCCTGGATTCCCAATGTACCCTGGCTCACGGGACAGAGATGAACTTGTGGCAGATCAAGCAGCATGGCCGCAGGGCTGTTGCCAAAGAGCGGAAATACCAAGGTACTGGCATCACAGCACCAGCTCCATGCCTGGCAGCCAGGACACGCAGCAAGATGGGAGACGGGAGAACCAGACCTGCCCCCAAACACAAGGTACCCTTCAACCTCCAAACTTCCATCCATGCTAGAAACTTCCCTACCCCTGAGGCATCTTGGGAAAGCATCTGGGAACAGAAAGCTAAAGTGTCCCCAAGACCAAGTACCAAGAGTCGAAGGAAGGCAAGGGCCTGTCCCATCCCGTTCCACACCAACCGGCTGGCCAGCGGGGCAAAGAGCCACAAGGGACACGCGTTGGCCCGCCACATTCCTCCAGGCCCTCCCTGCCCCCCACACCCACCGCTGCCAACTCGAGCAGAAAACACATCCTCAGGTAGCGATTTGGAGCCACGCTGGCTTGGGCCCAAGTGCAGATGACAGGCTGTCGGCCCTGCTCAGACCTGCCTGCTGTGCTGCTGTGGGGGCGAGGGGGGCAGGGCCAATAGTAACTGCCTAGGGCCTCTCCCATGCCTGCCCCTGCCTTTTTCCGTCTCAGGGATAAACTTCCTATCACAAGCCCCCAGGGTCAAGGCTACCTGGCTAGGCAAGGGTATCCCTCCCTACGTATGGAGCAGGAGCCTAGGGAAAGGTAAAGATGGAGGCACAAGCTGGGTGGCCTTGGAAGAAATAATTGTCCAGGGCTCAGAGCAAGAGCAGAGCAGGGCAAACCCTGCCCACCCATGCCTGACCCCCTAACCAAAAGTCTCTTTCAGGACCAAGGTACCAGGCAGACCCATTCCCATGGCTCTTGGTATCTGAACCAACCGCAAGCCCTCAGTCAGGAAAGCCCTTGGGCCATTGCTTGATACCCCCCCTCTACTCGCTAGTCTCAGGCCTCCAGACCCACCTTTACCAGCTGTTTTTAATCTCACACTCAAGACTATGTCCATATTCACATCTGCACCTAACTAGCTTCACACCTGCAGACAATCAGGTGCCGGTACAAGCCAGGTCCAGAAAGTGAATAAAAGCAAGCACCATAAGACTTCCTGATCCCAGGCCTTTATACCACAGGCATGCTACCTGTCTCCCCCAAAGCTGGATCCCCATGACCCTTCTTCCCAGCATGCCCAGACTCGGGTTCTTGCCTGACCTGACCACCCCTAAGCAGACAGGGTGCTTCCCAATTCCAGAAACTAAGAAGCACAATAAAACATCCGCAAACAGCAGTGCCACAGAGGGTTACAACTTGGAGCCTTGTTAGTGTCTCTTCCCTTTCGGAGGAGGGGTCTTCCCATCTCTAGCAGCTTCTGCCAACACACACAATCAGGCCATCCCCGCGCAGGTCCCAGGCGCCTGTCCGTGCCCCCGGGCATCCAGGAAACTGCAGGGCAGGAGCAGGCTGGCCGCGGGCCCGGACGGCTCCGCCAGGGCCTGCCCCGGACCAGCCCCAGCACGCGCAGCGCACATGCCTGCACAGCCTACCGGGCCGCAGGCGCCTCGCACCTCCCCACGCACTGACACGCGCAGGGCGACGTAGGCACACTCCGAGGGCCGCCGTGCACGCGGACCTTGGCCTCCCAGCCCCGCCGCGACCCCAAGCCTGTCGGCCCTTGGGAACCCCGCGCGCCCACGTGGCCAGGCGCGAACCTGGCCGCAAGAGCACGCGCCCCAGGCCCGCCCGCGGCGCGGCGCCCCCTGCCGGCCCCGCCCCGTCTGGGCGCGCGCGGCCCGCACCCGCGCGGCCGCAGGTGCTGAAGGGACCGCGGCGGGCGCCGAGCGCGCAGGGAAGCAGAGTGCGGGGGAGGGGCGCACGTACCGGCCAGGCGAACTGAAAGGGAATGACGACGAGGCCCGGGTCCTGGTGGCCGCCGGTCCGAGACCGCGCGCGCGCTCGGTCCCCCGCAGCGCCCGCCGGCGGCAGGTAGAAGGAGTTGCCACCCAGCACGGGCGTGGCGCCGTAGCCGTAGCTGCAGGGCCCCGTGGGCGTCACCTTGGCCTGGTACTCCTTAAGGCACACGCGCACGTACGTGTCGCACTCGTCGCGGCCGCAGCCCCCCGCGCGCGTCGTCCGGCCGTCGCCGTCACAGCAGGCGCCGCTCAGCAGCTCCCCGTTCACGTTCCGCAGCGCGCTCAGCTGCAGCTCGAAATAGCCCATGGGCCGCGTCGCCTAAAAATAAGGCAGCGCAGAGTGCAGGGAGGCGCGGGCCGGGGTCGCCGAGCCTCCGCCCCGCCCCCACCCTTGCGCCGTTCCTAGGGCTCCGGACCGCGGCCGTTTGTGCGCCGCCTGGCCCGGAGGAGCGGCCCGGCCCGGTGCGCCCCGTCCGCGCCCGTCGCCACCGCGCGCCCCGCTCACCTGCACGCACAGAACCAGTAGCAGCAGCAGCCGCCGAGGCAGGCGTCCCCAGCCGCGTGCCCGCATCGCCGCCTCGACCCCGCCCGCGGCCCCGCCGCCGCCGCCGCCGCCCGCGCCCGCTATAGCCGCCGCGCCGGCCTCCAACGCCCGCCCGCCCTCCGAGCCCGGCGGCGCACAGGCGGCGGCGGCCGCACAGGCGGCGCGGGCGGGGTCGAGCAGTGCGCGCGGGCTGCGCGGCGGGCGTGCAGGGGAGGCGGCGGCTCCGGCTTACTGCAGCCGCTCTCCGGCGGCCGGCCCGGCTCCCACCCGGCGGCGGCGGCGACGGCGGCGGCGGGTCCTGGCCTCGGCTCTGCGCGCCCGCGCTCCCGGCACCGCAGCCAACAAGTTCGGGACGAGACTGACAGCTCGCTCGCCCATTCGTCACCCGCGCACCTGCATATGCATGAGGGGGCGGGGCCTCGCGGTGGGGTGGGGCCGTGGGGGGTGTTGGGGGCACCCCGAGCTTTAAAGGAGGCGAGGGTGCGGTCTATGCGCGGGGCGGCGGGGCGCGGGGCCACCGAGCTGTGGCTTCTCCTGCGCCCAGGCTCACTGAGGTGGGGCCTTTTCTGCTCCAGAATTCTCGCCCGGGTTAACAGCCTGGGAGTGAGTGGGGCGCCCCCTGAGGTCACTGCCTTGGTCCCCTCCCATCAGAGCGCAGCCACTCTCGCGCTGCTCTTGGTCCCAAGGGAGATACTGCCTGCTGCACACATCAGGATTTTGCCCCCACGCAGAGCGGGTGGGGCACTGAGACTTGAGTGAGCCCAACTCCTGGTGCGCCCCCTTCCCCCAGGAATTTCCCCCCAACTCCGCAGCCTCCTGTTACTTTCACGCCGGCTACAGGGGGCGCTACTCCCCTCCGGCGCTCAGCCCTCCCTTCCTCCAAGCGCACAGGTTGAGTAGCCAGTCAACAAATGCTCCTTCCTGCAGGCTGTTCCCAATTCCAAACTGAGGTGGTGGCCATCGCTACATTCTCTTATCTTCAAGGAACGTGCCGGCCTGAGGTTCAAATTTAGGGGAAAAGAAACGGGCATAAAGGATAGTGGACCATGTCAAGAGAGCTACCGGAAGAGGACTTTCCAACAGTCTGGGAGTATTAAGTCACAGAGCCTGGGTGTCCCAACCCTCCATTACCATTTCTTGACCCTGTTCCTAGGTGATCATTTCCTCTTCCACACGTCAACACCAAGGGTTCTTTGTCTACAAGCTGCCTCTCTCCCACTCAGCAGGGCCCTTTGCAATTCCAGTGGTTAGCCTCCATGATTGGTGATGTGCTACTCTGCCCTTACAAAAGTCTCCCGAAGGCTCCTCACTCTAGTCTCCCTTTCTAGTCCAAGTCACTGCCAGCCAGGATTTCCGCAGAGAGGGAGAAGTTCTGATACCGGTGAATCAGAGCCACAGTAGAAGGAACTTGGGTCAGGGCAGTGCCAGGCAGCCTACACAGGGAGCCAGGCCATCGAAAAGCCTTGATCCAGTTTGCCTGCCCTACCACTGTGAATGGCCGTCCAGGATCTCCTGCAGAAGCAGTAGGCCTGAAAGGGTGAACCAGTATCCCCCATACTTGCAGCATACCTGGCTCTGTCTCAAACTGCTCCCACTCCAAGGAGTGGAGCACTCGCCCAGGGAGCCCACACGCAGGTAGGGTAGGTGATAGGGCAGACACAAGCCAGGCCTGGCTACACACAGAGCCTCCCCTCCTCCACACCAAATAAGGGAATTGGTGCATATTAAGAATCTTTCTGTTGTTTGCATCCTTTAAGTGACATCCCCTTAGCAAATTCAGCTTCCCTGTCCCTCTTGCTTGGAGACAGGAGATCACAGAGGACAGAGAGTCTGAGCTTCCAGCTCACCTAAGTTCACCACCACCTCTGAGGCACTCAGCCAATCTTTGAACTAGGCAGCCACAGCCCTGGCCTACCTGCAGGGGCCTCTGTCTAAAGATGGATGATGGCTTAGACATATACTGTAGACCAGCAAACCATGAGCATCCAAACCGGGGGTGGGGGGGCATGAGACCCCGATGGTAGGGCCAGCAAGGTGAGGAGAAGGAACAACATGCCAAAGTTCTGGGGCTGAGAGAACCTGACAAGAGCTTGTGAGGACAAGATAGCCCAACCAAAAGCAGGTGGCAATCCTGCAGTCAGTCTTCCTACTGAAATCAATGAGATGTCACAAAGACCAGGGCTGGGAAGTGCCACACCATGACTTAGGAGGTCAGGGTGATGTGGTGCTGTTGGGAGGCACAAGCATAGTCAGGACAATGACTAACGGTGCAGGGGCTGAGGAGAGGGAGTTTAGCATGAAGCTGCAGCCCCTCCCTGTGTACCTCTGTTTCCCTGCTGTCAGCCAGCTGTGGGGGGATGGGGTGGGGGGCAGGCCAGCAGGCAGAGCCAGGGTACGCTGACAAGGACTTCTGTGTGGCTGCCTGACTCAGCCTACCTGCCCTGCCTCCCAGCTCAGAGCTGTGGGTGCAGTGGCCCAGGGGGGGATTCTTCCTATCTGGCCGAGACACGGGGGTCACCTTATACACTGGCTCAAGGTGGACATGCCACCAGCATACCTTGGAAAGCGGGGAGATGTAGTCCGCCTCTCCTGTCTATCCAGGCACTTTGTGAGGGAGAACAGCTGGCAAGTATCACGACAGCAGAATATTCAATATCTGGGCTGCACCTGCTATGTCCAGGTGTCATCCCACAATGGTAATAGCCTCCTCCTCTTCTTCCTCCTCCTCCTCTTCTTCCTCCTCCTCTTCTTCCTCCTCCTCCTCCTCCCCTTCCTCTTCTTCTTCCTCTTCCTCCTTTTCTTCTCCCTCCTCCTTTTCCTCTTCTTCTCCCTCCTCTTCTTCCTCCTCCTCTTCCACCTCCTCCCCTTCCTCTTCTTCTTCCTCCTGTCCTCTGGGAGCCACAACCTTGCCTGATGGTGACCAGGAAACGCTCAAGATGTGAAGGTGGTTACTTGCATTGAGAGGTCCCCTCCCATGGGAATCCCCTCCCTGCACAGAGTTCTGCAGCCCTCGGGCAGAACTGCCATGGACACCCGTCAAACCTCGTGCTTTCCTTCATGCTGTACTTGGGGGCTCAGGATCCCTGACCTGACCCTGTGGGGTCAGATGTTCTGTCTTTTCAGGAAGGCCTGCATCACCCGCTGGGCACAGCACCCTTTGGTCTCCCGCATGGTAGCTCGCTCTAAGACCCCCAGCACTGGGGTCAGGACCTTTTCTGAATGGGTGCTTAGCTTGAGCTGGAGAGGCCCAGAGGGGCCTCAGGACCAGACTGAAGGATGAAGCAGCCCAGGATTTGGACAGAGCTGGCTGGACTCTGGAGTGAGCTATGCTTCCGCCCATGTCCTGTGATGCTAAATATAGCGTCCAGGGAGGGGAGTTTCCGGTTACAGCCCCCCCACCCCAAGCCGGGAAATCGATGCCAGCTCCATTAGGCCCAGGAGTGGTGCCTGCTGACCTGCCCGTCAGGCTGCAGATCTGAGTGAGGGACTGGACTCTGCCCAAACCCAGGTGCCCTGACTCCTAACCCATCCTTCAGGCCACCAGAGCCCTCCCCCACTAGAAGCCCCTCCGGCAGCAAACACCTAAGGGCAACCCTAGGAGGCACAGGACTCTGATGGTGGGCGTTCGGCAGTTGCAGAAAGTCAGGGAAGGACATAGATGGTACACTCCTGTCCCGGAAACATCAGGGTGAATCTGGGTCACTATGCCCCCTCCCACATATTTAGCTCCTGGACACACACTACACACCTAAGGACCCTTCACCAGAAGCTGTGTTGCTTGTCTGACTGGGCCCCACCTAAAGCTGCAAACATTTGCATACAGGTGGTGCTATGTGAGCAAGTCCACATGTCACAGCCTCCTCAGGGTGGTGCCTCAATGTCATACCCACCTGGGGCACAGGGAGGAGGTGAGGCGGGTGTCCCTCATCTTCCAGGGCGGGGAAGGGGACTATATGAGGAGAGAGAGCACTCATTCCAACCCAGCATGCCTATCTCAATGTCTACAATTAGGACTCCAACACTTCAGCTCTCATCCAAAGGTTTGCTGGAACACAGAGCCCCAGGGCATGCTCAGATAGCTCATCACCTGAGCTCCACTGTAATGAATGATGAGGGTGGGAAGGGATATACCCCTCCAGGCTACCTCACTGCCTGGGGATGTGGGGGAATGGTAATCAGTGAGTGGTCCATGACCCAAGGAAGTCATAGAAGATGCTGACTGGAGGGTTTGAAGCGGGGCCACTTTTCTGAAGCCTGACCTTACCCTGAGACAGACTGATCCCTCAGATGTTGCCCCAGCATGCCTTTCCTAAATATGTGCCTGTGGCTCTCGCAGCTGGCTAGGTGGGACAGAGTGCTCTTTAATCTATGCTAGGCACTCTAGGGACCTGTAGAATGGCTCTAAGCTACGCATGTAGGCCCACCCTCAGGCCAGAGAGCCTTAGGCCAGCAGCACTGTGAGCTGTCACGCTAAGGCAGTTCTGCGCAAGAACCAGGCTGCCCACGCCAAGACGGCTGCTCTGGATCCCCATGATGACCTAGCCTACAGACGTGGACTTACGTCCTGCAGGCCAAGTGAGGTCCTCTCCCAACTTCCGATGGCTCAGAAGTCATGGGAAGAGTACCGGAGACACCAGACACAGAACATCACCAGATCCAAGTTCCTGGACACTGGGAGTGCAGTCCTGGTCCAGCCCCAGACATGGCAAGGTCCCTGTTTCTGCCCAGATCAGGGAGTACATACTCTGGCATGGGCAGTACTGTGCCCATTTCCTCTCAGCTGAGGCCAGTCTATCTCTGCTCCTGCAGACACAGTTCATGTTACGCATGAGAATAATTAAGAACATTTTAATTAATGCTTTGTAGACATTATCTGTCTTATCAGACAGACACCATTAAGTCATAAACCTTTCTCTTCCATATGACTACCCCTTTCCACATTTGGTCTATGTATCTACCATCCTCCGTGAAACCAACAACCCGCCCACCTACATCCCTCTTTTCCATCCGGGCCCAAGAAACTTGGGGGTAGCTGATATGGAACTTGATCAGGGATCCAAGGCTAAACACCTAGCCTGGTTCCCTCATGAGCTGGCTACTCTGCCTGACAGTACTCCAGGCTTGCTGTGCTAGCCCGCTGACAGCCATCTGCCTCCCAGGTCATCCACTTGCCCCACCAGAGGAGGACCAGAGGGTTTCTATGGAGACCTTGCTACCCTCCAAGACACAGTGCCTCACCCCAGGTCACAGTGCTCAAAGCCAGCGGACATCAGTAAAACTTACACAAGCTTTATTGGGTGCGCAGGGCAGGAGGATGAGTGGATGGGATTAGGCCTGTCCAGCCCCAAGGTCTCACTGGAGACTCAAATGGGGAACCACCTGGCTAAAGAACCAAGAGATAGCGTAGATAACCCCGAGAGTCTTGGGGATGTCAGGGTTGTCTGCGAAGGCCTGGGCGTCATCTAAATTCAGATGGATCACTTCGATGAGTTCTCCCTCCTCGGCCAGCCCTCCACCAGGCCCGCCTCGCTGGGCATCTGTCACCTCCGCGTAGAACATGGTCTGCCTGGAGCTAGTCAGTCCTACTCCAGACCTGTCAGGTAGGACAGGGACTGCTGAGAGACCAGTGTGGCCCTGCCAGACACCCTGCTTCCATGCTTCCCGCTCTGCCTTTCTGATGATCAGAACTCTGTGTAGCTTCACCCTTCCCAAATACCACTCCCGGGGCAGGGGTGGGGAGGGTATGTCCACGGAACCTGCCCCCTGCAGCGGGCGAGCCTCATGCATGTTGGGTATGCCGGCTATCATATGGCAGAGGTAGGCATCAAGGGCACTAAAATGATTTTTTGAGATGAATTTGATAACCGTGCTGGAGAGGTGGCTCAGCCACCAGTGGCTAGGCTCATCATCAAACTGTCAAGATAAATATGACATCTGACACTTAGGGGAACACACAAATGCAGAGGCACCTTACATATATATATCTTCGACCTAGGACCTGTTTGGCTAGCTGACTGAATTCATCCCGAGAGAGATACATGGGTAGGCCTGGCCTAATCAGGTGAGCTCACAAGACAGCTTCATGCTCACAATCTAAAGAGCTCTGGCACTCTCTGCTAGCACAGAGACCAGACAAGCTGCTGTGTTGTAAAAAGACGTGTGGCAAGGACCTGCAGGCATTGCTAAGATCTGAAAGTGGCTATCAGCTAGTCAGGAAGTGGCCTCTATCCCATAGCCACAAGGACCTGCTACCTTTGCACCTGGATAGATTGTGGATGTGGCAGGTGTCTCTGAATGCAGCTTATGAGACCCTACATGGAAGATCAGGGACCTTGGACACAGACTGTGCATATACAGAAGCCATGAGGTCACAAGCAAGTGGTATTAGAATCTGTGATAGGCCCTACGGATCTGTTAGGCCCCTGCCCATGTCTCCTGAGT
D3_15 114143073 114158121 15049 TATGTCTGTAGCTGGACCACAGTTCATTCCCAAATTTCTCTTCTTCATCTAGGCAGCAGGATTTGTAGACAGGGGAGTAGGAGCAATGTTTCCAGTCAGACGGTCACCTTGAAGGCTTCAGCAGTTCCAGGGGACAGACACGGATTTCTCTTCACTCGGCCAGGGAAAGAAAACCCAAGGCCAGTAACAGCCTCCGGGTGACAGTGCATGCAGATAGCTAGCCACATCTGGCTGACCACATCTGGCTGGCCTTCCTGAGGGATGAGCCTCTGTGCATCTGACTGTCCAGCTCTGCAGAGTGGGCGAGCTAGTATAGGAACAGGGTGGCCCTGGGTTGAACCCTTGCCCATGGGAACCCTGGTGTCAGCTGAATGGCCTATATTCCCCTACAGTCAGTGGCCACAACGAAAGTGGGGCCAGCATTTATGACCCAGTAGGGACTCCAGACAGAGGGGACTGTGGAGTGAGCAAGGGAATCTGGGCCTGTTTAGTATTGCTATCAGCATGGGCTAGCTGTAGCCAGTCTGTCCCCATTCCTGCTGGGTAGCAGGTTACCTGAGTGAAGACTAATTCTCAGTTACTGACCATGCCAAGCTTGAGGAGGGTATAGTTTGCCAGAGAAGCCTGGAACCTGCAATGGACTTGAGACACTGGACAGTAGATGTGGCGGGAGGTGCAGGCCTGCAGCATGTGTGCATGTGGGCCTCTAGAGACGCCAGCTCTACTCATGCACTTGGTGCACACCTCACACGTGTGCCACTCCCACTTCAGCCTCCAGCAGCACCTTACCTTGGACAGGCAGATGGTAAGACTTTATCCTATGAGCCCCACCTGGTCTATGGGGCCTTCCCTGGCACCATCCATGCATGAGCATTCCATACACACCCTTTAGGAAAGATCTAGCAGCAGACACAGACGCACCACAGGCACACACATAGACACACACACAGACATACACAGACAGAGACAGACAGACACAGGCACACACACACACTCACACAGACACACACACACAGGCATGCACACAGATACATACACACAGGCACACACACACACACTCTCACACAGACACAGGCACACACACAGACATACCTACACACCCACACAGACACAAACACAGACACACAGACAGACACACACACACACACAGGCACACACACACACACAGGAGCACACAGACACACATAGACACATACACACACACAAACACACCCCTCTGCTTGTCCTAAGACTGTGTTCTCATGGTAGCAGGACTACCGTGACAGGCCCTCAACCCAGGACTCTTGGCTGCTGTTGCCATTCCTATCTGTTGTCCCTAGCTATATCTGGACTGTGTATGTGTGCTCACGTGGAGAGAGATGTATGGGTGTGTGTAGGTGCATGCGCACTGTGAATACATACGGAAGCCTGAGCTTAACCTTGCAGAGCATTTCTCTGAAGCCATCCACCTTTAGTTTGAGGCAGGGTCTCTTGGTCCGTAACTGCCAGGGCTGAACTCATCTCCCGTGCTTCTGCAGCAAGCGCCGTACCAACTGGGCTCTCTCTCTTCAAGTGCTGGCCATCTCCTGAGGGTCATCTTCTAGTTGCACTGTTTCATTTGCGGTCCACATATCTTCCTTTCTGCGGCTTCTCTGGCTGCCAGTGCTTCTGAGGAGGCATCTGCTTTGGGCGCGGTGAGCAGCCTCGCTCTATGGATGGTGACTGAGAATCCTAACGTCTGCATGCAGGCCTCTCTGCAGTCCGTTCTTCAGGCTGCTGCTCACAGGCCGGGCTTCCCGTCACTCTGAGGGTCTTGGCTGTAGTCTGCTCAAGGACCATATAAAGTCATTTAAGAGACCAGTGGGTAGCATTCTAGAACAGGGGAGGGTGATATTCATTCCCATCATGCCCTTGAGGGCCTCAAATTATCAATTAGGAAGAAACTTGAAGCCTAGGGGGTGTTTTTTAGCCAGCATAATGGCGGGAACGTAACTTTCAAATCTTATTACCGAGTCAGGATGAAGACCACGCCTCCTCGGCAGGCTTGCGACGGGACTGCCCAGTGCCTGCGAGTGTTGCTGCTGGTCTAGCACTTCTCTGAAGAGCCTGGTGGGAAGACTCATCACACACTGCAGTATTAGAGAAACAGCACAAGGCATCTCCAGAAACAACCCTGGCAGGAACCAGACCAGCTTTTTACCCAGCAAGAAGTATAGTGAGTCCCCCTCCTCTCAAGAGCCAAGCATTCTTTCTGCTCTCCTAAGCTGTGGATGCTGGCCTTGCTATGTACCGTCTGCCAGCCTCTGCCAGAGAGGGCAAACACCCTGTGCACTGCTGGCAGTTGGCTCCAGGATTGGCTCCCAACGCCCAGCCCCGAGGCCACCACTGCTTAGTCCTTATAGTTTCTACTTTAGATATAAAGACAAGAGGGCCGGGCGGTGGTGGCGCATGCCTTTAATCCCAGCTCTTGGGAGGCAGAGGCAGGTGGATTTCTTGAGTTCGAGGCCAGCCTGGTATAGAGTGAGTTCTAGGACAGCCAGATCTACACAGAGAAACCCTGTCTTGAAAAACCAAAAAAAAAAAAAAAAAAAAAAAGACAAGAGGGCACTGGCTAGAAGTCTGTGGCATCCTTGGGCTTCCTTCTCTCAAACTTGGGGTCTCTTAGACTGTGAATTCATTTTTGCTGAGCACTGTCCCATTTCATAAAGCCCTCTCTTTAGTTAGGAGGCCAGGTACACACATTCCCCAAACCTTACTCCCCAGGAGGGTTCCACTAAACGGGTGTCAACTACTACAGTAGGACTCCAGCAGTGCCTGAGGCCCAAGTCACCCACTGCGCTGAGGTCAACAGAACCACCTGACCTCTTAAGACCCCACATCAACATGACCCAACCCTCAGGCCATGTCCCACTTCCACCTATGTCCCAACTGCACATGGAGAAAAGGAACAGAACCCAAAGAACAGGGAGGCCAAAACGTTTAAGTTATTAAATCAAATATACAGAGTGATTCATTTAATATGTACATATTTACAGAAATGCACTTTCACAAGGAGGGTGGCCGGGGCCGGCAGGTGGGCAGCGGCCTGGTGCCCACGGCAAACGCTGACAGCTGGGAGGGGGTCTGTGTGAAGGCACTTGTCACAAGCTTCAATACTGCCGCCGTCCCGGGAGGGAAACCGAGCAGTTGGGAAGGGCACTTCTGAAAGCACAGTTGGAGATCTCTGGAGAGTTCTGGGCAGGAGGAAGCAAGGACAGCAGGCTGGAGGGGCTAGCCAAGGCATGGGCCAGGTTTACGTGCCAGCCTTAGGCCACACCAGTGACCTCCAACCCCACTGACAACCACAGGCGCCACCAACAGCTATGTAACCGGCATCACACGGGCCACCACGGGTCCCACTGACAGTACGCCAGCCCAGCAGCCAGTGCCACTGACAGCCACAGGTCCCACTGACATCCACAGGCTGGGCCAATTGCCATGGGTACCATGGACAGCCACAGGTCCCACTGAGAGCTACAGCTAAGACAACAGCCACAGTCCCACTGACAGCCTCGGGCCATGCTGTCAGCCACAGGTCCCACTGAGAGCCACGGGCCACACTGAAAGCCACAGATCTCACTGAGAGCCACAGCCCAGCCCACAGGTCTCGTGGGCTTTTGGGCCTCGAGCTAGAGAGAAACCCAAATGAGGAATAAAAAAGAAGATTCTGTAAACAGCGACGGCCTGTGGTAACAAACATTATACGATTTGGTGAGGACACACACACACACACACACATACACACGCCCTGCTCTCCTGCCACAGTGCGTGCGGACGCGGAAACTTTACAAAAATAGCAATGATCCGAGAATACTCCGTTGTTTTCCGCCTGACAGCCGTTGAATAATTTATACAAGGTTAAAGAAACGTAAAAAATAAACATTTGTTTTTTGGTTTTGGTTTTGTTTTTTACACAAAATAAAGAAACTATGCACACGGCCTTGGCCTCCTATGGTCCGGCAGGCAGCGTGGTGCCAGCAAGGGTTCTGGGTGCCAGCCTGGTGGCTGGCTATTCCCTGCCAGCACGGCGCACGTCCTTGGTACTTCTGACGGCGCGGTTGTCCACTTTGGGCCCTGGAGCCCAGCGGGCTGGCCTTCCGAGGGAGCAGCTGGGGTCTTTGGTGAACTTGTGTGAGATGAACTTCTCTGCCTCTGGGGAGTCCCCATCTCCACGGCTCAGCTCTTCATCCTCCTCGTCCTCCCCACCAGCCCCATGGCCAGCTGGCCCGGGCAGTGCCTCGCCTGCCCTGCGGGGCGGCGGTGTGAAGTTTTTGCACTGGTAGAGTATGTCCTTGTGGCCCCCAGTTCCCAGACCGCTGCCGCCTGGCCGCTCAATGGGGTTGCGGATGGGATTGAGCGGGGCCCACTGGTTGTTGGCGCTCTCATCCCGTGGTAGCCGGCTCCTCTCACGTTCTTTCCTGCGCTTTCGTGTCCACCATACGCAGATAACCACACAGGCGAGCCACAGCACACTGAACACGCTGCACAGCACGGGCACCAACAGACCTGGGTAGAAGAAGAGGTAAACATCCTGCGTCCACATGGGCCAAGCAGGGACTCTTCTGGTTTCCAGAATGAAGCTGGGTAGCAGCAGACACCTCTTCCCTCTGAGCAACATCCACAGCAGATTCCCACTGGTCTTGAGTCTGGGAGCCCCTATCACCCCAGCTTACCTGTGGAAGAGCCACCCATAACAACTGTTTCCACCTTGACCTCGGTGACAGCCAGCAGCAGTGAGCTATTTCCTCTCTGAGTGATAGCAGCCACGATGGCGTGGGCTGTGCTCTGGATCAGGCTGCTGTCAGGCAGGTCCCTTGCAGGGCTGAAAGACTGTGGCAGAGGATGACACTGGGGGACGGCCCAAAGGTACCCTTCCTACATCCCAGGAGCCTGTTATAGCCACTGCCCAAACTCTGATCGGGTCCTAGCCAGATGTACAGAGGGCTGCCATGGGTAGAACTGAATCAGTGCTGTGCTACACACGGCCAGGACCTGACAGGGCTTGGAGACCAAGAGACGGGAAGCTCAGTGCGGTTGGATCTTGATGTAGAGGATGCACCCGCCAGATAGATAAGGGCCTGGCCCTGCCCCTGTCAAACCCCTGCATCCTGTATGGGGACCGCTGGACAATACCAAACAATACCAACCCCAGAACTCTCTCTCTTCTTGCGTGCTGGGACCCGACCTGCACCCAGGCCATTTCCTCACGATAAAACCCAAACTCACATCCTTGTTGCCTTCCCATCGAGCAGCTGACCCTACGGACTGTCAGTGACCACCTCGACAGCCTGATGTTCTTCTCTTATAGCTCTGGCCCCTACCCGCCTGCCGCACGCAGTCCACGTGGATACAGCTTCCCCACCCAGCCGCACCCAGCTGTGGAGGTGCCCAGAGGGATGCCAGATCTGGCTCCTATCTCAGTTCCCACTGCCCCGGGTCTCCATTCCACCATGTAAGTGCCTCCCCGTCATCTTCAACTCTGCCACTGCCCCGCGGGATGCCAGAGTGTCACTGCCGCTGAGGGTCTAGAGGCCTGCTCAGTTCAGGTCACCACCCACACTCACCACAGCCACCTCCACAGCACTGGCCCCCGAGGATGCTCGATCACAAAGCAGCAGGAGGAGGCGGTCGTGTGCCGCCGCCCTCGTGGCAGGCAAGGCTCGGATTCCAGAGCAGATAGCGCCCACGGTGGTGCCCTGGGCAGATAAGCAACAGGTTAGCGGGGTTTAGGGCCAAGATCTGAGGCCATGTCTCTGCTGACAAGGAGCCTACCCTGCTCTTAACCCAGTCTGTCTGAGGCAATGGGAGGAGCTTGGAACGGCCACCGTTGAGTTCGAGCCCCTGTTCTGGGGAACGGGTAGGCTAGTTCGGAACATCCAGAGGGTGAGGATGGGACACATCAGAAACGGGAACTATCCTTTGCATGTCAATCCAAAGTAGGGTGGCCCGCAGCACCCCTGCAGTCTAGGCCCCAGGAACACTGGGCACGTTAGCAGCCCAGCCTGGACCCACTCTCTCTTGCCCAACAACGCCTCGGCTCAGTGCTTTCTCGTGTGATCCACCTATCTGCACAGCCACGGGCTTCTGGACCTACGTGAGCTGAGCCTTGAGAGAGCGAGCAAGCGGACTATCACTCTAGGGGTAAACCTGGGAATCCTGGGTCCCCCAGGAGCACTCACCTGAGGCACTTGATCACGGTTGAAGCGCAGTGTGAGTCGGGCACAGTTGTTGTCCAAATGACTGCTCCGTGGCTGACAGGGGGTGCTGGGTGGCAGAGGCTCCTCCGCTGTACACTCCCCCCAGTTCTCACAGGGTGGCTGCAAGCACTGACCCACGGCCTTCTCCTGACATTGCTGCCCTGGGGGGCACTGGGCACTCGGATCGCTGGGCTGACCAGAGAGCAGGCAAGGCTTCCATCCGCACCATACCTGGGAGAGACGCGCAGGAGACACATGGGAGCGGGAGCACAGTCAGACAGCACACAGCGCACAGTCAGGCAGCACAGAGAGAAGACATCAAGGAGTAAGTTTCAAGTCAATGTCTCTAACACCCAGGGGCCCTAGGGAAGCAGGCAAAACTCCAGTCCAGAGAGAACTTTCTGCCAAAACAGAAAGAACTAGGCAGAGCCTGGGAATGGACAGAGAAGAGAGGCAGGCCCAAGACCCCTCCCAGCTCATCCCCTTAGGATGGCCCTCAGAAGTGGGCAGCCTTATCAACCCACACCCCCACCCCTGCATCAGCCTCTTGATAGCTGAGTGAGCCTAAAGGCTCAAGATTACTCAGGGTCACAGTGCAAGAGGGGCGGAGGAGGGGCTGGCCCCACCTTGCTACAATCCCGGTGGCCATCCAGGCAGCGGCAGCTGTTGCAGTCTTCCATCCAGGAACTCCCATGCGGGAAGGACATTCCCCGGGACCAGCAGGGCCTCGTGAATATGACCACTGTGGTAAGAAGGAGGAGGCTCAACAGAGTGTCCAAGCGCTGGAGGGTGGATCTGGCCCACGCCCTGACCACGGGCACAGACAGCCTACCTTCCTGGCACCTGGGGCCAGAACGACCTGGTGGGCAGCTGCAGCGGTACCCGTTGATCTCATCCACACACGTGGCTCCGTAGGCACAGGGCGAGGACTGGCACTCATCAATGTCTGCAAGGAGAGCGGCTGTGTTCTTAGGGGTGTGCACCCCACCCAGGGACCAGCGTGTGGGCGAGGCAGAGGGCTGGAAGGCAGTACCTCAGTCCACCTGTCGCACAGCTACCTAGGCTGTCTGTGTCTCTGTCCATCTGAAGCCTTCTAACTCTCAGTCCCTCGCCCTCCTCTACTGCCTCTGTGCTGTGAGCACTCAGGGACCTCTGTGCTCCTCTCTCTCTGAGGTGGCCATGTACACAGAGGCATCCTCACAGCCTGAGGGGGCAGGAGCATTCCACCCTGTAGCCCCTCTCCCTCTTCCCAAGATGCAACTGGCTCTTCAGGAAGGAACTAGGCTCTCATAGGATGCAGACATGCTCATGGGAGGCAAGGGAAGGCTGCGGCCATGTCCCTGTCAGGATGTGGATGTTTATGCCTCCCGGCTTTCGATACTGAGATTGTCAGGAGAGGGCCCCAGACGAAGCCCCCAACCCCAGCCCCTTCCATCCACCTAGGCTGCTTACTGATACGGCAGTCAGGACCCGCAAAGCCAGGCGCACACTCGCAGCGGAACCAGTTGACGCCATCAACACAGATGCCTCCGTTATAGCTGCAAGGGAGAGGGTGGCCATAAAGGGTCCCCTAGGATGGGCCCTGCCCCCCACCAGCCTCCTGGGCCGCCACTCACCAGGGCAGAGGGTTGCAGTCATTGGTGTCTGGATTTAAGGGGAAAGACAGGGTGGTTATTTCAGCACACTCTTGCCCAGAACACCTCTGCAGCACATCTCTGTGTCTGAGGCTCGTGGGTAGACACTATCCTGTCCATACCAGCCTGGCACAGCCAGTGGAGAAGTACGAGGAAGGCTCAGGACCCCAAGGGAAGCCTCCATGGGGTGGGAGCTATAGTTGGAATGGGACCTATGTCTTAGCAGGAGCCCAAGCCTGCAGAGTGGTGGATCAGGGTAGGTAGAAGGACCCTGCAGATATGGCACAGGGACTGAATTACAAAGTGGCAGAGCAGGTCTCAAGAGTGTGGATGTGTGAGGTAGGCAGGTGGAAGAGTGGTTCTTCCTGGAAGTTGGAAGAAGGGATGGGGGTGGGGCTGGGTGAAGTTAAGCAGAACCCACAGGCCTCCCCCACCTGAAGCCCCTCCAGCTCACTATGTGTGCAGGTGCGGCCCTCCCAGCCATCCCGGCAGATGCAGGAGAAAGAGTCTCCGCTGCCCACGCAGGTGCCTCCATTCACACAGGGATTGGGCACACAGCTGCTGTTCTTGGCTGCAGGGAGGGAGGGGGGAGGATTGAGATGCCTGGGGCAGACCACAACATGGCTGGGGTCGGCAGCCCAGGGCTAGGGGAGGCAGCCAGCCTGGGTAGGGTGCTCACCGATGGTGCAGGTGCTGCCCTTCCAGCCCGGAGGGCACGCGCAGCGGAAGGTGTCGCCGCTGTCATAGCATGTGCCACCGTTGCTGCAGGTGTAGGCGTCACACTGGAACTCGCCTGCAAGCACATGGCCGCTCAGTGGGCGGGCCATATTGACCCCAGCAGGGTCCTGGCAAGCAGCCCCTCCACTCGCTCGCTTGCTCATTTGCAGGGACCCCGGGGCACTTACGTGAGTGGCAGGTCTTGCCCTTCCAGCCATCGTCACAGGCACAGTAGAAGTCATTGACCAGGTCATAGCAGCGGCCGCGGCTGTGGCAGGGGTCGGGGAGGCAGTCGTTGGGATCTGGGGGGAGGACGCCGGTCAGCGGGGGTCACCGGCGCTGGGGAGGGCTTCACGGAGAAGAGCAAGAGCTGGGCCCAAGCACATGGGAGCCTGGGATTCCACCCCATGACTTCAGGCCCATGTACACAGTGCTGAGTAGGACATAGGGGTGGAGCCAGGCCTTAGCCAGTGGGGGCGGTCCGGGTAAGGCAAGGGTGCAAACTCACTGATGTCACAGAGTTCTCCTTCCCAGCCACTGGGGCAGAAGCAGCGGAAGGAGTCCACTTCGTCAATGCACGTGCCCCCGTTGCGGCAGGGCTGGCCCATGCAGTCGTCAATGTCTGAGGGAGAGGATGGGTGAGCTGTCCCTGTGGCTGGCCAGCTTGCCCCACCCCACCAACTCTGCACACCACTCACTTTCATGGCAGTAGGTGCCTGTGAAGCCGCTGTCACAGATGCAGGAGAAGTTTCCCCCAGGCAGGCTAACGCAGTGCCCGTGAGGGCCACATATACCAGAGGGTGCGACACCGCGTGCCCTGGACCCTGCCTCGAACCCGCAGCCATCGATCACTGTGGCAAAGAGATGGACAGGGGTCAGACCCATCTCCACCGGGGTACCCACCCAGCCTGAAGGGTTGCATCATGTACCTCTACATGCCCCGCCAGGGCATGTGTCCCTGGGCACTGAGCAGTTCTTGCCACCAAAGTCTTCTGGGCAGGCGCAGTAGTAGTCACCCTCAAGGTTGTAGCAGCGAGCACCGTTGAGGCAGGGGCTTGGTTCACAGAGATCCATGTCCACCTGCAGGTAAGGAGTGGGGGATGTATTTGTGAGTATCCAGCTCTATATAGAAGCACTGTTTCGTATAGACAACCAGGCCTCTCTGCCTTAGACCCAGCGGTGCCAAGCTGAGCTTGAAGCTCCCACCCACCCAAGAATGTCTGAGCACCGTCAGCTGGACGGAAACACCTGTGGGCCACCAGCCCCCTCCTGCCGCCCTCGCCTCCACAGCAGCCAAGCTTCCTCTGCCTCCCACAGACAGCATCCGGTTTTGGCTCCTCCCGCCGGCAGGAAGGCCAGCTTCTGACCCCCATGTTGCCAGGCTGCCCTCAGAGCCAAGAGAGGTCCTTCCTACAGCCAGCACCACCATGCTCTGGGGACCCGAAGTCAGAGGCCTCTGCCACGGGCCACTAAGAAGCCCACAAGGCCAGAGCAAAACCATGTGTAGCTCAGGACAAGGGAGATCACCCAACAGGGGTCAGGGTAGCAGCCGTGTGGAAAATCACCCGTTTCTTCCCAGGCCCACCCTTGACCCATGATGTCCACACATAAAATATGCAATTCTGCCTTTGGGGGTCCTTCTTGCAGGCTTCCCCTCTGCACGGTCCCATACAGGGAGTGAAGCATATAAGATTGTTGAGACAAGGGACAAGCCTGGCTTTGGTGACCCTCCTAGACAGGGCTCCCACCAAAGCCCCTCTAGGTTATTACCTCACAGTGCAGCCCAGAGAGGCCCCGTGGGCAGTGGCAGCGGAAGCCATCCACCAGGTCCTCACAGATGCCACCCCGGCGGCAGGGGCTGCTGGCACACTTGTCGTACTCTAGTTCGCAATGGCGACCTCCAAAGCCCCGCGGGCACACACACTGGTACCCATTGACCAGGTCCTAGGTGTGTGGACAGGTGGGTGGGTGAGCGAACCTCATACAACCCTGCCTGCCTCCTCCAGCCACATTCCACCCTCCCAGACTTGGCAGCCCCCTTACCTTGCAGGTGCCCCCATGCTGACACTGCCCATGGCAATCGTTGATGTCTGGAGGCAGAAGGGCATGCGGGTGGGGTCAGGGGGGCCCTCTGTGCTCCCCAGCCCCGCCCACCGGCGCCGCCCACCCATACTGACTGATTTGGCAGTTGATGCCCTTCCAGCCCGGGAGGCAATCACAGTAATAGCCGCCAATCAGGTTTTTGCAAGAAAAAGCATTAAGGCACGGCTTCCCTTCACACTCATTGGCGTCTGTGAATGAGACAAGGGAGCTGTGGGGCTCGGGCCCCACTCACCCACTGGGCCCTGCACCTGACGCCCGCAGCCCCAGCAGTGCCAGCAGCAGCAGCAGCAGCAGCCACATGCACAGCACACAACCCATGCACAGACAGTCCCCCCCAGGGAGCCCTTACCCAGCTGGCAAGTAGCCCCCACCCACTGCTCCGGGCAGATGCACTCGAAGCCGTCCACCTGATCCACGCAGGTACCACCCGCTGCACATGGGTTAGAGGCACACTCATCAATGTCTGCAGTGGGGGAGGAGGAAGAGAGAGAATGAAAAAGAGGTAGGTAGGTAAGGGTGTGGCCAGCAAATGAGAGGACGAAGTCAACGGGTACAGACTATGGCCAGTGAACGTGGGATCGTGTCTAGTTAGTGTAGACCCATGGACAGAGGACATGGGGTGTGGTCAGTGAGTAGGGACACAGTACACGGGGTCTCAGTCTGCAGCAGGGAGTCACAGTCCCATGTAAAGCAGCAGGAACCGATTGTTTGGCTGCAGTGTCTGCTGTGCAGCGGATTCAACCACTCTGTCCACACCCCGAAGTGCTACCCACTCCTACCTTGTGAAGCCCCCAGACACTCACCGAGCGCACAGGTGGGTCCGTTCCATCCTGACGGACAGTGGCATTCAAAGCCAGATGGCACTTCGTGGCAAGAGCCCCCATTGGCACACGGGTTGGAGGCACAGGCGTGCTCAGCTGCAGAACCAGAACATGAGTGGAGCGATGCCCACTGAACTTGAGCACGCTTCCCCGAGCCCACCAGACCCAGAGTTCACAGGGGTACAGCCCACTGTACAAGGCAGTGAAGAAAGGCCTCAGCCAGGCTCCCCGAGAGACAGCATTCCAACCTACCCCGCTCGCAGTTCTTGCCCAAGTAGCCATCTGGGCAGGCGCAGAGGTATTGGTCAGGCTCAGCATTGATGCAGGTACCCCCGTTGACACAGGGGTGGTGGCTGCCACAGTAGTTCAGGTCTGGGCACAAGGGTAGGGCTCTCAGGGATGGGCCCAGTGTCAGAGCTTAAGGCCTGGCCCTGCCCACTGCCCACCATCTCTCTACCTTTGTCACAGAGCAGGCCACCCCAGTTGGTCTCACAGTCACAGTGCCAGGGCTCCACACAGCTGCCATGCACGCAGCCAGGGTAGGGGACACACTCGTCACAGAACTTGCCCTGCCAGCCGTAGCTGCACCTGGGGGACCGAGCGACGAGGCCATCAGCCGGGCAGATGAGGAAGGGGCATGGGAGGCAGGCACAGAAGTGCAGGCTACCCCTACTGGGTGGTGGTCCCAGAGAACAGCTCTGAACCAAGCAGGGGTTACGGCCTGCCGGCCAGTCTCGCTGTCACAGGCATTCCCGGCCACTGGCCGAGATGGTCAGCCCAGCTGTCCCGTCACTCCCCCTGAGCTATTCTAGGACTCAGCTCTGAGCCAGGCGCCTGGAAGGAAGGCCCAGCCGGGGGAGGCCCAGGGGTACAGTGCCAGGTGCTGCTCACCAGGTGCTGCTGGGACACAGCAGCAACTGGGATCTGAGAGGGATGAAGAGGCATCAGGAGAGATCCTAGCTACCCTGGTCCAAGGGCTCTGTGACCTTGGGTGCCGCCCATATCCTCACTGCTACTCAAGGGCAGAGGTTTCTCTGACTCCTAGGACAGTCCAACCCAGTGGCTGCCCAGCCAGCCCTATGGGAGCGCCACACTGAGTGGGGCTGAACCCAACACATAGACCCGAAGACCTCGTCAGAGGCCGTAATCTTACGACCTGGCTCTGACCACACTGGGGACTAGTGTAGCCTCTGGGGAGTCCCTCAGGATGTAAGTAGGTGGCCAGCACAGAACCAGCAGGTGCGAGAGTACAGGGCTCCAGTAGGGCTGCCCTCTGGGCCCTGGACAAGACTCTGGGGGCCCCTTCCTTAAAGGCTAAGGTCCTGTGGGGCAGGAATGACGTGCAGGCCACGTCACTTCCACGCTGACACCCGCCACAGGAGTTATTTTTATAGAAGGAAAAACCACAGCCCTTCCTGAGCTGCCCTGGAGCCACGCACACAGGCACTTATCAGCCCGGCTCACCCAGGCTCACATAGGGAAACTGAGGCTGGCTCCAGGGTCCAGCCCGGAACGTCCAAGGCAGGTCCACAGTAGGCCTCCCCTGTCTCTACTTGGGAGTCTTCTCTCCAGGTGATACGGGGAGTCGAGGGGCAGAGAGGGCTGGGACTAGCCTTGGGTCATTCACCAGGGAACACCAAGGCTAGCTTTGAGCCCAGACCCCGTGAGCCCCAAGGGCAGGTTCTCCACCCTGGGCGGGCCATCCCACACCAGACCCCACCTTGTGGCTTTCCTGCCAGCCGTTCCAGGGCCTGGGGAGGGTGGCAGGAAAGCACGGCCATCTCCGCAGTAGCATCCGGCTGGGGAGGGGTGTCCTCTGCTGAAACCTGAGCTCTGGACAGCAGGAGGCCACTTGGCCTCACCCTCTGGCCCAGGGAGAGGGTGGCACTCACCTACCACCCCCTACCCTTGCTTTCCTCCCCAGGGCTCCTGCCTGTGTGCTACCCACAGCCTTTCTGCACGGAGGGACGGAGGGACGTTGCCTCATCTTTCATCTCCCTCCAGCACTGACCACTTTGGGATGCTGCTGGTATAGCCGCCAAGATACCGTAATATACCTTGGGCTACAGAGTGAGTGTGGGGTTAAGAGTAGGCTCCTGTGTTTACCACCAGTGGGGCACATCTGCCCAGAACCCACGCCCAACTCCAGCACACTGCTCAGAGCCGGGCTGTGAAAGACTGCACTGGGGCAGAGGGCTGTGTGGATGGACGATTTCTGCTGCCTGTCCCACCCCCCATCTCCCTCCTTGGATGTGGCTCCTGGAGTAAGAAGCCAGCCCATCCTGAGACAGGTGCTCCTTGCACTGCCTTGAGTCCTGCCAAGACTGTCTGAAACCACACTGTGTGCAAGTGGCACCTGGGATGTCTCCACTGCACACCCATCTCTTTCTGCCCAGGGACCAGCCTAGCTGCTGAACACATCACTAATGCCACTATACAACCCCTCCCCCAGCCCATCTCAACTCCCCAACTCCCTGGCCAGCCTCTCCCGACCAAACAGTACACGTCCCCATCGTCCTCATCCGAAAACACACGAGGTATACCCACTGCTCAGAGGGCACCCAGGGACAGTGAGAACCAGGATGGCAGGAGGGCCTTGGCAGGCCTACTGCTGTGGCTCCCCTGAGTCTAAGATGCTCATCTCTAACTCTTTTCCTACACCCTCCAACCCCCTGGGCCCCCACGTTCCCAACTCACACATCCCAGGGTGCCGACCTTTGCCTCTCTCTATCCTCTACCCCTAACTTAGCCTCATCACCTCCATCACCTTCATGAGCCCCAATGGCTTCTACTCTGCTCTGGGCTGCAGGATCCCCTCTCTGTCCTCCTCACCTGTCTGTCTACATGCCTCCAAGTGCTGCAGGCCAAGCCATTCCCAGCCCCTCCTCTCCACCTGACTCTGTGCTGCCTTAAGGCCAGGCCTGTCCAATGCGCCCTGCTTGGCACACACTAGCCCGCCTCTCTGACAATCATCCCTACCTCAGCCACCACAAATCCATGGTTTAGTGGCTCAAGCTAGCAGGTTTACAGCTCCTGCTTGACTGCACCCCCCTCCTCCTAAACCAAACTCATCATCAAATTCCTATTCCTCAGAACGTCTGCAGGTCCATCCCACCCCTCCACCCCACTGGCCCATTGCTCTCTTCTTCCTCACTGCCACGCTGTGTGGTTCTCCTCAGCCTCTCTTGATAGGGCTCCTCTTCCCCCTAAGCCTCTCTCTGCAGAATCATGTCAGTTTCTCCCACTAGCACGCCACGGTGACTTCCTACTGTGTTCACCTGGGCACCAGATTCCTCACATTTATGTAGTGCTCATATGTATGCATACCACACACACACACACACACACACACACACACACACACACACACGCTTGCATGCACACACACTTGCACAAGCATGCACGCACACACATACCCCTTAGCCTTTGCTTCTTGGTGATGTGACTACCTGGCCACCTTCCCTTGTCCCCTTCTAGCTGTCCCATGGAGAAAATGTCACTGGACATGCCACATGCTCAGGACAGCACTGCCCTCTTCGTGGCCACAAGCTTTGTAAGG
GF3 -1 -1 1 GTAGCTGTGGCTTCGAATCCATCTCAGAGC
GF4 -1 -1 1 CACCGAGGTAGCTGTGGCTTCGAATCCATC
EX52 -1 -1 1 CTCTCTCTGCCCCTCTGTTCCAGCCGTGTG
EX32 -1 -1 1 GCCGTACTGGTCGCAGGTATAGTG
GR3 -1 -1 1 GTCGTACTCTAGTTCGCAATGGCGACCTC
GR4 -1 -1 1 CGTACTCTAGTTCGCAATGGCGAC
Comments:
Created
Target: 2803Ensembl ENSMUSG00000002799 -- 114158283 -- 114158693 ENSMUSE00000115088 -- ENSMUSE00000115111
creating candidate regions
attempting to insert candidate regions into db
done inserting candidate regions
running aos on us and ds
running aos on gaps
finished running aos
AOS Produced 8 oligo candidates from u/d regions
AOS Produced 14 oligo candidates altogether
inserted results of aos runs
Aligned target to NCBIM37 assembly: chr: 12, start 114158283: end 114158693
Found 10 RP24 black6 bacs on NCBIM36
Found enough RP24 bacs: not looking for RP23
Entered all non-repetitive oligos
Sequence count unchanged by blasting
finished aligning oligos to bac
ACCEPT (0) gap pair G5:12:114164193:114165192_537 G3:12:114153783:114154782_483
ACCEPT (0) gap pair G5:12:114164193:114165192_537 G3:12:114153783:114154782_517
ACCEPT (0) gap pair G5:12:114164193:114165192_537 G3:12:114153783:114154782_511
ACCEPT (0) gap pair G5:12:114164193:114165192_189 G3:12:114153783:114154782_483
ACCEPT (0) gap pair G5:12:114164193:114165192_189 G3:12:114153783:114154782_517
ACCEPT (0) gap pair G5:12:114164193:114165192_189 G3:12:114153783:114154782_511
ACCEPT (0) gap pair G5:12:114164193:114165192_552 G3:12:114153783:114154782_483
ACCEPT (0) gap pair G5:12:114164193:114165192_552 G3:12:114153783:114154782_517
ACCEPT (0) gap pair G5:12:114164193:114165192_552 G3:12:114153783:114154782_511
DESIGN COMPLETE
U-type: U1
D-type: D1
Creating display features: mapping to reference assembly
Created display features
Inserted short and long range genomic sequence arms

webmaster@sanger.ac.uk

Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SA, UK  Tel:+44 (0)1223 834244