High Throughput Gene Targeting: Create Design

This custom vector design tool is provided by the EUCOMM consortium as a service to the research community. When using this tool, the user agrees not to submit more than five designs per day for creation without prior discussion with the High Throughput Gene Targeting Group at the Sanger Institute.

Design Type Oligo Select Method Artificial Intron Design
5' retrieval block size U block size Min 5' spacer Critical Exon Min 3' spacer D block size 3' retrieval block size
 
       
Subtype Domain Disrupted
Gene Build Gene
Start Exon End Exon
Target Start Target End
Primer Length Design Comment
Created by dk3
Valid After Annotation
not done
oligos on fwd strand oligos as ordered View gene and design in Ensembl UCSC BLAT recombineering primers
Design ID: 189131
Chr: X
Strand: 1
Status: Ordered
BACs: RP24-87C20 : RP24-89A22 : RP24-360N3 : RP23-129E14 : RP23-453F15 : RP23-126J21 : RP23-68F13 : RP23-112F3 : RP23-448D15 : RP23-39I7 : RP23-118N3 : RP23-313F8 : RP23-98F1 :
Instance: Plate 154: Well C11: BACs RP23-129E14 RP24-87C20 RP24-89A22 RP24-360N3
Oligos on GRCm38:
Type Start End Length Seq
G5 159547410 159547459 50 TTACTTGAGTTTAGGCCCTCCCATCTACATAAAAGCCAGGTATAATGATA
U5 159552761 159552810 50 ATTTTAAGGCCAGTCTGCCCATTATTCTAGACATCAAAAGTTTTACTTCT
U3 159552888 159552937 50 ATGTAAGTATAAATTCAACTTCCATCATTTCAGTTAACTTCAAATTATTC
D5 159555757 159555806 50 TTTAAGTAGGTCATAAATTAGGAAATCTGTTGGAGAGAGTACCAGACATT
D3 159555909 159555958 50 AATGACAGACATTAAAAAGCCTAATAAAGGAGGAAGAAGCAACAAAAACA
G3 159560061 159560110 50 TTTTTAAAATGTTTCAGTTATTCAGTGGTCATTACAGGAAGCTTGTTCTA
Oligos:
Type Start End Length Seq
D5_D3 155993739 155993840 102 CACTCAAGACTAGTTTTTCTTTTTATGTATTTTCAATAACTTCCTGCTTTTAAATGCTAGTAGATTACAAAAAATTAGTCAGAAAATGATCAGACTACTCCA
G5 155985342 155985391 50 TTACTTGAGTTTAGGCCCTCCCATCTACATAAAAGCCAGGTATAATGATA
U5 155990693 155990742 50 ATTTTAAGGCCAGTCTGCCCATTATTCTAGACATCAAAAGTTTTACTTCT
U3 155990820 155990869 50 ATGTAAGTATAAATTCAACTTCCATCATTTCAGTTAACTTCAAATTATTC
D5 155993689 155993738 50 TTTAAGTAGGTCATAAATTAGGAAATCTGTTGGAGAGAGTACCAGACATT
D3 155993841 155993890 50 AATGACAGACATTAAAAAGCCTAATAAAGGAGGAAGAAGCAACAAAAACA
G3 155997993 155998042 50 TTTTTAAAATGTTTCAGTTATTCAGTGGTCATTACAGGAAGCTTGTTCTA
G5_U5 155985342 155990742 5401 TTACTTGAGTTTAGGCCCTCCCATCTACATAAAAGCCAGGTATAATGATACATGTTAGGAAAACCAGAAATGGGGGGAAGATAACCAAGACATGGATTTCAGCAGCTAGATGGCTAGTCAGTCTAGATGAAAAGGTGCACTCCAGGACAGTTAGAGACCTTACTGTAGAAAGCGAGAGAGAGAAGACATCACCTGAGGTCAGGCCCTGACTCATTCCACACTCATACACACAAAAATGGAATTGATGTTTAAATCCATGCTAACAAACAAGGCAAAAATACCCTCAGTGTTACTCCAGAATCACTTTTCCTCAACAGGTATCTTTAAGATAGTGGTGGCAGGAGAGAGTGAAAGCCTCGGTTGGTCCCTGCACTACTCAGATACAGCTGCTTTGAAAATGCTGCAGAAAGGCAATTTCAGGACAAGTCAGGGGTGGATAGCACGGCTTATAGATTTATAGACCATAAAATGTTCATAGGGGTGAGGTGGGCTTTTCACAGCTGCAAAGATGTTGTCAGTCTGGAGTAGTTTTTTCCTGTTTTTTTGTTTGTTTATATATACTGTTTTATTTTTTAGTATTGGTGTGATAGCAAAACTAGAGATATGTACATATCTCAGAAGTAGCCTAAGAGTATAAATAAAAACAAATCTAAACAATGACAAACATACTGGGTGTGATTAATTCTAGCACTTAGTGGTACAAAGGCAAGTTGAACTTACAGAAGAATTAAGCTTTCTCTTGGCAATCACCACGTTTTAAAGCATACTACAGGCACTTTTTAAAAAATAAACAAACAAACAAACATGCTAATGCTGTATTTCTTTGCAGTGTAAAAAGTGGATCAGGCAGCTCATATGCTAAAGGATGGCACGGTCAAGATCCAGATCCCCCAGGTGGAAACAAAGGTGAGGAGTCCCATGCTTCTCCTAGTTAGCTCGGATTTAGAAATCACTGTTACTGCTCAAGCCTCCATAAGCTCACTGGACCTGGCTGCTCATAGTACTCGATTAATCATGGTAATGGTAGTATTTGTAGATTTGAGGAGCTGATAAATTTGTTTAATTGGGGCTAGAATTACTTTATAATAAAAAGGAATGCAGTGACCACATCCAGAATGAGAAATGTCTTTGAGGTTACTTTTTTAAGCTATTAGGAGGTTTACAACTTTTAGTGTATGTTTTGTTTAATTTTTTTCAAGAAATTTAATCAGAAAATGTTTAATTTTTTTCAAGAAATTTAATCAGAAAATAAAGTATTTCCTAGCTTCTTGGCAAAAAATCAGTTTTGAATAGCTCAATTGTAGTTCAACTCTCATTTGTTTTCTTTGCTAGGAGGTATCAGTACTATAGTTTCCATAATTAGATTAGAATAGTTCAACCAGTTTATTGTACATTAGATGCCTCCCAGTTCTGGGACAACAAGAGTGAGTATCCCATCTTCCATGGCCTTAGCAAGCACACAGACTGGCTACTCTGATACAGTGGGGAAAGCGCTGTGCTTCTGACAGGGGCAAAGCTCTCTGCATCTCTAGGGAGAGAATTCATTCTGTTTTACAACCAGTAAGGTTCAGACTGACATAAAGGACTATTATTACATACAGGAAAGATAAACGATGGTTTTTATGTTAATATAACTTGTTCCAATAATAGAGTGAATCATCAGTCAGTAATTTAGTTTTCATTTTATAAATGTCACAAAATCATGTTCAATTTGGGAGAAGTTTCAAAAAGAAAAGAAACTGTAAAGACAAAAAGACTATATAACAAGGAAGATAACACAGAGTGTGCCTTCTTTTAGCCTTCTTTTAGTTTTCTTTTTTTTCCATTTTTTATTAGGTATTTAGCTCATTTACATTTTATCCTTCTTTTAGTATGACTATTAGAGTAATGGCCTCAGAGACTCTGCCAATGCTTAGTGCCTAGTTTTCTAATTACTTATAGGTTTTTGGTTTTTTTGTTGTTGTTAAGAACTACAAAGAGTTTGGTACTTTGTTCCTACTTAGAAGTCAATATACTACTTTGCTACAAGACACTTCCATGTTAGAGACATTTTCTCTACCTTCTAAGAACCCCTGAGGGCCAGTGCTCTAGAGTGGCTCTGGGTAGATGATGCAAATTTGTCACAGGTTCTGGGGTTTTGACACAGCTGAGGAACTTGAGTCACTTGGAGTAAGCATTATCTTATTATTATGGGCAGCAAACAAGTAAGCTCTCTCTCTCTATCCATGAGGGAGACCTGATCTCTGTTTCCAAGGCTGTTTCCTGGGGAACCAAAGTTGCCAGTGCCCCCACTCATAAGGCTAGAGAATTATCTCCTAACCTTTAGGAGAATTGGAAATGCTAATAACCTTTATAACAAATTTTTCTGGAAGGGAGTACTACATAATAAGATATAAAACAATGTCAGCAGTTTTAAATGTGAATTAAGGGCTAAAGTTAGATCTTGAGTGTTTCATCCTGTCTGGGAAACTTGTGCCTCTGACTCCCGGGTTCTCTGCTTAGCAGTGAAAAGAGATGAAATCTTCAGGAATTCCTCAGAGACTTGAGTTGTTTCCCCCCTGGGATGAGATAAACCATGAAGATGGCAGAGTTTCTGCTTCTGATAAGTAATATTTGCCAGTATGTCTAGCTTGGCAACTCTAGGCGACAATATTGCCAAATCCATGTAAATGTCCTAATGGGTACTGGAGAAGATAGATGTGTTTCCTTTTTGTGTGGAAGACACACATTTGTCCTTAGAAAAAAAGACTTATTCATAATTGAAGCTTCTTAGAGCAGGTAATTTTATTTTATTTTTTCGAGACAGAGTTTCTCTGTATAGCCCTGGCTGTCCTGGAACTCACTCTGTAGACCAGGCTGCCCTTGAACTCAGAAATCCGCCTGCCTCTGCCTCCCGAGTGCAGATAAATTTTAAAATGGCCAGGGTATTCTTTTTTTACTGATTTGGAGCCATTAAGCCCTAAAGGAGGAGATGGAAAATTGGACAGGTCACATGGGGGTTCTTACTCAGATGCAAAAGTGAGCTTCTTCTTTTTCTTTTTCCCTTTGAGGCAGGGTTTCAGTGGCTGACCTGGTATTTAGTATATAGACTACGCTAGATTCAAACTAAGAGATCTGTCTGCCTGTGCCTCACAAGTACCAGGAACAAAGGTGCGAGTCACCATAGCCCGCCCCTTCCTTACTTTTAAGGCTGAGTAACTCAGAGAGTTTTCCATGGATGTGGGAGTCTTCTCAGTAGGAATACAAGTCTACAATTTGGCGATATTAAGTTACAGAAACAATAGATGCAGAAGAGCTATATAATACTGTCCCCTAGAGAGCATTATAGTTGCATTAAAACATACTTTGACTAGAGTCCTAAGTTATTTCAACAGCACATATTTCAGTTGATATGTAAGGGAGGAGATTTTGGAAAGAATAGCAGTTTATGTTAGAAGTATTTATGGAGGGATAGGCATAGTAGTGCACACTTGTATTCCCAGCATTTTATTGGTGGAGGCAAAAAGATTGTGTTAAGTATAAGGTCAGACTTGTCAACAGATATATTCCCAGACAAACCAGTTTGGGTTGTAAAGTGGGACTCTCTTATTTTTCTTAGAAAAAAACCCCTGTTGTATGGAGGCATAGTATAGAAATTGATGGCCTATGTCTCTCTCATTTATTTCTTCCCTGCCCATGGTACCTGGTAAGCGTCTCCTTTGGTAAAGCCTCGAGGGAGAGAACAGTCAGTTGGAAGCACTATAAAAACATTTTTGGAGTTTGGATTGTAGCATCATTGTCTTAGGATGTAATTTCAGAGGTCATCTTTAGTTTTCTTCACACTTTCAACATATTTTTAAAATTTATATATTTACATCGATTCTGCCCCCCTCACAGAGAGCATTCTCCCATCCCCTCCCCTTGTGCATATTTTTTCTAACTTTACTCATGCTTGTTTCTCAGTTAGCTATTGAACCTGAGGTGAGCTTTTCTTGATTGGCACTTTGAAGGTACTACATCTCCTTTTGCTAGAACTTGCTATCAGTAGTCTTTCAAAAACAAGGTTCTGCTTTCTACCTGGTCTGCTCCTCCTCTAATATGATATGTATATTTAACCCATTTTGATGTGTTCATAGAATACATCAGTAAGGATGACAAGAGTATGGTTGTCAGGTAGGACAAAAGAATCATTAACCCATCTCCCTCACACCGGTATACAATTCCAAGTACATATAAAACAAATTCCTAGATTAACCTTGAGTGGGATAGTAGTAGAATTCTAGCAAAGTATTTTAGGTAGGTCACACTAAAACAGTTAATTGTCTCAAAGTGAACTAAACTTCTCTCTGCTTGTTTACATAGGTCATTATCGCCACAATCTAGAAATTTTGAATACCATGAGGAAAGACATTTCCATGGGCACTATGACCCTGAATATAGACATGATCAACAAAGACCCTTTACTTGGAGAATGGATGATGAAAAACATGGACAAAATAAACCAAGGATTCCCCCTCGTGTGAATTCGTATCATCGGTCTTATGTAAATAGATCACCTTCTCCAAATGTAAAACCTGTTGAAAAATTTGATACATATAAGCCTCACCAAGAATATTTTCCTGGCAGAGGAGATGATGACAGACGATCTCAGTATATGCCCACATACACAGAAAGTGCAGCAACCTACATGGAGCACGAAAGGGATTGTTATATCCCTACAGTGCAAGGAAGGTATACTCCTGATGATCACAGAGGTAGAGGTAGAGGAAGTGGGAGAGGAGAGAAGCCACCTCAGATGTCACTGGGGAAGCCACCTAAGATGTCACTGGGGAAGCCACCTCAGATGTCACTGGCAGATTCCTTGAGATTTAAAGAGAAATGGCATGAAGATGAATTGAGACACCAGAGGGTACAAGAAGAAAGCTACCCTCAGTCACCCAGAAGAGGCTCAGAAGACTTTGGCACAAGGAACCCTTTTCAAAAGAGGTACAGGAAATCATTAAGTCTGGGGAATTTGGCATAAAGCCTCCAGTAATAAAGTTACTTTTACGTTGAATATCATAATTTTTTATCTCAAAAGATAAAATAATTTATATTTTGAGTAATTTATGTGGATAGCTAGAATGTAGTTTTGTTTGTTTGTTTGGTTGGTTGGTTGTTTTTTGAGAGGGGGTTTTTCCTGTATAGCCCTGGCTGTCCTGGAACTCACTCTGTAGACCAGGCTGGCCTTGAACTTAGAAATATGTTTGCCTCTGCCTCTGGAGTGCTGGGATTAAAGGTGTGCTCCAGAATGTTTTTAAAAGATGTTGCTTTTAAATTTCCATGCCCCTCTTAATGAGTTCACATGAGGTGGTCTTGCCGTTGCATGATGTATTTTAAGGCCAGTCTGCCCATTATTCTAGACATCAAAAGTTTTACTTCT
U3_D5 155990820 155993738 2919 ATGTAAGTATAAATTCAACTTCCATCATTTCAGTTAACTTCAAATTATTCTTTCCAAATTAAAACAATATACCAAACAGGACAAGTGATATATTTAAATCCAAGACTTCTATTAAGTTATAAATGAGTAAATCATGAAATAAAAAAAATTTTTTTTGTGGTTTTTCGAGACAGGGTTTCTCTATAGCCCTGGCTGTCCTGGAACTCACTTTGTAGACCAGGTTGGCCTCGAACTCAGAAATCCACCTGCCTCTGCCTCCCAAGTGCTGGGATTAAAGGCGTGCGCTACCACGCCCGGCTACATGGGGTCTTTTATGGTACAAACTCTGCCACATAAGCTTCTTTATGTCATTACAGGTATCCCGAGGATCATGATTTCAGAAAGTATGGCTACACATCAAAAAGACCTACAGATGCAGCAAGGTATGAAAATAGAGATCCAGCCAGAATCCCAAAGTGGAAGCCTGAGCATTCTTTTCTACCTTTCCAAGAGAAGAAAGAAGAGTGGAGCTTTGGAGCCCAAGGTCACAGATATACTGAGAGAGAGTACCCAGAGAGAAGCTCGACAACCAGAGTATCCTACGACTACCGTCACAAACATCATAAGCTCTCAGAGAGCGAGCAGGACTTTCCTGATGGCAGATTTCACAAGCACTTAAAGGAAGAAGACAGAAAATACAGTTCTATAAAAGCTCCTGCAAATAGAGAGTTAGATTGTTTCAGTACTACAAGAGGAAGAGAAATTGAGAATGAGCAAATCAATGGACCTTTTTATCTCTACAACAAAAACTCTGTTTCCTATAATCATACAAATATAAAGGATGCTGATTTGGAGCCTTGCAATGACAAATGGAAGAAAAAAATTAGTAAAGAAGATTGCAGAAAAGAGAATGCATCTTTTAGTAAACAGTTTGATACAAGCCCAAAACCTGAAGAGAAATGCTATTCACTTATCAAGAAGAAACCACTTTCTGTCAAAGTAGACAGAAACAAGACAGACACATTTAGGTATTAGCTTTTTAAGAAATATTAATAGATTTTTACACCTTAATTTGCAGCTTCCAAGATGAAGTTTATATTATTGGCTAGAGTATATTACATGTTCAAAAGATTACCAATAATTTCTTCCAAAGTCCTGGAATGAAGATAAATTATGAAGTTAGTAATAGGTGGTGATCTTGTGTCTTCTGGTTCCCATATCTTATCTCCAAGTAATTCTTGGGTATGGGCATTTCAAGGAATTGGTAATCTTTAAGAAGTTATATGTTTTTATACTGCCAGGTTTTTGTTTGTCTTTTTAAATCCAGGGATATACTAAGGAGAATTCAGCTTTTGTTGTTTTTTTGGTGTTTTGTTTTGTTTCGTTTTGAGATAGGGTCTCACTATGTAGCTCTGGCTGTCCCCTATGTAGACCAGGCTGGCCTCAAACTCACAAAGATCCATCTGCTGCTGCCTCCTGAGTGCTGGGATTAGAGGCATGAGACACTCACCAGGCCAGCATCTATTTTTTATGCAGCTTCTCAGGCTGTCCTTTGCTGCTTTTGACATTCATAGACTCTTTTAGCAGGAAGAGATCTTAGCAGGTTCTTATTCTGTAGAGAAAAGTTAGGTTTGAGAAACGAATAGAGCTCAAATCCTCATGCCTTCTTGGGGTCCCAGGAGACATGATTTGATGTAATCCCTACTGTGATTTCAGCATGACTTTAGTTTGACTAGATTATTCTTCAAGATAGAAGGAATGAGACTGTAGTGTTTCTGTATTTGGCTGATGGAAGAATGCTAGTGCACATGTGCCATGGCAGGTATGTAGCGGTCAGAGGACCTCTTTTGGGGGACAATTTTAGGAGTTGTTTTCTTTCCTTCCACCATGGGTTCTAGGAACCAGACTTGCATTGCAGGTTCTTTCTTGTACCTGCTAAACTGTCTTGCTGTTCCACAGTTAATTTCTAAATAGATTTAGTTTCAAAACATTATTCTAAGCTTCTCATTGCTTTTGGTGAGAATTTTTTTTAAAGATTTATTTATTTATTTCATTTATATGAGTACACTGTAGCTGATTTTAGACACACCAGAAGAGGCTATCAGATCCCATTTACAGATGGTTGTGAGCCACCATGTGGTTGCTGGGAATTGAACTCAGGTCCTCTGGAAGAGCAGTCAGTGCTCTTAACCACTGAGCCATCTCTCCAGCCCTTGGTGAAAATTTTAATAGTTAAAATTTTAGGTTTCGTAATAGCTTTTAAAGTATGGTGGTATTTCAGAGTGGCTGATTAAAACGTTTTGACAATAATAAAGTAGAAAATAGTCTGATTATTTTTTTATATTAGGTGACTTTAATGCCTTATGTGTTTGAAGGTAAAATTCACTTAGAATTGTAATTATTGTTATTTGAAAAGAGCTCAGAACCATTTATCTATACTTATTTTCCATTTGTGGTTTATTAGTTTTATAACATGTAATTTTAGTGCCTAAATTATGGCAGAATAATTAAATCTTTTTAATATTTAGCTATCTTAGCATTAACAAATTCCTTCCTTGGCAAAATAGCAAAAATTACAAATTTAATTAAATATTTGAAATTATTTTAGGTCTACTTCTAGATATTCTGCAGAGAGACAGATATCACATGATTTGGTTGCTATTGGCAAAACAAGTGACAATTTTCATCCAGTATTTCAACATCTTGACTCGACTCAGAATCCTGAAAATAAACCTACTGAAGAATTTGCTCAGGAAATCATAACACTAATCCACAAAGTTAAAGGTTGGTATGTTTTACACAAACATTAAGTATAGCACAAAAATAATGTACCAACTTTTCCCAAGATACAAGTACCTTTAATGTAGCTTAATTGTAATTAATATTCCATTTTAAGTAGGTCATAAATTAGGAAATCTGTTGGAGAGAGTACCAGACATT
D3_G3 155993841 155998042 4202 AATGACAGACATTAAAAAGCCTAATAAAGGAGGAAGAAGCAACAAAAACAGGTATACGTCCTAGACACTGCAGAAGTCTAGGTTATTTTGTGACATTAGCAACACTTCCCCAAGGCCTTTCTAGGACTTTATGCTATAAGCTTGTTCATGTATAATCAGTTGATGATTCCATTCTTTATGAAATCAAAAAGCTAAAGGAGGGCTTTAAAGAGTTGTATTGCTTCTCATAAGTGTCCATTGGAAAATCAGTGATGTAAAACAACTCTTCCTAGTAGTACTGCATAAATTATTATAAGCAAGAGATTCTTAAGAATGTCAAATTTTTATTTGCTTTAATTTTTACCTTAATAAAACATTTTTGATTTTTTGAGACAGGGTTTCTCTGTATAGTCATAGCTATTGTGCAACTTCCTCTGTAGAACAGGCTGGCTTGGAACTCAGAACGTAGAGATCTGCCTACCTCTGCCTCCTAAGTTCTGGAATTAAAGGTATGCATCACCACCACCTGACTATGAAACATATTTTTAAAATAATGATTTGGGCTGAAGAGATGGCTCAGCAGTTAAGAGTACTGGCCCTAGATTCCGTTCCCAGTACCTCCATGGCTGCTTACAGACTTCTGTAGCTCCAGCTCTAGACCGCTTTTGGACACTTTGGGCACAAGTCACACACTTAGTGCACACACAAAACACTTATGCACATAAGTAACATACATTGAAAAATAATTACTTTCTCTCCTATCCCTTAAGTGAAGGGAACCAGGTAGATGGGAGCTAAAGGTTTAGTTCAATATTAAAGCTCTTTTCCAAGAATGGGTAAGGCCCTGAGTTTGATCCCCTAAACCTTAATTTTGAATATGAAAAAATACAGTTTGTCAGAAACCGTTTACCCTCTCAACTCTACCTCTTTTTATCCAAAGAGTATAGTTTTCAGAAAGTATGGTGGTAGTACAGAAAAACAAGAGAGTGTCCCAAAATGGGACTAGTGAAATAGGAGAGAAGATTGCTTGTATAACATTTTGATGTATTCTTTCTGTACTACTATTAAGAGCTTGTAGCATAGCTGATTTTAGAATGTCTTTATGAGCTGAAGTTAATGCAAAAATGACGTGGTGTTGGAATGTACTCTGTGGTATTTAAGCATAACTTAATTCAACATTCATTCAGAGATTAGTGTGATTAAATTGTTAATTGATTTAATTTTCACTGTTGAACTATAGAGTATCTTCCAAACTTCCTAGAGTATGGCCTTACCATGAAGAAGAATGATTCTCACTTTAACAATTTCTTCTAGATAAGAAAGCAAATGTGGCAGATAGGAAGAAAATCCTTGAATTCATAAGTCAACTCTTGTTTGGGTTTGGGGAGGCATGTGAGCATTATAAGTTAATATACAAAGAGTGTGGGCCATATTTCTTTTCAAAGGAGAACAGTTTGGATTATTTTGATGGTCCCTTCTTGATGTTGAGTTTTATAGAATCTTTTAAGGGCATTCAGTTTCACATTGACATGGAACTATTTGTTTCCTTTTTTAGCAGATAGTTTTGTAACACCTGATATTACTCTAAATGAACGTTTCTCAAGAATAAAAAACAGACAGGATGCAGATTTCAATCAAACGAAATCAAATTCAGATCCAGAATTTCACAGGTAATGATTAATTACTGTCTTTTCACTTACCTCAGAAGAATAGTCCAGCTTTCTGAGCTCGCTTTCCTTCTGAGCTTGGTATAGAACCTAGAAGTGCACTTTGTACGTACCAAAAGCAGTCTGAGCAGCTGCTGGACCCATACACAGTGCTAACTTACCACTGTTTGAAAAGAAAGATTCACTTGCTCTCATTCTGCTATGTCTGTAGTAGCTGTCTACTGAAGGGAATGCTGGAAAAGGTCAGCCATTGAAATCAGGGCTTACTTTAAGTGGTCACAAATGATTGTTCTGAGGTCTGATGAAAACATGCATGCCTTCTGTCGGTACTTGTCTGAGCAGAGGGTGCACCCTGTATGCAGTACTGAGATGAATCAATGTTATAATTTTATCCATCACCAAAATTGAGTTTGAGGTCACACTAGTGATTGGAGAACCACCAAGACTTCCCTACAATACACCCATAGGGTATGTATGGCTTAGTAGACTGCCATGTAGGTGAAAGCCTATCATGGCGTGGTGGCACACGGCATTAGTCCCAGCACTTGGGAAACAGGCAGGCAGATACCTGAATTTAAGGGAGTGAGTTTCAAAACAGCCAGGGCTACATTAGAAAGACCCTATCTTAAAAGACAAAAGAAATGAAAAGCTACCTGACAGCAGGTTGTTTTGGCTTTTTCTAAGACCTACTGGTTTATTTCTAATTCTATCCTGTAGTAAAAGAATCAGTGTATAACACAATTAGCATAATTATTTAATTATGTGCCTTTATTATTTTAGGCGAATAGATATGTCTTTGGATGATTTTCAGAATAAATATACGATGGTATATGAACCAGATAAGGTAAGTGAGTACAATTATTATTGCTATAGTAGTGGGAAAGGAGTTAAAGGTCTATAAAGAAAGGATGACATTCAGGAATATAAATTGAAAAAGTTCTCCAAGTGACTGATGGCAGTCCAGGATGGAGTGAGATGCTGAAAAGGACAAACTTTTTCTTTGGGAGGCATGGTTAGTAAGCATAACAACTTTGAAAAGTTGATTTAAAATTACATTGAATACTCATCCCCAAACTTCTCAGAGTAAAGCTTATAGAAAATATGGTTGATAGCCAGCCATTTTGCAAATCTGGCATGTGGGATATACTTTTAATTGTATGTGGAAGCAATGCAAAGGAACTGTGGCATTTGGTGCTGCCTATCTGTTTGCTGTAGAATTTAGGAAAGATTCTGTGGAATAAAAACTAGCAAAATAATGAAGCTAATACTAAATTTTTTTCATTATCATTATATATGTTTTCTACCCAATACTTCCCCTCCCACTCTCTATTTCTTTCCTGACTAGAAAGACTTCTATGACTGATCAGGTTAGAAAACAAGTCTTTAAAAGCATGTCAACTTCTAAATGTATCATTAATTTTTCCTTTGAGAATTTTTCTGTAGTGAAGAGATTTTAATTTATTTCTGATAGACTATATAAATAATTTTTATTTATGAAATAAAGATTCGATAAATATAGGTAGCTTAGTTTATTGAATAATGCTTTTGTAACATTTCTAGTTATAGTTGATCTCCAGGAAATTTGAAGACTTAAAAAAATTCATAATCCCAGTTTGGCATGGTACATTTTAACAGTCTTTCAGATGCAATTCAGTATACCAATAATCCATAGCATTTCTTTTATGTAAAAGTTCTAAATTCTCCCCATGGTCCTTTATAATTGATGTTTTTAAGTTTTAAAATTTTTAGTAAATGTTTTTCTATATTGACTTCATAATTTATTAATTTTTATGGCTGTATAGTTTTGTTTGACTTATTTGCCATAACATCCTGCATCATTCTTTTTTCCCCTTAAATTATTTTCACATTTAAGTTGTTTCATTTTTTGTTATTTTCAGTATTTTTAAAGAGGCAACTTTTTGGGATAAAATCTTGGAAGTAGGATTCTTGGATTAGTATAAGAGCTTTTCTGATTCTGAACCATGGTGGCCCACACCCTTAACCCTATAGTTGGGAGGCAGAAGCTGACAAATTTCTGTGGTTCAAGACTAGCCTGGTCTACATAGTTATGGCCAGGGTAGCCAAAGCTACACATAGAAAAACCCTGTCTCCAAAAACAAACAAAATAGAACTTCAGTTGTGTCTCAAAATACTTTTATCAGTTTATACTACCATTAGCTGCATGGGTATAAAATAATTAAGGACTTTAAGTTTCTTTTTAGAAATTGTCTTTGTGCTACTAACAATAATGTGAATAATTTGTCTTCTGTCAAAATTCCTCAGACTCTGGTCAAAGTAATAGAACCAAATGATCTACGACATGACATTGAGAGAAGGAGAAAAGAGCGATTACAGAATGAAGATGAGAATATTTTTCACATGGCTAGTCCTACAGAGAGGTAATCAGTAAATGAAAAACATCCTGCTATCTGGGAGCTTTTGGTTTTAGGAGCTTTTACATTTTTTGTGCTTAATTTTTGCCCGATTGTTCGATCTGTTTTGTGTGTTTTTAAAATGTTTCAGTTATTCAGTGGTCATTACAGGAAGCTTGTTCTA
U5_15 155975694 155990742 15049 TATATGTATGTATATATATGCATGTTCATGGCATAGCATGTATGTGGAAGAAAGAAAGACTTGTAGGCTCTTTAAAAAACACATGGGTTCTAGAGATCCAACTTAAGTCATTGTGCTTATATGGCAAGAAGTTTTACCTACTGAGGTATCTCCCCAGCCTGTAAGCACATAAGTATTTTTGTTTTAGTGGCCTATCTTTGTATTTGGCTCTTTCTATTGTGTTTACTTTTCAAATACTTTACCCCTTGTGATCAAAGTAAGAATGATAAGCAAAAGTGGAGTGCTGTGTGCACTTAATGACTCTTCCTTACTGAAGAACTGGTGAGAAGGTAACACACGCTCTGTGACAATGAGAATAATCCATGCCTGGTCTCCTCACCTCTGCTTGCTTTCCCCTTTCTTCTGAGCTCCTTACTGATTGCCCTCTTATTCCTGTGCTCTTTTGCTGCAAAGGGTTTCCTGGGGAATTTTTATTCTTTGAATTTGTAAATACTTGATTTGCATTTAGTGTGGAATCTTTTTGCATAATGTACCCATCTTAAGTGTAGAGTTCAGCATTTTTAGTATTTTGATACAATTGTGCAAACATGATCATAAGTCTAATTCCAGCACAGTTCTTCCCCCCCAAACGTTCTGTTGGGTGTGGTGCTAGATGCCTGGAATCCCAGGATTGGGCTATATATGGAGGGAGGGTCAGGAGATGAGGGTCATCATCCTCACAGCCTGGTGTACAGAGTGAGTTCCAGGACTACACAGAAATGTTGTCTGAAAAAAAGAAAAAAAAAAACAAAAACAAACCAAAAAGCCAGCTCTGCATTTTACACAGATCAGTTAATTCATTTGTCTTTTCCACTATCCACCAAACAGCTTTTAGATTAGAATTGGTATTTTGCAATATCGTGCTCTAACATCATATAAGACTATTAATAAGATCTTTCTTTAACTCAGTACTCAGGAAAAAAGTCTGACTTGGAGGCCTCTTTTATTTAGTAGGCTCAGAGATGAGGCTTTTTACTGCTGCCCAAAGTGGTCTGTGCTGTTTCAGGCTGCCTGCTTAAGGGAAGGCTCCTGGTAGGTACACACAGTTGGGGATAAACACTTGATGTTGTACAGGAACCTTCTGAATGCCTAGGAGAAGGTCCTCCCAGCTCAACTTAGACTTTGATGGCTTGCTCCTCCATCCTGGCCATGCTGTTTTCAGGTTTAGCCTCATGAAGGCCTCAGGTTTGTGAATCTTGCTGTGGACATACTTCATCTGGGCAATTTCTTTCTTTTTTTTTTTAATTAGGTATTTTCCTCGTTTACATTTTCAATGCTATCCCAAAGGTTCCCCATACCCACCCCCCATCTGGGCAATTTCAAGTGAATATACTGTACCTCTTTATTGGCCACATGGGACAAGTCTCCATGAATCGTGTCCAGGGCCTCAGTCTGGCAGGCAAACAGGCCTGTGCTATTGCAGCACCAGCATGTTGCAGCCTCGTCTGTCCTTTGGTCCTCAGGGGGTCTCCCATATTCCAGTGCACATGATTGCTGCTGTAGCTCCATGATATATGACCATATTTCCAACTCCAGATTGGTATCCAGCAGCCTGGCCAGTAGAATGGTGGTGAGCCTCCAGCCCTCTGGCTGATCATGACCTGTTTCAGCAGCTTAGCTTCCCTTGTTAGAATTCTTCACAGCATAACATTTCAAGTTTGATGAATCCTAATTAATTTTTTCTTTTGTTGTTTTTATTTTTAGTGCCATATTTTAGAAACTATTGCCCTATTCAAGGTCGTAAGGATTATTTATATGTGTTTTAGATTTTGTGTATTTAGTTCTTGAATCCATTTTGTTTGTGTGTGCATGTGTCCATGTGCATGACATTTGGGTTGTAATTGTATATTGGCTGATATAAATTCCTTAGTTCACATTTTCCTCTTTCATTGAGGCTTTCAAGATACTACCTTTATTTTTCTTTGTATTGTGTGTGTGTATTTTGAAACTCTAATTCCATCATTTCTCTCTTCCCTTTCCTCCCCCAACTCCTCCCATGTACCCTTATTGCTCTCAAATTCATGGTCTCTTTTTCTTTAATTGCTGTTACATGTATACATATATATTCCTAAATACATAAATATAATTTGCCTAGCCTTTTGAAGAATTTGGTTGTCATGGAGAGCTAGGATAGCCCCAGGGCCATATGGTTCCAGAAAGATGTGAAAATTCTGCAGGGTTATGGGAAGGATCTGATGAAAAGGGAGTTGCTACAGTCTGCTCTGTCAGCTGAATCAGGGTGTGTTCTGCTAAGGCTGTCATCAGGGTTCTTCTCAGCATCCTCCTGGGAGTAAATGACCCTGCTATCTGGGTGTTTGTGTTCAGAGGTAGCCAGATGATTCACTGCTTCTGGTCTTTTATGTTTTACTCTGAAGCAGTAATACAATTGTATTTATCATCTGTTTCTGACATCTCAGTCAATACCATATTGGTTTTAGTCTGTTATTTCTTTTAAAGCTTTTTTGTCCCTTTTAATCAACATTGCTGGCAAAAGAAATGACATTTAAATAGGATAAATCTTTTCTGCGAAGGCCAGATAGTAAATATTTTATACTTTGTATGCTACGTGTGCATCTCTATTGCTGCCACTTCTTTTAGCACTAACAATTCCTCCTTTTTGTGGTACCAGGGTTAGGATCTATCAATCTCTGTTAGTCAATCTTCCAGGTAATTTTAGTGCACACTAAGATTTGAGAGTCTCAACTCCAAGGTGTGTGTGTTTGTGTGGAAATGGTGAGCTTTTGGGTATGGGCATTTTCAATATTTTGGAGTACTTTCATACTGCTTCCAAGCTACTTATATTTCGGTATATTCTAGCAGTGTATTAGGGCTCCTTTTGTGCCAAACATTTGCCTACTCATTAAAGCAATAACCACTGTTTTGGGTGTGAAATGGTTGGGTTTTTATTTGCATTTCCCAATTACTACTTGATCATATTCATAGGTTACTTGAATTTTGGTTTTGGGATACACTAGTTAGAAATTTTGCCTTTTAAAAATACTAACATGTAAATAAATAAAATATGTTGAAATAATTACTGAACAAACCCAGAATCCCCAAGGAGGAAGGAATTCAGAGTTTTTAAAAAAGGAAATTCAAGGAAGAGCACCGACAATGATGGTCAGACAACTCAGGAAAGCTCAGGTAAACTGAGGCAAGGACATTGAAATAGGAGGAGCAGCATGACCAGATTAGGGAAAACAAGGAGTTTTATATGGACGATTAGGGTAAGTAGAGGAGGAGACCAGAAATTAAAAAAAAAAATGTGTGTGTCATGTATTTAATCATTAATTTATTTATTCACTGTTTTGTGAGACAGGCTTTCTCTTACTATCCTGGAACTCAGTTTGACCATGTTGGTCTTTAACTCACAGAGATCCTCCTGAGTGCTGGGATTAAAGGCATATGCCACCACACCTGAATTTAATATTTCACTAATAGTGAAATGTTTGGATTAATTTGGCTCGGGTTTTGCTTTGCTTGTTATAAATATACATTCTCAGTTTTTCCCATTTTAAATTATTTAAGACTTATTTTATGTGTATGCATGGATGGTTATGCTACACATACATGCCTTGGTGCCAGAAGGGGGCGTTTGTTCCTCTGGAACTGGAGTTACAGCTAGGAATCTAATGAGGGTCTTTTGCAAGAGCAGCCAAAGGTATTAACTGCTAAATGATCCTGCTGCTATTGTGGGTCCTGTCGTCATTGCTGCTGCTGCTGCTGCTGCTGCTGCCACCACCACCTCCACTGCTGCTGCCACTGCCTCTGCCACCGCCACCACCTCCGCTGGGGTGGGGGAAGGGGGTTGCTTGAATTATTTCCTTGCTGGGCTAAGGCAGACTGACAGGTGGAGTCTGGGGCCCGCCAGCCAGCCTCGCCAGTCTCGTGCAATCCCCAGGTCCCAAAAAGAAACAAGGTAGCAAAAAGAAGCGGGAAAGCGCACAAACAGCTGAAGGTTGGAGGAGACTGGGCTCTGGCAGAGCAGGACACATAAACCGCGGTAATTTCTGCTGTTCAGGAGCCCCTTCTTCGTTCTTCCCCGTCCGCCCCCCCATTCTTACGTTTGTTTGTTTATTTGTTTATTTGTTTTTTTCCATTGTTGTGAGCGACGGTTAGGGGCTGAAACTCACGTCTCCAGAGAAGGGTAAGACTTGATTTTGATTTCTTTCTACCTGCTTTCTCCCCTCTTCCACAATTCCTTTCTGTCATTTTCCCCTCCCAGTTGCGGGTCTTCCGCATTCCCCTTGGTGGCCACTGGTTCATGGTCTCAGCGCCTGAGTGGTGGTGGAGTAAAGGCGGCAGCGGACATTTTGTAGATACGTTCGCGCCCTTGCCGAGCTCTGCGCGGCTTTTATAGTCGAGTCCAAATGATTACGTAACAGGAGCTGCGCAGCCTGGTGTGCGGCTTCTTCCCCTCTCCTGCGCCGATGGTGGTTTGGGAAATGTAAGGTTTCTCCCTGCAGAAGAGGCACACATACTCATCTCCCACCCTGCGAACTTCACTTGCAGGGTTCCAAGACTTCAATTTGGCTTGTATTTAAGCTAGTTTAATACTATGTCCAAGCCGGGCGTTGGTGGTGCTCGCCTTTAGTCCCAGCACTTGGGAGGCAGAGGCAGGAGGATTTCTGAGTTCTGAGGCCAGCCTGGTCTACAAAGTGAGCTCCATCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTCAAAAAACAAAACAAAACAAAAACTATGTCCAAGAAAAGTGCTTGGCTGCCGATAGGGAAGAATAACTAGTTCTATCTTCATTTTTATTTTTAATTTAATTTTGAATATTTTGTGAGAGTTTCATTTTGTAGCCTTTGGCTAGCCTTAAATGCACTATTTATAACAGGCTGGCCAGGGCAGTGGTGGCCCATGCCTTTATTTCCAGGAGGTAGAGGCAGGAGGATTTCTGAGTTTAAAACCAGCCTGGTCTACAGAGTGAATTCTAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTCGGAAAACCAAAAAAAAAAAAAAAAAAAAAAAAAAAACCAAACAAACAAACAAAAAAACAAACAAAAAAACCCAACAACAACAAAACCAGGCTGGCCTTGAAATCAAGAACAGTCTTCTTTACCTTCGGAGTGCTGGATTAAAGGCATGTAGTACTCTTTTTTACTTTTGATTTTATGACTGGCTAGTCCTGATTGGCCTGAAACTCCTCTTTGTAAATCAATCTGGTCTCAAACTCATGGAGAAATGCCTGCCTGCCCTAGCCTCCTAAGTGCTTTGGTTAAAGGCCTGTACGTTGTGTGTGGCCACAATTCCATATTAGAACTGCTGTTCCACAGGCTCAAGTGAATCTAAGGGGCAGATGTATTCTTCGGAAAGTCAGATTCAAAGACAACCTTAAAAGTTTTTGCCTTCCCACAGGGGTTGCATATATCAGCTAACCTGAAAATAAGATATTTAGATTACGATTCATAACTAGCAAAATTAGTTATAATATAGCAATGGAATAATTTTATGGTTGGAGGTCATCACAGCATGAGGAACCCTATTAAAGGGTCATATCACTAAGAAGGTTGAGAACCACTGTTCTATCATAAAACAGAAAACAAAGTAAATGTTGGAAAAGAATTAAATAATTCACTTAATTCAAAAGAGGTAATAAAGGGGGCACATCCTGTAAAATGATGCCTGAGGTTAGCCTCTGGTCTTTACATATGTACACATATATAGAACTCTTTAAGCCAGATCTAAAGACTAGTAAGACCAGATTAATATCTTTTTTATAGTTTTTGCTTTTTTAAAGGTTTATTTATTATGTATACAGCCTTCTGCCTGCATGTATGTGTACAGGCTAGAAGAGGGCACCAGATCTCATTATAGATGGTTATATGCCACCATGTGGTTGCTGGGAATTGAACTCTGGACCCCTGGAAGAATAGCCAGTACTCTTAATTTCTGAGCCATCACTCCAGCCCCCAACATCTTTTTTGTTTGTTTGTTTTTTGTTTTGTTTTTGTTTTGTTTTGTTTTGTTTTCGAGACAGGGTTTCTCTGTGTAGCCCTGGCTGTCCTGGAACTCACTCTGTAGACCAGACTGGCCTTGAACCAGCTCCCAATATCTTAAAACATTAATGGTTTCCATACCTGGGTTCTATTTTTGTACTGCTGCAGTGAATTTTTTAATTTATTAGATATTTTCTTCATTTACATTTTAAATGCTATCCCAAAAGTCCCCTATCCCCCCCCCCCGCCTGCTCCCCTACCCACCCACTCCCACTTCTTGGCCCCAGTGTTCCCCTGTACTGGGGCTTATAAAGTTTCCTAGACCAAGGGGCCTCTCTTCCCAATGATGGCCGACTAGGCCATCTTCTGCTACATATGCAGCTAGAGTCATGAGCTCTGGGGGTACTGGTTAGTTCATATTGTTGTTCCACCTATAGGGTTGCAGACCCCTTCAGCTCCTTGGGTGCTTTCTCTAGCTCCTCCATTGGGGGCCCTGTGATCCATCCAATAGCTGACTGTGAACAACCACTTCTGTATTTGCCAGGCCCCAGCATAGCCTCACATGAGACAGCTATATCAGGGTCCTTTCAGCAAAATCTTGCTGCTGTATGCTGCAGTGAATTTTAACCTTAAGACTTTTTTTTTTTTTTTTTTTTGGTTTTCTGAAACAGGGCTTCTCTGTGTAGTCCTGGCTGTCCTGGAACTCACTCTGTAGACCAGGCTGGCCTCGAACTCAGAAATCTGCCTCTCTCTGCCTCCCGAGTGGTGGGATTAAAGGCATGCGCCACCATTGCCTGGCTAACCTTAAGAATGTTAACTTTTAGAAAATGTTATTTTTTATGTGTATGCGTGTTTTGTGTATGTATGTGACTATGCACCACTTGTGCAGTGCTGGATGAAGCCCAAAGAGGGCGTTTGATCTCCTAAAACTAGAGGTAAAGAGGATGCTGAGCATCTATGTGGGGGCTGGGAACTGAACCCAGCTCTGCGGAAAGAGCAGGCAGTGTTCTTAATCACTCAACTATCTCTCTAGCCCCTGAACTTGAAAAATTTAACAACCTTCAATTATGTACATACATACTATATTTAAATTTATCCTTCAGAAAACGTCTTTCCTTGTTGTCAGTTATGCTTATTTAATTGTATAGTAAATTAATCATTTCAGTAATCTTTGTCAGCTGTTATATCCCTTTGCAAAACCCTGGTCTCTGAACTTAACCCTGGAACTTTATTCCATCAATTAGGGGTTTCCTTGCAGTACACTTTGAAGTTCTTGGGAAGAAAATTTAACCCAACCCATATTTCTTTCTGTCCATTTCTGTCAAAAAGTATAGTGTACTTTAATGTATGGCCAAAGTGAACATTTCGAGCAGCTCACTTGATGCTGCGCTTCAGGACTTTTTCTCATAAAAGCAAGAAGCCAGCCAAGTCTTCTTACCATCGAGTCGGCCGAGCACAGACCGAACGACTCTGAACTAGAGTTAACTCTCTAGAAAGCGTTTTCTAACCTAACTTGGACCTTTGTGATATTCTGAAGCTTTCTTGGTTTTGTCTTTCACTTTTCCTTTTCTGTTTTGGAAAAAAATATGGTGTTTTTTTTCATTATTGTTTTTTTTTTAAACTAGGACTAAATCTTGTTTACTGTATAAAATCTTTTTTTTTTGATACTGGTTTTCAAGACAGGATTTTTCTGTGTAGGGCTGTTCTGGGACTCACTCTGTAGACCAGGCTAGCCTTGAACTTTGTCTCTGCCCGCCTCTCCAAGACCTGAGATTAAAGTTGTACACAACTATGCCTGCTATAAAACCTTACCCTAAAATAGTCTTTATTTTGTGTATGCATATGTGTATGCATAGGTTATATGTGCACACATGTACATGTGGAAGCCAGAAGATGAGTTACTTTACCGTATTTTTTTGTGACATGATCTTTCACTGAACTTGGAGATTGTTATTTCAGCTAGACTAGTAAGCAAGCCCCTGAACTTTCTCTGTCTCTTGTCTCCAGTGCTGAGATTACAGACTTGCACAGCCGTACGTACCTGGCTTTTACATAAGGGCTGGAGATTTCGAGCACAAGTCTTCCTGGCTGATGAGCACGCATTTCAGCTATTCCTCCTCAGCCTCATTTGTTTTTGAGTTGGTTTCTTAAGAGCCTGGACTGTGCTAAGTAGGCTAGTGGCCTGCCTATTTCTATCTCCTTAGCACTGGGATTACAAATGTACACCATGGGCCTATCTTTACAAACCCTTTCTGTGTTTTTGTTTGTTTTCCTTGGCAAAAATGCATGGTCATAACTTTCAGATCTGTTTCTTTTCCTTACCCGTTCCCTTCTATGTTTTCTTTCTAAATTTAACAAAATATTTAGTAATGAAGATCTAATCATGAAACAGAGCAACACAATAAGTTTGTCAGAGTACCAAAAAGGAGTTGAATACAAATTATATTTATGATATTTATGATATAATGAAGATTACTTGTCCACACATTGTTAGACCACAGGATTCTTACCTGGTACAAGTCTTAGATTTTATTGTTACCTGGGTTTTAAGTATTAAAAAGGTTCTTTATACATTTCTTTTAAAATTTAGTCTCATGTTAGTTTAAGTTATAGAATGTTAACATTTCAGGAATAGTTGGCCAAGGTATGAAAACTTCAAAATGACCTCTAATAGGGAAACTATCTTAGTACAAGCAAGAAAGGCAGAAGGAACTGAAGATAGAGTCAACAGTCTTTCTATGTTAACCTTGTTATTTCAGTTTGAAATATAAAAGGTTTCTGGTCCCCTAAAGTGCTATGGGACATGACCTGGGGTTTAGAGAAGGAGCCAGTGGTGCAGGGACCCAGAATTGCTGTTGCACCTAGCCTGCTTCACTTTTATTTCACCACACAGCTATCTAGGAGTAGATAACCTGTAGATTAGTGAAGACGTTAAGGGGAGTCAAGCCTTCACGGCCCCTCGTTTCCTTAACCTGTGATAGCCCAGTGTCCATTCTGAGCAAGTCTGTCTTAAGTAGAGTATAGAAGATCAGAGGGAGTGATAGTTGGGTTAATTCGTGGACAGGCTTGGAGGTTATCTCCCTCAGGTTCTGGGTTCCTTGGAGGGATTTGTAGTTTTTCCACCATTGTATATTCCATGTAACTCCAGTGGCCTCCTGTGAGGACTATAGCTAGTGTCTTAGGATTCAGTTTATAGCTCTTACAGAGGCCAAAGTTATACCATAAGGTTATAAGCTTTTGTTCATGAAGAAGGGAAGGAAAGTCTGACTGGATACATGGTCAGTCCGGGAATGGCTTAAAGATAATCTAACAACTCCATCTACCTATGTAAAATCTCACAATTTTACAAAAAAGCCTTGGCGAATGGCTGAGTGTTTGACAATTCTCATGTCTTCATCACTAGTCGAAGAAGTGAAATAAGAATGCTGGTTAGCGGTAGAGACCACAAAGGGGTTTGGGTTGTAGATAATGGCAGAGATAATAGGCAGGAAGACTACAGGCTGTAAGTGAATGATTAGAAGGCGGCAGTATCTGTGGAAGAGACTATGTTTTGGATCTGAAGATCTACTGATTAATTAGGCTTAGGCTAAAGCGCTTGCTTATTATTACTTGAGTTTAGGCCCTCCCATCTACATAAAAGCCAGGTATAATGATACATGTTAGGAAAACCAGAAATGGGGGGAAGATAACCAAGACATGGATTTCAGCAGCTAGATGGCTAGTCAGTCTAGATGAAAAGGTGCACTCCAGGACAGTTAGAGACCTTACTGTAGAAAGCGAGAGAGAGAAGACATCACCTGAGGTCAGGCCCTGACTCATTCCACACTCATACACACAAAAATGGAATTGATGTTTAAATCCATGCTAACAAACAAGGCAAAAATACCCTCAGTGTTACTCCAGAATCACTTTTCCTCAACAGGTATCTTTAAGATAGTGGTGGCAGGAGAGAGTGAAAGCCTCGGTTGGTCCCTGCACTACTCAGATACAGCTGCTTTGAAAATGCTGCAGAAAGGCAATTTCAGGACAAGTCAGGGGTGGATAGCACGGCTTATAGATTTATAGACCATAAAATGTTCATAGGGGTGAGGTGGGCTTTTCACAGCTGCAAAGATGTTGTCAGTCTGGAGTAGTTTTTTCCTGTTTTTTTGTTTGTTTATATATACTGTTTTATTTTTTAGTATTGGTGTGATAGCAAAACTAGAGATATGTACATATCTCAGAAGTAGCCTAAGAGTATAAATAAAAACAAATCTAAACAATGACAAACATACTGGGTGTGATTAATTCTAGCACTTAGTGGTACAAAGGCAAGTTGAACTTACAGAAGAATTAAGCTTTCTCTTGGCAATCACCACGTTTTAAAGCATACTACAGGCACTTTTTAAAAAATAAACAAACAAACAAACATGCTAATGCTGTATTTCTTTGCAGTGTAAAAAGTGGATCAGGCAGCTCATATGCTAAAGGATGGCACGGTCAAGATCCAGATCCCCCAGGTGGAAACAAAGGTGAGGAGTCCCATGCTTCTCCTAGTTAGCTCGGATTTAGAAATCACTGTTACTGCTCAAGCCTCCATAAGCTCACTGGACCTGGCTGCTCATAGTACTCGATTAATCATGGTAATGGTAGTATTTGTAGATTTGAGGAGCTGATAAATTTGTTTAATTGGGGCTAGAATTACTTTATAATAAAAAGGAATGCAGTGACCACATCCAGAATGAGAAATGTCTTTGAGGTTACTTTTTTAAGCTATTAGGAGGTTTACAACTTTTAGTGTATGTTTTGTTTAATTTTTTTCAAGAAATTTAATCAGAAAATGTTTAATTTTTTTCAAGAAATTTAATCAGAAAATAAAGTATTTCCTAGCTTCTTGGCAAAAAATCAGTTTTGAATAGCTCAATTGTAGTTCAACTCTCATTTGTTTTCTTTGCTAGGAGGTATCAGTACTATAGTTTCCATAATTAGATTAGAATAGTTCAACCAGTTTATTGTACATTAGATGCCTCCCAGTTCTGGGACAACAAGAGTGAGTATCCCATCTTCCATGGCCTTAGCAAGCACACAGACTGGCTACTCTGATACAGTGGGGAAAGCGCTGTGCTTCTGACAGGGGCAAAGCTCTCTGCATCTCTAGGGAGAGAATTCATTCTGTTTTACAACCAGTAAGGTTCAGACTGACATAAAGGACTATTATTACATACAGGAAAGATAAACGATGGTTTTTATGTTAATATAACTTGTTCCAATAATAGAGTGAATCATCAGTCAGTAATTTAGTTTTCATTTTATAAATGTCACAAAATCATGTTCAATTTGGGAGAAGTTTCAAAAAGAAAAGAAACTGTAAAGACAAAAAGACTATATAACAAGGAAGATAACACAGAGTGTGCCTTCTTTTAGCCTTCTTTTAGTTTTCTTTTTTTTCCATTTTTTATTAGGTATTTAGCTCATTTACATTTTATCCTTCTTTTAGTATGACTATTAGAGTAATGGCCTCAGAGACTCTGCCAATGCTTAGTGCCTAGTTTTCTAATTACTTATAGGTTTTTGGTTTTTTTGTTGTTGTTAAGAACTACAAAGAGTTTGGTACTTTGTTCCTACTTAGAAGTCAATATACTACTTTGCTACAAGACACTTCCATGTTAGAGACATTTTCTCTACCTTCTAAGAACCCCTGAGGGCCAGTGCTCTAGAGTGGCTCTGGGTAGATGATGCAAATTTGTCACAGGTTCTGGGGTTTTGACACAGCTGAGGAACTTGAGTCACTTGGAGTAAGCATTATCTTATTATTATGGGCAGCAAACAAGTAAGCTCTCTCTCTCTATCCATGAGGGAGACCTGATCTCTGTTTCCAAGGCTGTTTCCTGGGGAACCAAAGTTGCCAGTGCCCCCACTCATAAGGCTAGAGAATTATCTCCTAACCTTTAGGAGAATTGGAAATGCTAATAACCTTTATAACAAATTTTTCTGGAAGGGAGTACTACATAATAAGATATAAAACAATGTCAGCAGTTTTAAATGTGAATTAAGGGCTAAAGTTAGATCTTGAGTGTTTCATCCTGTCTGGGAAACTTGTGCCTCTGACTCCCGGGTTCTCTGCTTAGCAGTGAAAAGAGATGAAATCTTCAGGAATTCCTCAGAGACTTGAGTTGTTTCCCCCCTGGGATGAGATAAACCATGAAGATGGCAGAGTTTCTGCTTCTGATAAGTAATATTTGCCAGTATGTCTAGCTTGGCAACTCTAGGCGACAATATTGCCAAATCCATGTAAATGTCCTAATGGGTACTGGAGAAGATAGATGTGTTTCCTTTTTGTGTGGAAGACACACATTTGTCCTTAGAAAAAAAGACTTATTCATAATTGAAGCTTCTTAGAGCAGGTAATTTTATTTTATTTTTTCGAGACAGAGTTTCTCTGTATAGCCCTGGCTGTCCTGGAACTCACTCTGTAGACCAGGCTGCCCTTGAACTCAGAAATCCGCCTGCCTCTGCCTCCCGAGTGCAGATAAATTTTAAAATGGCCAGGGTATTCTTTTTTTACTGATTTGGAGCCATTAAGCCCTAAAGGAGGAGATGGAAAATTGGACAGGTCACATGGGGGTTCTTACTCAGATGCAAAAGTGAGCTTCTTCTTTTTCTTTTTCCCTTTGAGGCAGGGTTTCAGTGGCTGACCTGGTATTTAGTATATAGACTACGCTAGATTCAAACTAAGAGATCTGTCTGCCTGTGCCTCACAAGTACCAGGAACAAAGGTGCGAGTCACCATAGCCCGCCCCTTCCTTACTTTTAAGGCTGAGTAACTCAGAGAGTTTTCCATGGATGTGGGAGTCTTCTCAGTAGGAATACAAGTCTACAATTTGGCGATATTAAGTTACAGAAACAATAGATGCAGAAGAGCTATATAATACTGTCCCCTAGAGAGCATTATAGTTGCATTAAAACATACTTTGACTAGAGTCCTAAGTTATTTCAACAGCACATATTTCAGTTGATATGTAAGGGAGGAGATTTTGGAAAGAATAGCAGTTTATGTTAGAAGTATTTATGGAGGGATAGGCATAGTAGTGCACACTTGTATTCCCAGCATTTTATTGGTGGAGGCAAAAAGATTGTGTTAAGTATAAGGTCAGACTTGTCAACAGATATATTCCCAGACAAACCAGTTTGGGTTGTAAAGTGGGACTCTCTTATTTTTCTTAGAAAAAAACCCCTGTTGTATGGAGGCATAGTATAGAAATTGATGGCCTATGTCTCTCTCATTTATTTCTTCCCTGCCCATGGTACCTGGTAAGCGTCTCCTTTGGTAAAGCCTCGAGGGAGAGAACAGTCAGTTGGAAGCACTATAAAAACATTTTTGGAGTTTGGATTGTAGCATCATTGTCTTAGGATGTAATTTCAGAGGTCATCTTTAGTTTTCTTCACACTTTCAACATATTTTTAAAATTTATATATTTACATCGATTCTGCCCCCCTCACAGAGAGCATTCTCCCATCCCCTCCCCTTGTGCATATTTTTTCTAACTTTACTCATGCTTGTTTCTCAGTTAGCTATTGAACCTGAGGTGAGCTTTTCTTGATTGGCACTTTGAAGGTACTACATCTCCTTTTGCTAGAACTTGCTATCAGTAGTCTTTCAAAAACAAGGTTCTGCTTTCTACCTGGTCTGCTCCTCCTCTAATATGATATGTATATTTAACCCATTTTGATGTGTTCATAGAATACATCAGTAAGGATGACAAGAGTATGGTTGTCAGGTAGGACAAAAGAATCATTAACCCATCTCCCTCACACCGGTATACAATTCCAAGTACATATAAAACAAATTCCTAGATTAACCTTGAGTGGGATAGTAGTAGAATTCTAGCAAAGTATTTTAGGTAGGTCACACTAAAACAGTTAATTGTCTCAAAGTGAACTAAACTTCTCTCTGCTTGTTTACATAGGTCATTATCGCCACAATCTAGAAATTTTGAATACCATGAGGAAAGACATTTCCATGGGCACTATGACCCTGAATATAGACATGATCAACAAAGACCCTTTACTTGGAGAATGGATGATGAAAAACATGGACAAAATAAACCAAGGATTCCCCCTCGTGTGAATTCGTATCATCGGTCTTATGTAAATAGATCACCTTCTCCAAATGTAAAACCTGTTGAAAAATTTGATACATATAAGCCTCACCAAGAATATTTTCCTGGCAGAGGAGATGATGACAGACGATCTCAGTATATGCCCACATACACAGAAAGTGCAGCAACCTACATGGAGCACGAAAGGGATTGTTATATCCCTACAGTGCAAGGAAGGTATACTCCTGATGATCACAGAGGTAGAGGTAGAGGAAGTGGGAGAGGAGAGAAGCCACCTCAGATGTCACTGGGGAAGCCACCTAAGATGTCACTGGGGAAGCCACCTCAGATGTCACTGGCAGATTCCTTGAGATTTAAAGAGAAATGGCATGAAGATGAATTGAGACACCAGAGGGTACAAGAAGAAAGCTACCCTCAGTCACCCAGAAGAGGCTCAGAAGACTTTGGCACAAGGAACCCTTTTCAAAAGAGGTACAGGAAATCATTAAGTCTGGGGAATTTGGCATAAAGCCTCCAGTAATAAAGTTACTTTTACGTTGAATATCATAATTTTTTATCTCAAAAGATAAAATAATTTATATTTTGAGTAATTTATGTGGATAGCTAGAATGTAGTTTTGTTTGTTTGTTTGGTTGGTTGGTTGTTTTTTGAGAGGGGGTTTTTCCTGTATAGCCCTGGCTGTCCTGGAACTCACTCTGTAGACCAGGCTGGCCTTGAACTTAGAAATATGTTTGCCTCTGCCTCTGGAGTGCTGGGATTAAAGGTGTGCTCCAGAATGTTTTTAAAAGATGTTGCTTTTAAATTTCCATGCCCCTCTTAATGAGTTCACATGAGGTGGTCTTGCCGTTGCATGATGTATTTTAAGGCCAGTCTGCCCATTATTCTAGACATCAAAAGTTTTACTTCT
D3_15 155993841 156008891 15051 AATGACAGACATTAAAAAGCCTAATAAAGGAGGAAGAAGCAACAAAAACAGGTATACGTCCTAGACACTGCAGAAGTCTAGGTTATTTTGTGACATTAGCAACACTTCCCCAAGGCCTTTCTAGGACTTTATGCTATAAGCTTGTTCATGTATAATCAGTTGATGATTCCATTCTTTATGAAATCAAAAAGCTAAAGGAGGGCTTTAAAGAGTTGTATTGCTTCTCATAAGTGTCCATTGGAAAATCAGTGATGTAAAACAACTCTTCCTAGTAGTACTGCATAAATTATTATAAGCAAGAGATTCTTAAGAATGTCAAATTTTTATTTGCTTTAATTTTTACCTTAATAAAACATTTTTGATTTTTTGAGACAGGGTTTCTCTGTATAGTCATAGCTATTGTGCAACTTCCTCTGTAGAACAGGCTGGCTTGGAACTCAGAACGTAGAGATCTGCCTACCTCTGCCTCCTAAGTTCTGGAATTAAAGGTATGCATCACCACCACCTGACTATGAAACATATTTTTAAAATAATGATTTGGGCTGAAGAGATGGCTCAGCAGTTAAGAGTACTGGCCCTAGATTCCGTTCCCAGTACCTCCATGGCTGCTTACAGACTTCTGTAGCTCCAGCTCTAGACCGCTTTTGGACACTTTGGGCACAAGTCACACACTTAGTGCACACACAAAACACTTATGCACATAAGTAACATACATTGAAAAATAATTACTTTCTCTCCTATCCCTTAAGTGAAGGGAACCAGGTAGATGGGAGCTAAAGGTTTAGTTCAATATTAAAGCTCTTTTCCAAGAATGGGTAAGGCCCTGAGTTTGATCCCCTAAACCTTAATTTTGAATATGAAAAAATACAGTTTGTCAGAAACCGTTTACCCTCTCAACTCTACCTCTTTTTATCCAAAGAGTATAGTTTTCAGAAAGTATGGTGGTAGTACAGAAAAACAAGAGAGTGTCCCAAAATGGGACTAGTGAAATAGGAGAGAAGATTGCTTGTATAACATTTTGATGTATTCTTTCTGTACTACTATTAAGAGCTTGTAGCATAGCTGATTTTAGAATGTCTTTATGAGCTGAAGTTAATGCAAAAATGACGTGGTGTTGGAATGTACTCTGTGGTATTTAAGCATAACTTAATTCAACATTCATTCAGAGATTAGTGTGATTAAATTGTTAATTGATTTAATTTTCACTGTTGAACTATAGAGTATCTTCCAAACTTCCTAGAGTATGGCCTTACCATGAAGAAGAATGATTCTCACTTTAACAATTTCTTCTAGATAAGAAAGCAAATGTGGCAGATAGGAAGAAAATCCTTGAATTCATAAGTCAACTCTTGTTTGGGTTTGGGGAGGCATGTGAGCATTATAAGTTAATATACAAAGAGTGTGGGCCATATTTCTTTTCAAAGGAGAACAGTTTGGATTATTTTGATGGTCCCTTCTTGATGTTGAGTTTTATAGAATCTTTTAAGGGCATTCAGTTTCACATTGACATGGAACTATTTGTTTCCTTTTTTAGCAGATAGTTTTGTAACACCTGATATTACTCTAAATGAACGTTTCTCAAGAATAAAAAACAGACAGGATGCAGATTTCAATCAAACGAAATCAAATTCAGATCCAGAATTTCACAGGTAATGATTAATTACTGTCTTTTCACTTACCTCAGAAGAATAGTCCAGCTTTCTGAGCTCGCTTTCCTTCTGAGCTTGGTATAGAACCTAGAAGTGCACTTTGTACGTACCAAAAGCAGTCTGAGCAGCTGCTGGACCCATACACAGTGCTAACTTACCACTGTTTGAAAAGAAAGATTCACTTGCTCTCATTCTGCTATGTCTGTAGTAGCTGTCTACTGAAGGGAATGCTGGAAAAGGTCAGCCATTGAAATCAGGGCTTACTTTAAGTGGTCACAAATGATTGTTCTGAGGTCTGATGAAAACATGCATGCCTTCTGTCGGTACTTGTCTGAGCAGAGGGTGCACCCTGTATGCAGTACTGAGATGAATCAATGTTATAATTTTATCCATCACCAAAATTGAGTTTGAGGTCACACTAGTGATTGGAGAACCACCAAGACTTCCCTACAATACACCCATAGGGTATGTATGGCTTAGTAGACTGCCATGTAGGTGAAAGCCTATCATGGCGTGGTGGCACACGGCATTAGTCCCAGCACTTGGGAAACAGGCAGGCAGATACCTGAATTTAAGGGAGTGAGTTTCAAAACAGCCAGGGCTACATTAGAAAGACCCTATCTTAAAAGACAAAAGAAATGAAAAGCTACCTGACAGCAGGTTGTTTTGGCTTTTTCTAAGACCTACTGGTTTATTTCTAATTCTATCCTGTAGTAAAAGAATCAGTGTATAACACAATTAGCATAATTATTTAATTATGTGCCTTTATTATTTTAGGCGAATAGATATGTCTTTGGATGATTTTCAGAATAAATATACGATGGTATATGAACCAGATAAGGTAAGTGAGTACAATTATTATTGCTATAGTAGTGGGAAAGGAGTTAAAGGTCTATAAAGAAAGGATGACATTCAGGAATATAAATTGAAAAAGTTCTCCAAGTGACTGATGGCAGTCCAGGATGGAGTGAGATGCTGAAAAGGACAAACTTTTTCTTTGGGAGGCATGGTTAGTAAGCATAACAACTTTGAAAAGTTGATTTAAAATTACATTGAATACTCATCCCCAAACTTCTCAGAGTAAAGCTTATAGAAAATATGGTTGATAGCCAGCCATTTTGCAAATCTGGCATGTGGGATATACTTTTAATTGTATGTGGAAGCAATGCAAAGGAACTGTGGCATTTGGTGCTGCCTATCTGTTTGCTGTAGAATTTAGGAAAGATTCTGTGGAATAAAAACTAGCAAAATAATGAAGCTAATACTAAATTTTTTTCATTATCATTATATATGTTTTCTACCCAATACTTCCCCTCCCACTCTCTATTTCTTTCCTGACTAGAAAGACTTCTATGACTGATCAGGTTAGAAAACAAGTCTTTAAAAGCATGTCAACTTCTAAATGTATCATTAATTTTTCCTTTGAGAATTTTTCTGTAGTGAAGAGATTTTAATTTATTTCTGATAGACTATATAAATAATTTTTATTTATGAAATAAAGATTCGATAAATATAGGTAGCTTAGTTTATTGAATAATGCTTTTGTAACATTTCTAGTTATAGTTGATCTCCAGGAAATTTGAAGACTTAAAAAAATTCATAATCCCAGTTTGGCATGGTACATTTTAACAGTCTTTCAGATGCAATTCAGTATACCAATAATCCATAGCATTTCTTTTATGTAAAAGTTCTAAATTCTCCCCATGGTCCTTTATAATTGATGTTTTTAAGTTTTAAAATTTTTAGTAAATGTTTTTCTATATTGACTTCATAATTTATTAATTTTTATGGCTGTATAGTTTTGTTTGACTTATTTGCCATAACATCCTGCATCATTCTTTTTTCCCCTTAAATTATTTTCACATTTAAGTTGTTTCATTTTTTGTTATTTTCAGTATTTTTAAAGAGGCAACTTTTTGGGATAAAATCTTGGAAGTAGGATTCTTGGATTAGTATAAGAGCTTTTCTGATTCTGAACCATGGTGGCCCACACCCTTAACCCTATAGTTGGGAGGCAGAAGCTGACAAATTTCTGTGGTTCAAGACTAGCCTGGTCTACATAGTTATGGCCAGGGTAGCCAAAGCTACACATAGAAAAACCCTGTCTCCAAAAACAAACAAAATAGAACTTCAGTTGTGTCTCAAAATACTTTTATCAGTTTATACTACCATTAGCTGCATGGGTATAAAATAATTAAGGACTTTAAGTTTCTTTTTAGAAATTGTCTTTGTGCTACTAACAATAATGTGAATAATTTGTCTTCTGTCAAAATTCCTCAGACTCTGGTCAAAGTAATAGAACCAAATGATCTACGACATGACATTGAGAGAAGGAGAAAAGAGCGATTACAGAATGAAGATGAGAATATTTTTCACATGGCTAGTCCTACAGAGAGGTAATCAGTAAATGAAAAACATCCTGCTATCTGGGAGCTTTTGGTTTTAGGAGCTTTTACATTTTTTGTGCTTAATTTTTGCCCGATTGTTCGATCTGTTTTGTGTGTTTTTAAAATGTTTCAGTTATTCAGTGGTCATTACAGGAAGCTTGTTCTACACATTAAAAATGGAGTGGGTGAATATTTGAGGTCTTTTAATTCTAGAAGTGAAGAATATCCAACTGTTTGACTATTAGCAGGAGCTATGACCAGCAACCCTTATGGGCTATTTGAATCCAGCAGTTTGAAACGAATAGGTTTAGACCCTTAGATTCTGACTTAGGAGTACAACATTTTTTGATGTCAGTACAGTTCTCTTTGGGAATTCTTGGGTCTATGAAGTAGACAGTTGCAGTAGAACAAGTGGAAGGTATGGTGGCACACACCTTTAATCCTAGTACTGTAGAGGGAGAGGCAGGTAGATCTGTGTAGTGAGACCCTGTCTCAAAAACAAGACAAGACAAAAAACAGAAAAGAAACAGCGGAGGGAGACCTCAATTTGGATCTCATTGACTCTGCCCATTTACAAACTGTCAATAAATTTTACGAATCTTTAGAATTTTCTCCATAGTATAGTGATAAGACCATCTTATTATACAGGGGCAGCTATACTCTTAAGTCACTGGCATCTTAGCAGAAGTTATAAAGATATCATTGTCATATCATTGTTAAATTCAACCTCATAACTCTTTCCAGGGGTCTTTAGTCATCTAGATTGACCCTAGTCTACCTCTAGTTCTAAGAACTAGTAGGACCTATGACGATTGTGTGACCCCAAAGGATTATGGGGAATAACTGAATGAGACAGACTGTCTAGTTTGGGCAAGGGTTCTTTGTGTCCCTCAGAAACAGGACTATGAATAGGAAGGGATAGTGCTAATTGTTCTTCTATAACCTTTAGTATCAACTTTTTAAAACATTTTAAGTATTTGACTAGATAATTTTAAGTCAACTCCAAACTTGATTAACCTTACCCAAAATACATGGAGCTTGTTTTAACTGGAATTTATTTTGACAGTAGGTTTGGGATTGATTAAAAGATAGTGAAGTTGTGTTTTGCATATAAAACAATTGGAAAATGCAAAATTTTTGTCTTTTCCTGGGTAAAAGTCACCAATTTCCTAATATTATATGCTTAACACATGGTGTCACTGTGTTCAGTGACAAGATGTCTAATATGTTTTTCTTAGTTGAGAAAGCTTTTGAAACACAGTATACCAAGAAACAGGATTTTTTTCAATATTTACAATGATAACTGTAAATGTCCCAGGGCAGATCCTTGCCCTTTGAGATGATAGATCTTGAATGCTGGCACACTACTTGGGTTTGATGCCCAGCTCTAAGAATCCTAGCTATGTGGATGACTTGGGGTAGGTTACCTAGCCTGTTTCCTCATCTGTGAAATAGGACTGCTTACATCATACTGCTGATCAGGATTAAGTATAGTAGAGCTGGTTAGCATTAAGTTTAGGAATGCTAGCTTTGAGGATGGTATTACAGCATGAAACATGAGAATTTTAAACCTTTTTCAGTATTCTTTGCCATCAAATTCACACTTTGTAAGTAAGCAATTGAGTTGTTTTTACTATATTCACAGAGTTGTATAAGAACCACTTATCCCAAAAATATTTAGTCACTCCAGAAGAAAACAGTGTACCCAGCTGTGACCCCCCCCCCATTTTTCTTTTTCCCTTCCCTGGCAACCACTGTTATACATTTTGTTTCTATGGATTGCCTGTTTTTGACACTTTATATAAATGCAATAATACAATGTTTGGCTTTTTGTGACGGGATTTCTTATTTTACGTAGCATGTATTAAAAGCTTATTCATGCTAGAAATCGAGGATTTCTTTTATGACTAAATAATGCTCCACTGTATGGATGTGTCATATATTGTTTATCCATTTATCAGTTGATGGACTTTTGGTTGTTTCCACTTTTTGGTTATTGTGAATAAATAGTGCTGTGAACATTTGTGTGCAAGTTTTTGTGTGGTCATATCTTCATTTTTATTAAGTATATACTTAATGTAGAATTGATGAGATAGGTGGTTATTGCCAAACTGTTTTCCAACATGACTACATCATTTTATCCTATCAGCAATGTGTGAGAGGTTCAGGTCCATATCTTTACCAACACCTGTGGGGTTCTTTCTGTTTTTTTTTTTTGTTGTTGTTGTTGTTTTTGCTTTTTGTTTTTTAAAATGATACCAGGGCTGGGGAGATAGCTCAGTGGGTAAAGGTGCCTGCTGTCAAGCCTGACAACTTGAACTTGAGTTCATTTTGTGGAACCTATCTGGAAGAAGAGAGCTGAATCTCACATGCAGTTCTCTGACTTTCACCTGTTCATCTTGACAGGGACATCCACACATTTGCACATCTATGCAAATATACACTCTTTAAATAAAAATGAAATTTAGAAATTTTAAACGATGTAGAACTGTTCCATCTTTGACTCAGTTCAATTTCCTTATTAAAGTTTACCCTTTTATCTTAGAAATGAAGTTTGCCAAATTGATCTCGTTTTTACATAAGTAAATTTCAGCATGTAGTTTCTAGAGAAATTCAGATAAAGCATAATGTCACAAATCATAGGATTTAGTGATTTCCTTTTATGGGATTGCCATTAAAATGTAAGTTATTTGAAGGCTATCTGTGTTTGCTCAGTGCTATATTCCAGTATCTTGAATTCAGTCCATATTTGTTGAATGTGTGACGACTTTACAGAGCCGCAGATGGGGCAGATGATACTTTAGCTATAATGCATTTCTATTTGGGTTACTATTCCTTTTTGTTTTGGGATCTTTGCCAGCAAGCTTAATTCTTAGGCATTCCATCCAATGTCTAAGGCAGTTCTCTATTAGCTCCTCATTGCGATCAGGATCTTACCTTGATTTCTCCCAAGTCTTATGCTGTTTACAAAGACTATTCTTTCTTCTAACCAGTGTTACTAAGTCCCCTACAATATAATTGAAATGTGTTTTATATATATATATGGGCTGTGTATAATTTAAAAGCTTAAAAATTTTATCAGTGACCTTAAAAAGGACATTAAACTACCAAAAATTTATCAGTAGGGAATTTAGGGAAAAGATAGTTTTTCTTATACCAAACGAAGTTGAACTTCATAGAGTTCTTTTCATATATAACAGATAAGTATGTGTTTATTTTCTTTTTGTAAAGCTGCAGTTCTATGCATTGGAGATACAGTGAAAAACTACACAAAGCTCTTGACGTCTTAGCACTTAGGATTTAATGGTAGGAGAAAGAAAATGTTGGTGTAGTAATGGTTAAAAACTAAGGTAGAAGTGGAAATTCAGCAGGAAGAGTGACTTGTGTGATAGGGTTTTACGATTTTAGTGGGCATGTGAATTCACTGAAGGAGTCAGCCAACTACATTATCTGAGCGTATATACAGTACAGCGAACCAACTGCAAAGATCTTAAGCAGAAACATGTTTTCTTCTTGAACTTCTAAGGACTATAATTAGATCTAGTGGGTATCCCAGTGGTATAAAGGGGAGATGGCTCAGTGGGCAGAGCGCTTGCTGAACAAGCCTGTACTAGATTAGGTCCCCAGAATAATCCTGTTATAGTCCTTTTTGGAGATTGGAAGGCAGAGACAATCTAACAACTGGAGGCTATGGACTAGCCTAGACAATATAACAACTGGAGGCTTGTGGACTAGCCTGACAGACATAGCAGTGGACAAACAAGAGACCTGGTTTTTAACAAGGGGGAAAGTGAAGAATGACATCCTAAGTTGTCATCTGACTTTCATATGTGCCCTGTGGCACATGTGTGTCTATACCTAGATGTAGACAGGCAAGAGTACATAACATATACAAAAGGAGAAAAGTTTGTAGATGAGGCCAAATCATGAAGGATATGAAAACAATTTTACAGTGAGTAGAATTAGGAACATTTGAGGTTCTAACCAAAGAAAAGTCATAATCTTTGAATTTTAAAAGGATTAGCATGGCCACAGGGACTGTAAGAGTTACAGAAAAAAGCCACTGTTTTCATTGTATGGCCTATTTCACTTTAATAATGGTTTTAATTTCATCCATGTTGTGCCATATGTCAGTGTTTATTTCCTGAAAAAGAGCTTTGAGGCTGGATAGACTACATTGTTTTTACCTGGTTTTATGTGGATGTTTGTGAGTTTTCCACCTTTTGCTTTTTATAAGTGGTGTTATTAGGAACAAGGAGTGTGACTTTTTTTTTATTGTAGCCTTTTTATTCTACTGAGTATAAGATAACATTACATTGTGGTTTTGATTTGTATTTCCCTAATGACTAAAGATGAACATTTTTTTCATATGCTTATTGGCTATATATATATGTCTGTGTGTTTTATGTGGATAAATTTTTGTTCAAATCCTTTTTTCATTTTATAATCAAGTTAATGTTTTTACTGCTAAGGTATGAGAATTTGGGAGTTTTGTTTTTGTTTTGAGACAGGGTTCCATTATATAGCCTTGACTGGCCTAGAACTCACCAAACTGAAGAAATCTGTTTACGTTTGACTCTGAAGTGCTTAGTATGAGGCCTGAGGCGCCACATCTAGATAATATTGATTTTACTATTTAGGCCAGTGAGCTGGTTCAGTGGGTAAAGGCACTTGCACCAAACCTGACAGCCTGAGTTGAATTCCTGGGACCCACATGCTAGAAGGAAAATCCTGACTCCAGCATATTTTCTCCTGAATTTTATATTTGTGCTTTGGCTCCATATAATAAATAAAATATAATAACATGTTAAGAGTTTTTTATGTATTGTAGATACTACAGGCTGAGCGTTACTGGGAATTTTTGTGACCAGAGTTAACTCAGATTTTAGATTATTTGGAATGCTTGCATAGATATAATGAGCTATTGGGAGGATGGGCCGGCCCCAGAACTAAACGTGAAATTCATTTATCTTATTCATACACAGAAGGAAATTTTATAAAATATTTAAGTGTATCTGTTTTGACTGACTTGTATGATCAGGTGTAGAATTTTTCTTTATTTTTTTTAAGAATTTTTCTTTATATTTGTGCTTAGAAGACTTTAGATTTTGGAACATGTCACATTTCAGATTTTCATATTAGAGACGCTTAACCTGTATTCCTTTATTAGATGTGTTTTGCAAAGCAAATTTTAAAAACATAAGACATTTGTAATTTTGCTAGATAGAAATGATCGCTTTTAATATTTAATCTATTTTTTACTTTATCTTTTTTATAGGCATCTATGTGTACTTTTAAGTACTGAAATTATCTTCAATGCATAGTATTACAGTTGTACCTTGCTGTTTTGACTTAATATCACATCACAAAACATTTTGATGGGGCAGTAGGTTTTTGAACATTTTATAAACGCTGAACTCTCAGTCTGTATCAGGTTTTGGGGCCACAAATAAGGCAACTACAGTGGAATTCAAAACATATTCCATTAAAACACAGAGGTATAAGTAGTAGTTACAAATAGACATAGGGCTTAGGACTTCTAAATGCTGTATATGTCACAGTAGGGCTATCTATTCAGATAAGTTTAGGAAAATTTTTGGACAAGGTACAAATGGAGCCGAACTTTGAAGTTAATCTAAATGGAAGGAAATGACCACAGGAGGAATTGCAGGTACAAAGTTGTGGAATCAGGAAAGATCATGGTATGTGCTGGGAACTATATGTACGCAGTTAACTATCTAAGGTTCAATGTATGTGTTTGGGGATATTGGGAGAAAACAGGTAGTAAAGCCATAAAATAAAGAGCTAGGGCAAGAAGGACACGGGAAACCATCAGCAATATGGATTTTATCCCGTACAAAATACCTGGGAAGGGCTGAAGCATAGCAGTTGGCTCACTATGGAACAGGGCCTACAAAAGACTAGAAGAGGTCTTAATTGCATTGTGGGGAGATATGACAAGGAAAGAATTGCCAAGGCCTATAGAAATGAGCCTTCCAGGATGTTCCTCGCCAGCAGACCTAATTGTCAGAGACTCTTGCTGTCATTGTCAGGAGCTAGGAGCCTGTCCTTTGCAGTATCAGAGCCCATAACTTTGCCAGTGAGGTGACCATGTTTTACCTTCCCTCTTATAAATGAGATAGGTCAGGAGTCACTGATAGATACTTCTGCCAAGTAGAATCTCAGGAATTGGGCGGGGGCAGGCAGTGATGCTTTTACTTGAGGGGGAAAAACTTCCATGTATCAGCCAGGAATCCTGTCATTGAACCTCAGATTGAGACCCCCTAGTACAAGGAATATCGCTTTCTCTACTGATAGTTTCCAGCTTAGTTAAATAATATTTGTTGAAAATGTCAGTCTTAATGACTATCCTTTATCATTTTCGTAGTGACAGAGCATTGAGGTTTTACTGGTGTGCGGTATGTTTGAAGACTTTGCTTTTTAACTGATTAAAGTAACAAGATTCTTTTTTCCTTTTGTTAGGAATCATCAGTCTCCCAGTTTTTCAAAGGTGAAGACTATTCGTGCTGATGGATTTCAAAAGCCTCCACATTTTATAAAATCAAATTTTAGAAAATTTATTCAGAAACCTTACATAGTAAGATTGGAGTTTCAAGTTTTTCATTTTTGTATATTCTTTATAAATATATCTATACTTTTCAAAGTGCTTGTAACTTCATTATGTGTTATAAGAGCATTGAGGCTTAAAGATTTTTATGACATAATATAACTCATCTCTTGATTTAGTTGAAGTTCAATTTATTATAGTACTGATTTTCTTAAGCTGTTTTGGTAACAACTTAATTAAGATATAATTTATATACTCTAAAGTTAACTCATTTCAGGTGTATAATTTGGTGAGTTTTAGTAATTCTCCAAGATGTGTTAGAGTCATCACCATAGTCCAGTTGTTGGACTTGAGACAGGATTTCACTTTGTTGCTCAGGCTAAGCAGGGGAACTCACCATATATCCCAGGCTAGCCTCAAATTTGCAGCTCTCCTGCCTTCACCTTCTATGTGCTAAGATGACAAGCATGTGGCACCATATCTGAGTAGGATATTGTCATTACCCAGTAAACATTCTCATGCCTTATATTTAATTATTCCATGTTCCAACCGCCCACCAAACCACTAATTGCTCTATTTTAAAGATTTGCTTATAGAATGGATCATGATATAATAGCCAGCCGGCAGCTCTTCTGTAAGTGATGACTAAATGATGGAAGCCAAAGTTAGTTTGTTACCTTATGCTAGAAGTAATATCCCATTACTTAACCATATGGTTATTACAAGAAGCAAGCTACTAGATCATACCCACAAAGAGAAGGATCATTGATGGAGATAATTAGGAGCCATGTCAGCAGCTGCCTAGTACAATCTTCCCTCTGGCCAGACTCCACAGAAATGGATTAAGTAGAAGGTAATAAGATTGTTGGTTTTAGAAATAGGAAACTGGAGAATGGGTACCATCTTAATTGTTTCTGCTAGAGGATTTGGGTTCTCTGTAGTTAGAATGCTAATATAGCTATTTTTTTTTCTTTTTTTGGGCCTTCCCAAGCTATTGTAAGAATATTACCTTCGATCAATTAAAGTCGATGTGTTGGGCTAACATGCCTACTGGCAGTGTGGAAAGTTGGTGGGGTTTTTTTGGGCAGTAGAAACCCTTTACCAAGTCCTGCTGGCAATGGGTTTCTTTCTTTCCAAGATACATACATGAGTAAATGCTAGATTTATAGTCCACTTTCTAAAAGTCAACCATGGTGTTATACAGAGTGTTTGTTTTTACACTTCTCACAGGCATGAATGAAACGGGCCCCTCACAAACTAGCATGGGTCATATGAGAGAAGAAGTATGTAAGCTCCATGCTCCCTGGTTTGGGGTCTTAATCTTCAAAAATATGTCTTAAATGGTGAGACTAGTTTATAAAGTAACCCTTAAGGTATATTAACCCATAATAATACTTTCTGTTCAGAACTATACTATGCAGAGAAAAGATGCCATTGATCAGAAGATATTTAGAGTTGAGGAAAATCATCAGAACAGAAGAGGCTCTAAAGGATCTTTTAAGGTATTGAGTGTTGTTTTTCTGTTTATATCTGACTATGGGCTTATATATTGGAAATAATTGTGTCAGTACATTAAAAGTTATTTTTGTAGTCTTTTAAAAAGTTATAAACTAGTGTTTCTAGTTTCTATAAATACTTCTAGAATTTATATTTAATAGTTACCAGTTTAATACTGCCATGTTTCTTCAGGATTTGACTTTGAATTTCATTTTTACTAGTGGAACCCTGTTTTCAAATAGTAATGCACTTGCTTCTAGAAATTACAAAGGATTTAAGACTTAGAGTAGAGGTAGATTCCATCTATAAACATGTGGGCTGGCTCACTTCTCAAACTGTTCTAGGCGGTTGCTTGAAAATGCAACTAGCCACAAGTGTATGAAGAGTGAATGAGGAAGGTTTATAGAATTGTTTGGAAAGGCTTACATAAGATTTGTGTATGTCTGACAAAACTAAACATTCCTCCCACCTCCAGCATACAATGACAAGATCAAAACCATAAATATGTACAGTCCTTTTATGCTTCCTATAGGACAGAATCTAGTTTTCATCATTCATACAATTAATATTTGCTATTTCATGGTAAGAAAAGATGAAGGAACTGGCAGGAATAATTTTATTTTATTTAAGCATCTGTGAGTATATGTACATATGTACGGTGTTATAGTGAATACTTAATCAGTTTCGTCTATCCTAACTTTTATCGTTCAGTTCTCTGATAAAAGACACACAACCTTTATATTTATAAGCTTTAAGTAGCACTAGAGCTGAGCAGGTAACTACCCTCTATGCTATTAGAATCTACTTTCCCATCAGTAATGTTGAGTTAGAATTTACCATGTCCCATCTGGGCTGCTCCAATTCCCTAGCCCTCATGGCTATATTTTCCTGATCCACCTACCTACCCCATGGCAGTGTCGTCTTTTTTCCACCTCCCTCCTCTCTGCCTCTTTCCTCCTCATTCACCTCAGGCCTCAGCCTGGGGCCTTAACCCTCGCCTATGTCTTTTCCGCCAGCTATTGGCTGTCACCCTCTCTTTTTAAACAGTAGGGGAGGGTACTTGAGGGGTGAGGTTACATACCGTCATTTACCATTTTTGTAAGTGCACATTCTCATGCAGATTCTCTTGGGGGGGAGGGTAACCATGCCTTGGGGGCCAGTGTTTAGCATTACAATACAAGCAAAAATCAAAACAAAAACAAACAAACAAAAAACCCAAACCTCAACAGTGTGGGCACCCATGGAGACCAGAAAAGAGTCTTGGATAACCTGGAATTGAAGTTGCAGGCAGTTGTGAGCAACTCACTTTAGATGCTAGGAGCTGAACGTGGTTCCTCTGAAAGAGCGGCAAGTCCCATCTTCTCAGTCTCAGGAATAAAGTTTACACCTTGATTGTAGGTATTTTTACTCTTTTCCCCATCACTGGCACTTATATAGTCACTGTGAATTAGAAAAATAAAGTTAGCTATTTAGAACATAGGAAGATTATTTTTTCAATATGATGAATGTCAAGAATTCATTTCAAGTTATTTTTATCTTCTTTCCAAATGTGTATGTGTTTATTCATGAAGATAAAGCATGTATGTGCACATACATGTGCAGACCAGAGGTTGACATTGGATGTCTTCCTCAGCTGTTTTCCACCTTCTTTTTCTTTTATTGATAATTTTTTCTTTGACAGCTTCTTACATGTGTTAGAATACATTCTGGTTACTTTTGCTGTCACCATGTCCTCTTTTTCTCCTACTTGTCTTCTCCCTACTTTATGACATTTTGTCCTGTGTTCCACAGGGTTTAACTAGGTTTGTATGTATGTCCTGGGGTTTGAAACTGTCCATTAGAACTTGATAGGTTCATCAGTGGCAAAACAGCTGGATATTATGCGTCCCCTGTTTCCAGAATCTGTTAGTTTCAGTAGTTCTACAGTGTGTGATAGGGCCTTAAGTCATCTTTACCACCTGTAGCTGACTAGTAGATGTGCTAGTTCATGATTGCCTTATTCCCCCAGGCCTATATAGTACCATCTAGCATTGTGAAAACTATCCAGCAGAAAGCATTCAGCTCAATTCCAACTTGCTTTCTCTGTATCTGTCTACTTCTATAGACAACCAAGATGAATGGTAATAGCCCTGTATTATTTTGGAACCTCTGGAACATTCCTGATGGAGCCTTAACCACTATGGGAGTGTCCCATACCTGGCACTAGGTGTTTTGTTTAGTGACCCTTACCTAACTTGCTTTTCTGTTGCTGTGAAAAAGCACTGACCAAAATCACCTTTTGGAGGAAAGGTTTACAGGTTACAGTCATTAAGGGCAGCCAAAGTAGGAACCTTGGAGGCAGGACCAAAACAGACAAAGGAGGAATGTCACTAACTGGCTTGCTTTCCATAGCTTTCTGAGCTTGCTTTCTTAAACAGTCTAGGACCACCTGCCCAGGGAGGGCATTGTACAGGGAGATGTACCCTCCCACATCAAACTTTAATTAAGAAAACTCCCACTGACTCACCATACTCCCATCTGATGGATATAGTTTTTCAACTAAGGTTTATCCTTTCAGATGACCTCAGTCTGTGCCAGGTTGACAAAAAACCACCAGTACACATTTGTCCTTTTGTCAGCTCTTCACACAAACACATCAATCACTATTAAACTACGATCTTTCCTTTCTTATCTTTAAGATCTCATGTTAATAGCACAATGTAAAATACACTCAAGTTTAAAAGTCCTTTAAGTGTAAAAGTTTCAAGTTGTCTTTGAAAATCTAGTCTCTTAACTATGAGACTCCCGTGAAATCAAAGTTAGTTAAATGCTTCTTATTTTTTTAAGTACTTCTTATTCCAAAAGGGAATAAAAAAGTACAAAAAGTTCACTGGCCAGCATTTGAACCTTGTCACTGCCAACACAGAACTATTACATCTAAGGCTGGCATTGTCTAGCCTTGTGAAGTATC
GF3 -1 -1 1 CTTGCACAGCCGTACGTACCTGGC
GF4 -1 -1 1 GTAAGTGAATGATTAGAAGGCGGCAGTATC
EX52 -1 -1 1 GATATTCTGCAGAGAGACAGATATCAC
EX32 -1 -1 1 GTGGATTAGTGTTATGATTTCCTGAGC
GR3 -1 -1 1 CACACAATCGTCATAGGTCCTACTAGTTC
GR4 -1 -1 1 GTGCCACCATACCTTCCACTTGTTCTACTG
Comments:
Created
Target: 2803Ensembl ENSMUSG00000044150 -- 155991176 -- 155993582 ENSMUSE00000372666 -- ENSMUSE00000410616
creating candidate regions
attempting to insert candidate regions into db
done inserting candidate regions
running aos on us and ds
running aos on gaps
finished running aos
AOS Produced 8 oligo candidates from u/d regions
AOS Produced 14 oligo candidates altogether
inserted results of aos runs
Aligned target to NCBIM37 assembly: chr: chromosome:NCBIM37:X:1:166650296:1, start 155991175: end 155993582
Found 3 RP24 black6 bacs on NCBIM36
Found less than four RP24 bacs: looking for extra from RP23
Found 10 RP23 black6 bacs on NCBIM36
Entered all non-repetitive oligos
Sequence count unchanged by blasting
finished aligning oligos to bac
ACCEPT (0) gap pair G5:X:155984676:155985675_948 G3:X:155997082:155998081_203
REJECT (1) gap pair G5:X:155984676:155985675_948 G3:X:155997082:155998081_911
REJECT (1) gap pair G5:X:155984676:155985675_948 G3:X:155997082:155998081_534
ACCEPT (0) gap pair G5:X:155984676:155985675_907 G3:X:155997082:155998081_203
REJECT (3) gap pair G5:X:155984676:155985675_907 G3:X:155997082:155998081_911
REJECT (2) gap pair G5:X:155984676:155985675_907 G3:X:155997082:155998081_534
ACCEPT (0) gap pair G5:X:155984676:155985675_666 G3:X:155997082:155998081_203
ACCEPT (0) gap pair G5:X:155984676:155985675_666 G3:X:155997082:155998081_911
REJECT (1) gap pair G5:X:155984676:155985675_666 G3:X:155997082:155998081_534
DESIGN COMPLETE
U-type: U1
D-type: D1
Creating display features: mapping to reference assembly
Created display features
Inserted short and long range genomic sequence arms

webmaster@sanger.ac.uk

Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SA, UK  Tel:+44 (0)1223 834244