High Throughput Gene Targeting: Create Design

This custom vector design tool is provided by the EUCOMM consortium as a service to the research community. When using this tool, the user agrees not to submit more than five designs per day for creation without prior discussion with the High Throughput Gene Targeting Group at the Sanger Institute.

Design Type Oligo Select Method Artificial Intron Design
5' retrieval block size U block size Min 5' spacer Critical Exon Min 3' spacer D block size 3' retrieval block size
 
       
Subtype Domain Disrupted
Gene Build Gene
Start Exon End Exon
Target Start Target End
Primer Length Design Comment
Created by dk3
Valid After Annotation
not done
oligos on fwd strand oligos as ordered View gene and design in Ensembl UCSC BLAT recombineering primers
Design ID: 103566
Chr: 4
Strand: 1
Status: Ordered
BACs: RP24-538D8 : RP24-432L14 : RP24-175K18 : RP24-555H2 : RP24-322P11 : RP24-530M19 : RP24-172E14 : RP24-340H5 : RP24-300G14 : RP24-530O7 :
Instance: Plate 114: Well D03: BACs RP24-175K18 RP24-555H2 RP24-432L14 RP24-538D8
Oligos on GRCm38:
Type Start End Length Seq
G5 107885452 107885501 50 ATAGCCGTTATAATGTATCGCTTAGGAAATGATAAGAGAAAATGTCTGAA
U5 107890972 107891021 50 GGCCCATCTGAAGAACTTTGACTTGAAGAAACACAGAATAACAAAGGAGA
U3 107891106 107891155 50 TTGAGACAACCTGGAGTCCCCAGCCAAATGGCACAGATTCTAGAGGAGGG
D5 107893545 107893594 50 GTCTATGAATAGTAACTGTCACGTATGAAATGCCTACTGTGTGCTGTGTT
D3 107893662 107893711 50 AGTCTTTAGACAAGGGAACTTCAGAGACTGTAGTGTGCCAGAGTCCGTTA
G3 107897211 107897260 50 TCCAGTTTGCATGTGGCTTATATAAAGGCTCTCTATCTAGCTCTTAAGAA
Oligos:
Type Start End Length Seq
D5_D3 107566200 107566266 67 CCATGCCCATCACCTTTCTGTGCTACTTCATTTCATCCTCACTGTAACCTAAACAGTGATTCATCCT
G5 107558057 107558106 50 ATAGCCGTTATAATGTATCGCTTAGGAAATGATAAGAGAAAATGTCTGAA
U5 107563577 107563626 50 GGCCCATCTGAAGAACTTTGACTTGAAGAAACACAGAATAACAAAGGAGA
U3 107563711 107563760 50 TTGAGACAACCTGGAGTCCCCAGCCAAATGGCACAGATTCTAGAGGAGGG
D5 107566150 107566199 50 GTCTATGAATAGTAACTGTCACGTATGAAATGCCTACTGTGTGCTGTGTT
D3 107566267 107566316 50 AGTCTTTAGACAAGGGAACTTCAGAGACTGTAGTGTGCCAGAGTCCGTTA
G3 107569816 107569865 50 TCCAGTTTGCATGTGGCTTATATAAAGGCTCTCTATCTAGCTCTTAAGAA
G5_U5 107558057 107563626 5570 ATAGCCGTTATAATGTATCGCTTAGGAAATGATAAGAGAAAATGTCTGAACATACATGTGACAGTTGGAAACCCCATAGACCTAACTATATCCACTCATGGCTGAGCCCACAAATGCAGATAGAGTTGGGCCAGTTGTATTTTCAGAAGTTGCTTCTTGTAGTTAATGTAGTTACTACTTCTCAGTGACATGGAAGAATAAATAGTGACAGCTGCTTCTCAGTGACATGGAGGAATGTGTAGTGACAACCAGAAGAGGAAATGACATGAGGCCACACAGTGCTGTGTGACCCTCACTGGGCGAACAGCTTCTCTGTGCTGACTGTTCGGACTAGCTCATCTTAGTCTTGGTGAAATTTGAAATCTTGCATCTAAGTTTTAAAATGCATGTTGCCAATGGTGTGACTTCTAACACTAGGATGTGATTCTATTTGCTATAAAGAACCTTAGAATTTGGCAGGCTCTCTGCTTTCTGGACACACTTGTCAGTGCTGCTTGCTACTTTAAATTTTCTTCTTCAACTCTTAGAACAATAGATGGTCATTGTAGAAAATACAGGAGCTATAGAAAAGAGAAAGGGGGAGTTCTTTCATATCCTTAATAGACAGCCAGTGATAACATCTTTTTGGTTTCAGAAAGGCTCTTATTATCTAGCTATGACTGTCCAGGAACTCAGCTATAGTGGTCAGGCCAGCCTTGAACTTTGAATAGAAGCATGTGTGTCTCCTCTGCCCAGCTCTACCTAACATCTCCACGTGTAATGTCTTAGTCTTAGAGAGCACCAGGAGCTGAGGCAGGTGGTGCATGCTTGTAATCTCCAGTACTCGGGAGGAATAGCGCAGAAGATCAGCTCACGCTGCGAACCCGAGATTGTGTTACTTACTTTGAAATACCCTGCCTTTAGGTGTGGTGTGGCTCAGCCTTAGCACACACCTGTAATCCAGGAGCTTTCCGCTTGAATATTATAAACATGATTAAGTCGACCATAGGCCAAAAGGCAGAGCAATCAGTTGACAGAGAGTGAACATAGGAAAAAACTAGAGAGTAACAGGGAGTTGGGAGAGCTGAGAGGTGCAGGACGTAGAAGGGAGGGGCATCCAGTTTGAAGGAGGAGCTTCGGAGACGCTTCTAGGACATTGGTTGATGAGGAACGTCAGCTGGGCGCTTTCTCTGCCCCTCTGAGCTTTCACTCCAGTATCTGGCTCTTGGAGGCTTCATTGATAAAACCAAACAATTCAGATTTTGTTTTAAAGAAACAACATAGGAATCTCATGATTGAGCCATTCTGATGTGTGTATATATATAACAAGACCCAGCCTCAAAAACAAACAACTTTTAGCCCCCTCACCCTGTGTTGGGGTGGAGGTAGAACTCTTTGTTTAGGTTTGTGGTACTAGGAGTTGAACATAGAGCATCTATCCATCACTGACCTGGTTTCCAGCTCTATGTATAGTTTTGTTTTAAAAGCACAAGAGACAAAATCTGTTTTAGAAATCACAGTTTTTCCCCTAAACTTTATATATTTTCACAGTAAAAACAGCATGGCTTCCTAATATATCATTTTAGTAAGTGGCCCTTGTTAATGGACATGTGCTTCCTCAGGGTTTATTACTGTAAATATCTTTATAAGGAGCATTTTTATAGTAATCGGGGTTATTAATTTTTTTTTGGTATTTGCCAGTTTTCCTCTGCTTCTTAAACATTTTGGTTTTCTTTTGTGTTTTAGGGATCCGGAAGGCTTGCGAGTATTTTATTATCTTGTCCAGGACCTGAAGTGTTTAGTCTTCAGTCTGATTGGATTACACTTCAAGATTAAACCAATCTAGATATTGGATATTGTGGACACAAGGCGGGTGGGAGTTTTTAGTTACCATAATTAGGATTTTTTTTCTGTATATTGGGGCAATTTTTATAAACAATAAATGATGATCTTTAATAAATGCGATAACATCTTTTTTTGTTATTTTTCTAAACACCTGAATATGTGAATTCTCAGTCTGTAAGATACAAACATTCTGTGGGAGACTTGACAAAGCAAAGAAAAAAACAAACCTAAGCAACTAAGAACTGCCATTTACAGGAAATGATGGGGAAAGGTTTAAAAATTCAGTGAGGGCCAAGGAGATGGTTCTGGCAGGAAAAGCTTTAATGCATAAACTTGACCACTACCCACAGCCCTGGGACCTATGCTGGGCCTGGACTAAGCCACCCAGGAGCAGAAAGCGATCCTGTCTGAGCAAGGTGGAAGGCAAGAACTGACTCAGAACTTCCACCCCTTTGCTGTGCCATGGGTGTGCGCTAGCACACACACTGCTGAATATTTTTTTCAATACATTGAAGTTGAGAACCCCATTAGCAATATTCTAGGACAAGGTACCTGGGTTTTGTTTTGACCACGCCTCCCCTCCCTTTCCTGTCCAGGATGACTTTGAACTTGGGATCTGTCTCCCAAGTGCTGGGATTTTAGGCAGGTGCCACCACACATAGTTCAACCTGGATTTTTAAGTTTCAAGGGAAATGGAAACCCTGAAGATTTACAAGATGACTAATTGCTGGAGTTATAGCTCAGTAGTAAAACACCTGACTAGCATTCATAGCTTCTTGGGCATAAAATTTTATTGTGGTTGGGCATTTATTTTTTATTTATGTATATGGGTACATTGTAGCTATCTTCAGACACACCAGAAGAGGGCATCAGATCCCATTACAGATGGTTGTGAGCCACCATGTGGTTACTGGGAATTGAACTCATGACTTGTAGAAGAGCAGTCAGTGCTCTTAACCACTGAGCCATCTCTCCAGCCAATGGCTGGGCTTTTTAACATATCCTTTATTTCCGTATGAAGGAAAACTGTTCAATAGGTAGATTGGCAGGAACTTTCTCTTGCCATTACTTAAATTTCATGGCTTGCTGAAAATAGCTGATTAGATGGCATCAGAAGGAATGGGACTTGATAGGGTTCATTGGTCTGAAGGGACACGAGCCTAAATACATATCCTTAGAGACATTCCATTCTGAGACAAGGTCCCAAGCATCCTCAAGACTTTTCATACTCCGTTAGGGATATCATTAATATGTGACATGTCAGGATGCCAGACTTCTGAGACACTTAAAGACCAGTCTGGTGGTGTCCAACAGGCAGGGGGATGGCTCAGCGGTTAAGAGAACTTGCTGCTGTAGTAGATGACCTCATTTCTGTTCCTAACATCCATAGGGTGGCTCTATCAGTGTGTCACAGAGTGTTGCGGCCGGCTCACATGTCTGGGTTCTAGCCTGGGAGGCATCTTGGAATCTGGAAGAGAAGAGGGAGCTAGGCGGCGGGAGAGAGAATGGAACCAAGACAACTAGTCTGCTCAAGGTTCAATTTTACTATTCCCAGGCACTGGTTTATGAAGAAGGGGAAGGAACCCATTCCCGCCAAATCATCCTTGGAGTCCAGTTTCAGGTGACAACTTGATTAACTCCGGAACTGCTAGGCGGCAGGCAGTAGCAGTGGGAGTGGTAGAACGATAAGGTGGCAGGCTCCAACCCCCCCCCCCATGCTCTCTTCGTGCTATCAGTGAAACCTGTTCAGCCAGGTTTCAGGCTGAGGGGGGGGAGGGTACAAGAGGGTTATTTATGGTGCCCTCTTTTAGCCTTGGTGGGAGCTGCATGCATGTGGAGCACATACATACTACCTGCCAAAACCAAAATAAAATTTAAAAAGACTGGGCCATAAAAGTGGGAGCCAAGCATGGTGACACACGCCTTTAATCCCAGCATTCGAGAGGCAGAGGCAGGTGGATCTCTTTTGAGTTCGAGGCCAGCCAGGTCTACAAAGCGAGTCTAGGAGAGCCAGGGCTATAATTACACAGAGAAACCCTGTCTCTAAAAAATAAAAATGGGGCATGTTTTCGAATGTTGGTGCTCCCAGCTCCTGCAGTGTCGGTTAAATATATGACTAAGGTGGGGGAAAGTCAGCTCTGTTCAGGCATAGCTACCACGAGGACATGGACACAGGGCAACCCTGTGGGAAAAGTCGCAGCATCAAATCGTGTACATCCAGTGGGCAGTTTAGAGGGCGACTACCCATCATCTGGGAGGCTGCAGCGTAATCTGAGCCTCAGGACCACAGGTAGTGAGAAGTCGGATAGAGAACCGAGAGCCTAGAGAGGTCTGGCAGAGGTTTCCAGCCCGACTATCTTGCCTGCTCAGTGAAGGCACAGATTGAGAATCAGGAACCATCTCTGGCATTTGCGTTTACATCGGTTCCAGCAAACCTACCGAAAACAGCCGAGCCCGGCAGGTTAAGGAGGGACAAGCTAGAAAACGCCAGCCTACAGTACCACTCACTAACGCCCCGCTCCCCGCCCACCCGCACTGAGGCTGCGCGGCGACGCCGGCCTTTTACGACGGGTCGGAAAGCAGCTGTCGCAGCGACTTAACGTGGACCGGCAGCTATGGGGGTAAGGAGAGGCTAGTCGCCATTGGGGCATCCCGTCTGGTAGTAGCCCAGTGAGAGATGGGTCCGAGGCGGCGAGGGGCTCAGAGTGGCGAGCTCAGAGCAGGAGAGAATGGAAGGCGTGAGGCTCGGGTGGCGGGGCTTGAGTCGGGAGGGGCGGGGTGGGGCGTGGCACGCAGCTGAGCGGACGAGGCCTTGCACTCAGCGTGTCCCGCCCTCTTCTCAGAAAATCGCACTGCAGCTCAAAGCCACGCTGGAGAACGTCACGAACCTTCGGCCAGTGGGCGAGGACTTCCGGTGGTACCTGAAGGTGCGACGGAAGGCGGGTTCCTCTAGGGAAGGGAGGAGCATCCGGAGGCAGTGGGGCATCTTAGGGCTCAGGGCCCAGCCTTGATCACAGTGTTGAACTGGGAGCTTTTCTAAAAGTTCCACCGGGTCTGAGGTGCTTAACCAGGCATCTAAGTGAGATCTTCAGGATGGAATTTTAGATTTTATTTTTATTGATTAAACGTTAGTCTTATGTAATCTAGGCTGGCCTTGCGCTCTTTATGTAGCGAGGGATGACTTTGAACTCCTGATCTTCTTACTAGGATTACAGATGTTCGGCCTCCTCACACGGTGGAGTTTTGTGGTTTTATCCCTCTTCTGTTCTGGCGGGTATATCTGAATTTGGGGCCTCACGCTAGCACTCTCCTGATGTGAAATCCTTCCAGCTCTTAGTTTATAAACATACACGGAACAAAATATCATTTGAAGGGACCCTGTGCTTACTTAATATAGTGAATAAACCCACCTTGTTTTATTTGCTGGCTTTACTTATTGGGAAAGTTGGCCACCCTTTGACCTCACACAGTGCTAGTAAACTGGGTAGGTACCCTGCCCTAGAGGCCCAAACAGTGTGACACCCTTCATCGTCCCAGGCTGTGCTTTATTCTCCTAGTCTATCTCAGTGCCTCACATACCCAACCAAAGCCATAACTGATCACTCTTATTCCGCCACCCCCGCCCCAGCACTAGACAAGTGCAACACCATCGCACCCACAGCTCCTATTTCAAAATGTTTGGAGCAGGAGTTCCAGGGCCCATCTGAAGAACTTTGACTTGAAGAAACACAGAATAACAAAGGAGA
U3_D5 107563711 107566199 2489 TTGAGACAACCTGGAGTCCCCAGCCAAATGGCACAGATTCTAGAGGAGGGCAGGGGTGCCAACATCAGAAACACCTTGTTCTTACTTGGAGATAAATCGGCTCATGTCCCTATTGGATGCTGTAAGAATCCCCTAGAAGATAGGATGGGTCTAGAGGCACTCACTTGTATCCCAGTACTTGGAAAGCAGAGGCAGGAAGATCTCAGGTTCAAACACATTTGGGCTACACAGTGAGAGTGCATCTAAGATAAATTAAGAGAAGGCAGTAGGCTATGAGCTGGCCTTACACCGTGCTTCCCCTTCCCCTGTGTCTAAGGAAGCTACCTGCTCAACTAATAATACTCTTTTCCTTCCCCAAGATGAAATGTGGCAACTGTGGTGAGATTTCAGAGAAGTGGCAATACATCCGGCTGATGGTAATGGTCCCTACCACATGCTCCTGGGCAGAAAATTGGGGAAATTGGATTTCATCTTTCTTTCCTTTAGCCACTTGGGGGGGGGGGCACGGCAGGTGTTGAGAGAGCACCAATGTGACCCTCGCAGGGAACAACAGACATCTTTGAGGCAGAGTTCAAAATCAAGAGGGACTTTTTTTCTCAACCAGGGGAAGACTCCTTAGGCTTCTGCCCCACCCAGGGGATTGAATCCAGGGCTTTGCATATCTCTACTACTACTCTACTGAGCATGCTCTACTACTGAGCTCTCCTCAACCCTCTTGTCACTTGTCAGCAAGTGACTCACTTCTGTGGTCTTAGTCTGTTCCACTGGATGAGGTGGTGGGATGAGATCTCTCTGGGACCCTTACGTCTAGCTGTTACATGACTAGAAATTCTGTTTGCTTCTTGTCAGGACAGCGTGGCGCTGAAAGGAGGCCGAGGCAGTGCCTCCATGGTCCAGAAGTGCAAGCTATGTGCACGGGAAAACTCTATTGGTAGGTCGGGTGCTGCCTACCAGGCTCTTCCAGGGTGACTGGAAGCAGGCTTGTGTTGTCAAGGGGTGGACCTAGGTGTGAAATACTAAAACCTGTGCAGGTCTCTCTCTTTCCCAGGCTGTGTCTGGGCACCTGAGTGGAGTCTGGGTAGAGATTCAAGTCAACTTTTCCTTTTTATATTTCAGACATTTTGAGCAGCACCATCAAGGCTTACAACGTAAGTTTCCTGCTGTAGTGTCAGGGATGGTGGGATTAAATCTGAACTGATGGCTAGGAGTGGGGTCGAGAGTAGCTGCATCAGAGTGGCCTGCCCCTGGACATGGTCCCATGTATTTAACTCTTTGTTTTGCTTAAGACTAGGTCTCACTAGGTAGCCCAGGCTTGGCTCAAACTCATACTCCTGTTTCAGCCTCCTGAATGCTGAGAGGCCAGGTACTTGACACCACGTCTCCTGCGTATTTACTCTCTCATGCACCAACTCAGTGCTCACTTGCTCCGTATCTTTTGTCCACCATATCCACATCATCCACTGGGTAATACTGCAGTTTCCTCCTAAAAGTACACAGGATGACAGTCTGGGCAGTCTGAGCCCAGGGGTGAGGTAGGCAGGGCTCCTGGCTATCCACCTCCCAAGAGGTGCGCTCTCCATACACCCAGCCTTCCTCATGACATGGTGGATGTTTGGTTTCTGTTTTGTTTGTTTGTTTGTTTGTTTGTTTGTTTATTTGGTTTTTTGAGACAGGGTTTCTATGTATACAGCATTTTGCCTGCATGTATGCCTATAGGCCAGAAGAGGGCACCAGATCTCATTATAGATAGTTATGAGCTACCATCTCTAACAACCACTGGAAATTGAACCTCTGAGCCATCTCTCCAGCCTGACATGGTGGCTGGTTATCCAAAGGCCATGGTGTGCTTACTGGGACCATGTGGACGGTCTAGAGCCCTTGTAACTTAGCATTCTTGTCTTCTTGGTCACTTACCATTCATTGACCCAGTGCTTGGCTCTCAGTGCATGATTCAGATCCTTACAGTAAGTAGGCCGGGTTTCCTCTGCTCTGCTGACATGCAGGAAGGTTGACCAAGGATCCTCACTCTTCTGCACAACCTGTGTCTACAGAGGTCCTCTCTGGAGCAGTACCCAAGACAGGCGTTTTGTTTTTATAAAGGGCTAACTTGTTCTGGGTCCTGTTCTAGGCTCAGTGGTGTAGTTAGGGCCCACAAGGTAGAAAGGGCAGAGGGCATTGGAGGAGGTGGTCTCCATTGGTCCTGCCTCCTCAATACACTTCCTTTCCAGGCTGAAGACAATGAGAAGTTCAAGACGATAGTGGAGTTTGAGTGCCGGGGCCTTGAACCAGTTGACTTCCAGCCCCAGGTATGTGGCTTTAAGGCTCTCTGGGGTGGGGATGAAGCAAGCGAACTTTGCTTCTTACAGAGACTGAAATAGGAATTCTCCATCTTGCTTTTCCCTTCTTGTTCTAGCACTGAGCTACAACACAAATCAGGAAGTCTATGAATAGTAACTGTCACGTATGAAATGCCTACTGTGTGCTGTGTT
D3_G3 107566267 107569865 3599 AGTCTTTAGACAAGGGAACTTCAGAGACTGTAGTGTGCCAGAGTCCGTTAGTAAGCAGGGGCTGGATTTGAACCCAGGTCTGTCTGAATCTTATAGTCAGTGCTCATCCTCTTGTTTGTACATTTTTACTCACAGTAAATCTGTGGGGTAAGTTAGAAAAGATGGTATCGGCATCCCCATCTCATAAACAAAATCACAGATAAAAAGTTTAAGGCCAGCCTGGAATCCCTGAGGACCTGTCTCAAAAAACAAATAAAACCCAGGTTCAGAGCCAGGCATAGTGCATTCCACCTATAATCCCAGCACTCAAGAGGCTGAGGCAGGTGGATTTCTATTGAGTTCAAAGACAACCCAGTGTACATAGCAAGTTCCAGGAATGCCAGATATATCAGAGAGACCCTGTCTCACCAAATAAATACCCCACAAACTAAGGTTCAGAGAGGGAGTGGGGTGCATACCCAGGTCCTTGAGCAGATAGAGTGATGGGAGAGCTTACCCCCACTCCGGCCTTTAACTTGGTTTTTTGATAACACAAACTAGAACCACCTGAGTAGGGACCCTCAACTGGAGAACGGTCCCAATTGCTATATAAGAAAAATAGCTGAGGCTAGACATGGTTACACACCTTTAATCCCAGCACTTGAGGGGCAGAGGCAGGTGGATCTCTGTGAGCTCAAAACCAGCCTGGTTTACATAGTAAGTTCCAGGTCAACCAGAACTACATAGTGAGACACTGTCTCAAGAGAGGGCGTACGGGGGAGGGAGAGAGGGAGGAGAGAAGGAGGGAGGGAGGGAAAGAAAGAGAATATGAGAGAATGAATGAATTGGGGAAAGGATGGGAAAGAAAAATAGCTGAGCAAGCCAGGAGGCACTCTTCCTAGATGGCCTCTGCTCTAGTTCCTACCTGTAGGATCCTGCCTTTGTGTCCCTGGATAATGGGCTGTATGAAAAGTTAACCCTTGCTCTCCCAAGTTGCTTTTGAGTCCTGCTGCTTATCACAGCAACAGAAAGGAAACCAAGGCAGTCTTCTGGGCCAGGGCTGTAATTTAGATACCACAGCAGTGCCGAGTAAGTTGGGAACCCGAGATTTTCGGGAGCAGCTGTTGTTCTGAGGTTGCCTTGAGGGCTTTGCTAGGAAGAGCAGCCCTGGGCCGGTCCTCACAGGCTCCTTCTTTCCCCCACCCTCCCTGCTGCCTTCCTGTCTCCTGCAGGCTGGGTTTGCTGCTGACGGTGTGGAGTCAGGGACAGTCTTCAGTGACATTAATCTGCAAGAAAAGGTGAGACTTGGGGAGCCTGTAAGGTGTTCCATGGTACCTGGTGGGAATTCTTTTCTGCGTTAGCTCCAGATGTTTGTGCCTTTGGTTGGTGATTCTGCTATGGAAATGGCCATAAATATAATGTTTAAGGGCAGTGGCTAGAGTCCAGCTCTAGCAGGCCAGGGTTCTGAGGAGGACCTGTGAAGGTGGCAGTAAGATGATGCATAGACGTGTTATGGTTGAAGCAAGCTTGTATTTCCTCCTGTTCTCGCTAATGTTATTTTTTCTCTTATTCCTCATATACTACTCATAACAGAAGTCTTTACACAGAAATCACTACATAATAAGTCACATATTTCAGAAAACAAATTTCCCCAGAAGCCCACATGTAGTTAAACATTCGCCCCCACCATCTTTCCTACCATAATCACATCTTTATCCCAAAGCAGTAATGCTTTTATTATTGATTAACAAAGTTTATGCAGTCAAAGTATATTTCAGCCAGTTTTCTTGTCCTGGCTGGCAGCAGTTTGTGGTACCGTGTGGCCGACTGGTGTTTTTGTTCTAGTCTACAAAGCCTTGCTGAGCTGACCTTGCTAACCATCTACTTTCCTTCTCTTTCACTCCCAACAGGCTCATGTGTTTTCCTCTTACAACTGTTTTCTCCAGGTGCATACCAAAAACCTGTAAATATGTCTGTAAGCTACATGACAGGAGACTCAGTAACCTTAGTTACAGAAACATAATTGCTTTTTTGATCATTGGCCTGGCTCTCACAGGCAAGACACGTGGGCTAGCAATGCCCGAAATTTCCCTGTTCTTATTTCCTACTCCTGTAAATCTCACATCCAGCTGGAAAAAGTTTTTTTTGTTTTTTTTTTTTTTTTAGTTTTATTGCAATCTTCTCTAGATCCCTCATAAGCAGCCCTGGCCACTTGTATCTTTAAACTATTCTCAGAAAGTTCAGCTGAGTCTTTAACCCATCTAAACAGCACTGTCCTGGGGAGACCGTCATCGCACTTAAGTGCTACAGGTAAACTGCCCAGAGAGGGGTGGGACTCTCCCACAAAATAACCACACTACCACAAACACAAGAAGAACATCCAAGTATGAAGCATGATCAGGCCTAGCAGCAGCAGCAAGAGGCACTCTGAGCACCATCGGGCCTCTGCCTCTCCAAGGAACACCCATGGCTGCTCTGCTGAACGGTCACCCGAACTCCATAAGCTTCATTGCTGACTGCAATTCCTCCAGCATGGTCACCACCAGGCGATCCCATGGTTATGCATGCAGGAAGGCTGGTGTGCCTGACATGGAAAGTGCACAGTAGATAAGCTTCATTTAGGCCCACGTCACAGTGCTGCTGGCTGAGCAATATAAATATAGTAAATATGCTACTCTTAAACAAACCTATGAAGCAGAGGTGTTTACTGGTTGATGAAAGTTGTGTGACCAGATGCTTATGAGAAGCTAACTCTGTTTCTCTAGGAACAGTAGCTGAAGTGTTTGCAGTGATCACTGTAGTATTGATTCAACCCTGTAGATAGATGAGTCTATTGCTCTAGCTGGGAAGGAAGAACACCGGCTCATTCTATTTACCTGGCTCCTTTTGACAGCAGTAGGTAGCATTCTGTGCCCCTGGTTACTGTGCTAAGTGTGTTTTCATACAAATGGAAAATGAAATGTTTCATTTCATTCTTTTAACATTCACTCTAAAGTCTCCTGTTTTTCTTTTTTAATAAAGGAAGGAACTCAAGTTTGGGAAAATGACATGATTTTCCTGGTTAGAAGACCAAGAGATGGAGTTTAGGCCTGGGTGGTCCGCTTAAAGGTCTCCTGCGTTCATGACTAGCTGAGTCAGAGCCTGGATTGGGCTTTGGAACTTCTGGTTCTCCACTGTCCACATTGTACTGTTCTGCCTTGAAAGGCTAATGCTGCCTTCTTATTTCATAGGACTGGACAGACTATGATGAAAAGGCTCAGGAGTCTGTGGGGATTTTCGAGGTCACCCATCAGTTTGTGAAGTGCTGAACTGTCTGCCCGCAAACTTGCCTGTAAGAACTAAGGAGAGACACAGCGCCCTGAGCAGCAGTTCCCATGGAGGCTTCTCATCTCTGCTCTCCTAGCACCTGTACCAAGTCTGCATGCCAGGGTTTGCCGCAGTTCTAAGTCCCACCAATAAAGCCCCTGTTGGTGCCACAGTGCTGCGTGAAGGTGGTCTGAGAAATACTCCCTCCATTAATAAGATTGGACTCTGGAGGTCTTTGCTTTCTAATCCCTATTCTGTACCTGATCCAGTTTGCATGTGGCTTATATAAAGGCTCTCTATCTAGCTCTTAAGAA
U5_15 107548578 107563626 15049 ACAAGGTGGTTAAGATAGAGAATCTGGAGAGGGTACCCCAATCACACTACAGTCGGGTGCTACTGGGTGGAGGAGAAAACCATCCTAACCCCACAGCACTGCAAAGACGCTCCTGTCCCGCCACACTCCCACCATCACGAACATCAGTAAGTCAGCAGTTTCAGATTCTGCCATTTCCTTCCCCATAAAAGCATGAAGATAGGGAGTCGGTGTCCTTACGCTTTATTTTTAGGGTATTTGGGAGTTTCCAGGATGTGAAGAAGTTAGGTGGAGGAAATTACGGCTTCAATTTTTTTCAGTTAACTACAGGACGCTTCATTCAGGCCGGGCACCATGTGCACAGTCTTAAGAAGCAGCAGGAACTGCATTTGCAAACACGTGTTGTAAAAAATTAATTTTAAAAAAGCTACCTGTATAAATATAAATATATATATTTAAAGACAAGGTTTTGATACTTTTTTTTTAAAAAACAAAAACTACAAGAGAAGACTGTACAAACCACGGGCTTTTAAAATAGCATTTTGCTCTCTACAAGCTGTTAATGTCAGGGGTGAGGGGTGAGGGACTGGTTTGCAAACACACTATCCAAATGGATTTGCTTGTTTTGTCAAGCCACCCTCCAAATTACCATATTTGGTGTAATAGTAGGGCATGTAAAGTTATTGGGTCCCATTAACCATTTCTGCTCTTGTCATGTCATTCCGGGTTCCGTTAGCTCCCGTACTCGGCAATCCAGCTTCTTCCAGAGGCAGAGGGGCTGAAGGAAGTGTGCTCCATTTCACTAGCTGTACTGACATCATCCACATGTGGACATTTGTAATATCAGTACACTATTTCTAGAGAGATTAAATTCATTTTTTAAAATCTGTTTTGTTTCCTTGTGGTGATTTGATGGTGGTGGGGAGGTGTGAGCTCTCACATGCTAACCCCCTCATGTATACCAAAGGTTTTGCACAAACATCTCGATCTTAGCAGTAAGTACTCAGTATTATCCACTCCCGTTTTATAAAGACATGGGTGAAGTTACAGCTCAAAGCCACAGAGTTCTTTTTGGTAGTCCTAAAGAACAACAGACTATTCTCTGCCTAGATTTTCTTCCTGCTTGTTAAGAACTCAATTTAGGTAGTGTCTCTCCCAGGAAGTAACGTCTTGTCTGTCTGGGTTAGAAAACTCCGTATTTCCATTATGACTTTTGTTCACGTGCAGCCCAGTCTTTCTGAGCTGCCACTTTTCTCATGCCCCTGAGGTGACTTTACCAAGGCCTCCTTGTAGACACTCCAGTCCTTTTCTTCCTTGACCTAGGAGCAGTATTTTATACTAGGCCACTCTTCCTGGAATACTCTTATTTTGGCTTCTATGGCTCCATATGCCTGGTTTCTCCCTTACAGCTTTGGCCACAGCTTAGTCTCCTTTGCCTACTGTGTTAGTCAGGGTTCTCTAGAGTCAGAGAACTTATGCCTCGTCTCTATATAGTAAGCGGATTGGTTTGTCTGTAGTCCAACTCCAAGGATTTAGCAGTTGCTCAGTCCCACAAGGCAAGCAGAAGAAGAATGTCCTTATGTAGGTCTCCACATTAAAGGTGTGTACCACCACACCTGGATCTAGGGGAAGAAGAGTGAATCTTCCTTCTTCCAATGTCCTTATGTAGGTCTCCAGCAGAAGGTGTGGCCTAGATTAAAGGTGTGTACCACCATGCCTGGATCTAAGACTTGCTTTGTCGCAGATGACCTTGAACTCAGATCTCCTTGCCTTAATCTCCTGGGATTCATAGCCACTATGCCTCATGATCTCCATGCCAAGACCAGGTCGGAAACTTGTATCTCCCAGCCTCAAGATCAGGACCATAGGTGAGCCTTCCAATTCTGGATTGTAATTCATTTTGAATATAGTCAAGTTGACAACCAGGAATAGCCATTACACCTACCCTTTATGTTAAGGTATTTCACTTCAAATCCACTCATTTTCCAGTTTGCAGCCACTACCTACACATGGGTCATCACCACCACAGTACTACCTTCATGGATTTCCTTAACGACTACCTATCTCCATAACAATTGCACTTCTGGCCTTCCTATTTTCCAGTCGGCTTACATGACAACCAAAGTGATCTTTCTAAAGTGCAGTAGGAGCCAGGCAAGGTGGTGGCACACGCCTTTAATACCAGGACTCCTCTAGAGTCCTGCAAAGGCAGGTGGATATCTGTACCCCAGCCCAGTCTGGCCAATATAGTGAGTTTCAGGCCAGCCAGGGCTACACAGCCAGACCCTGTCTCAGAGAACAAGAAACAAACCAGTGGCAGGGCAGAGAGTGGTGAGACGACATCTCTGGTAACGATGTGTGTCAATTCTTTTTTTTTGAGACAGGGTTTCTCTGGCTGTCCTGGATCTCACTCGGTAGACCAGGTTGCCCTCGAACTCAGAAATCCGCCTGCCTCTGCCTCCTGAGTGCTGGGATTAAAGGCATGTGCCACCACACCTGTCGTGTGTCAATCTTCTATGACTAGAATTTACCGTATTTCACCTACTTGACCTTAAAATTCCCGCACCAGAAATTTGACCTTTCACAGAGGTCAACTTTGGCTCTTGAAAATGAACCTCTTGGGTAGTGGTCTCCACATTTGACCCACCTCGTTTTTGTTTCAGTTTGTGTGTGTGTATCTTACTTGGTAGTCCTGACTGGCCTGGAACTCACTATGCAAAGAGCAGTCTAGGCTTAAACTCACAGAGGTCTACTCCACTCTGCCTCTGAAGTGCTGGGATCAAAGGCATTGGCCACCATGCCCAGTTCTCACCTGGGTATTTTTTTAGAGGCTTCAGTGAAACTGGATTCTGTCAGCATGTGGCTAGGGCTGAGAATCGCTGCTAAATAAGATGACCAGTAGGAGCCGGGCGGTGGTGGCGCACACCTTTAATCCCAGCACTTGGCAGAGGCAGGTGGATTTCTGAGTTTGAGGCCAGCCTGGTCTACAGAGTCAGTTCCAGGACAGCCGGGGCTACACAGAGAAACCCTGTCTCGAAAAACAAAACAAAACAAGACAAAAAAGCCTAGTAGGGATCCAACATTCATTTAACCGACCCACAACACCTATCTAGACATGTTAGCTTGAAAGGGAAGAATGAAAGGCAACTCGTTCATGAGTGGTGACCCTCGTGAGGATGAGGTAGGAGGGTTTGTGGTTTCAGGTCAGTCTGGATCAGGTAGCAGTACTCTGCCTACACGTAAAATAAAGAAATAGCAGAAAGGGATGTTAGCTAAATGCAGGCAAGTTTCAGGCAACATTGTGGAATGGGAAAGGAGTCATTCTTAAAAGACAGCTAAGTAAAGCCAACTTTATTTTTCGGGACAGGGTCTTAGTATGCAGCCACTGGTCTCAAACTCTCATTACGCTCTTTAGACATTTACTACTAATCTCCCGCCTCAGAGCCACCTCCTGATCTACACACTGGGGAGTGGAAGAAGGCGGGGGATGGGGGTGGCAGCGTACTCATAGATGAGCAAATCATTTTGCCTCCTTTTACTGTGGAAACCCATCTAGGTTCAGAGTGTGAATAACCTCGTTCGACTCACTTGTCTCTTTAAATTGAGGTTGCGCCTGACAGGACTCTAGCGCTCAGTGTTGGGCTGAAACCCAGATGCAGTTCTCGGATCCCAAGATCTTCCAGAACTCTCGATATACAACCAAGGGGGCGTGGCGATCTTGACCCAGCGTCTAGGGGAGGGGGCGTGGTAATCTCGTTCCCGCCTCCGGAGAGTGAGAAACTCTTAGTGTCGCGGTGGCAGACGTCATTTCCGCGCGCCACCATTACGCCAGTATAAGACGTAGACCGCAGGCCGTGGTAGTGTCATCCGTTCCTAAAGTTCCGTCCTCCTTGTCCCTTGCGAGGCATGGAGAGTGACTTTTACCTGCGTTACTACGTGGGCCACAAAGGCAAGTTCGGTCATGAGTTCCTGGAGTTTGAATTCCGACCTGACGGTAAGAGCGGCCTCCCGGCTGCGGGCAGTGGGACCGGCCCCGGGGAGGGCGGAGAGAAGGCGGGCTGCGGAATGTGGCGAAGCGAAGCAAGGGACGCCGACCACCGTGCTGTTGGGTCGTGAAAGAGGCATTCTTTTGTCGGCTTCATTGGTTCTTTCTCTTCATCCGCTGGCGATTCTCCTTCGTAGCTTTTTAAAAAGCCAGGTTGCTTACATTCAACAAAGATTTAATGTCCATCTGAGAATGGGCTGTTTGTTTTCCAGTCTGGGGACAGAGCAACAAAAATAAATTTTCCCCTCTCGTGGAACATGTGTTTCAGAGCCGGAAGAAACCACAGCGATCTCTTGTAGTGTGGAGTGATCAAAAAGTAAGGTCGCTTTTAAAGAGCAGTCTGAGGAGTGTGAATTTGAATTAAGCCGTAATTGAAAAGGGATCAATTTTTGAAGTACAGGAAGAAAAGCATCTACAGGAGTAGCAAGTGTCATAGGACCTCAAAGAGCCAGACATATCCAGGTGGTCACTGGGGTGACTGAGAGACAGTAGTAGGGGGTGATGTTAGTCAAGAGCCTCGCTATACAGGTGTTTGTAGTGCTTGCTTGCATACAGCTTCCTTAGTTTTCAAAGTCCTTTCCCAACCCAGTTGAACATCAGCATGTTCTTCTCTGTGCAGCTAAGATAGCATTAAAATTCCTGTTTACAGCTGAGAACGTGTTCTTTTGCTACATCATGGCAGCCTTTTCCCGGGACTCTAGTTTACTGTCAGGTCCTTCTTCTGTTGTTCAGTAGTTTCAAGTGAAGTACCAAAAACACTACTATCACAGCTGGGAAATGGGTTGAAACATTCGATATAATTTAGGCAAAGCTCATATTCTTTGGAGGGTAATGGTGCTTTGTTCATGTTTTCTAATACGTTGCATTCTTTTTTTTTTTTCTTTTTTCTTCCGAAGGTAAATTGCGATACGCCAACAACAGCAATTACAAAAATGACGTCATGATCAGGAAAGAGGTACAGACCTTTCCTTCACTACGACTTAGCCTTTGGTTTCCCATTGCTTATGTTCTCTCTGGTAATGAAAGATGAAGTGTAGGAAGCGAGCACTTATTTCTAAGCAGCTAGATTATTTCTCTGATTCACTCCCCCCCCCCCCCCAGTGCTGAATCAAAAGCTAGTAAGTGTTTGAAATCTGTGTGTCTTGGTTTGTACCCTCGGTGTGCCCCATACTGACCATGTGACCTCAAAACAAGTTCTCTGGCTGAACTTGGTCTCTGTGTTTTCATCTGTAAAACAAAGGATAAGAAAACCTACCTGTGACTCCCAAATGTTATCATAGAATTAAATATATTAGTCCCTAGTACATAGACTATGAAGACAGCATTGACTTTGCTTCTGAAGAGGAAACGGATCAGGGGAAAGTCTCAACCTCGAATTACGCTCTTTAGAGCTAAACCATAGACATTTACTACTACTCTCCCACCTCAGAGCCCCCTCCTGATCCACACACTGGGGAGTGGAAGAAGGCGGGGGATGGGGGTGGCAGCGTACTCATAGATGAGCAAATCATTTTGCCTCCTTTTACTGTGGAAACCCATCTAGGTTCAGAGTGTGAATAACCTCGTTCAAACAATATGTTGTTTAATCCTGATTATAAAAAGCCCATGTGACAAAGTATTCTGCCATACTTTCAATCAGGAAAATCATGGCCTAGATATTAAATCTGAGGATAGTTACTCTTGCTTGTAAGAGATAATGATAGGCATTTGGGCATATCTGAATCTCAGTAAAGGTCATGTGTTCCATTCTGCTGGGATTTCTACTATATCATTAAGGATATGACAGTATGTCTTCATACAATTTAGCAGTTAATTTTATGCCGAATCAGCATCATATCTTTTTCTCTTTGTTTGGTTTGGGTTGTTTGTTTGCATGACCTAGTGCTCCTCAGAAGCAGTTGGTAGAGTGCTTGTCTTCATGAGGCCCTGGGCTTCATCCTTAGCATCACAGAAACTGATCATGGTAGCCATGTTTATATGTCAGCACTGGGGAGGTGAAAGCAAGAAGCTCAGAAGTTTAAGATCACCAAGGCCAGGCTGCGAGGCATGAAACCTTGTCTGTAAGCAGCAGGGTGTATCAGTTGTCTGTTACCACTATAACAATATATCTGACAGAGGCTATTGCCGGATTATTGTCAGGAATGATACAGACCTGCAATTCCATGACTTTGTAGTTGAAGGCATGGGGATTAGAAATTCAAGTTGGACTCAGTAATGGTGGTGGTGATGGTATAAGACTTTTATCACTCGGGAGGCAGAATGAGACGAATCTCTGAGTTTGACGACAGCCTGATATACAGAGCAAGTTCCAGGTCTGTACAGAGAAACTCTGCCTGAAAAAGCCTTTTTAAAAGAAATAATTAGTTCATAGCAAGTTTGAAGCCAGTGAGGCTCAGTGAAATTCTCAAAAATAAAGAAGAGATTATTTAGCTCATCACTCCAGAGGTTCAAAATCCAAACACCGCTGCAGTAGTGAGAATGGGTGTGTGGCCACGCAGTGACCTCTCTCACCAGGAGAGAAACACACAGACATTGGAGGCCCACAATTCCTCTGCTGATATGCTGCAATGATCTAAGAACCCACCATTAATTCCCACCTCTTCAAGGTCTATACCATTTCCCATAGTACCACCCTGAGGACCAAACCTTTAGTCACATAAATGGAGTTGGGAAGGCCACACTGAAATCATGTCCAAGCCATAGAGTAAAGGTGTATCTCTGTCCATTTGCACTGCTATATTAAAATGCCTGAGACTGGGTACAAAGAATAGATTCACCTCTCAGTGAATTCCAAGGCCCTGTCAGGTTGGTTGTGTGGTGAGGACCCCATCTGTTCTATATGGTGTCTTATTGCTGTAGCCTCCCAAAACAAACTTTGTTCTTCACATGACAAAGGGGCGAAAGGGGACCAGATAATTCCCTTGCCTCCTCTGCCCTTGAGCCCTGATCTTTACTAAAGGCTGTGCCTCTCACTCTTCTCACTATTACTTTCTGAGTTGGATGTTGTTGGGGTGCGGTGGTTTGAAGGAGAATGGCCCCTTTAGGCTCATACATTTTAAACTTGATTGCAGGCTTATGTGCATAAAAGTGTGATGGAAGAGTTAAAGAGAATTATTGATGACAGTGAAATCACCAAAGAAGATGATGCTCTGTGGCCCCCTCCTGATCGCGTGGGCCGGCAGGTGAGTGCTTTATTGACTCTACTTTGTACTTCTTACAAAGAGGAGGAGGACTGCTGCTCTATGGGAGGAGGGGTCCCTACAGAACTAGGAATACCCTGTTCTAGGGAATCATTAATTCCATGTTGGTGTTGGGGATGGAACTCAGGTCCTCTAGATGGGCAATCAGTGTTCTTAACTGAGCCAACTTCCCAGTCCTTTATTACCATTTTGATAACTAAAAAAGTACAAGATAATTCCACCTTGTGTGCTACTTACTCTTGTATTCCAGACTTCTGTAGTCTGTGTTTCTCCTGTCTTGTATAGCCCCATGTTTCTATCCTAATGCTAGGGGTGTGGAGGCGGGGGAGGCCTAATTGTGGTGGCGTACACATCTAATCCCAGCACTAGAGAAGCAGAGGTAGGCGGGTCTCTGTGGATTCTAGGCCAACCTGGGTCTGCTTAGCAATTGTAGGCCAATCAAAGTTATATAGTGAGACCCATCTCAAAAAAGCAAAACAACAACAACAACAAAAAAAAAACCAAAACTTTTTTTTTTTTAAAGGAAAAGATTTATAAATCTGACTTCATTAAAGTTAAAACTTAGCTAGGAAGCCGGGCGTGGTGGCGCACGCCTTTAATCCCAGCACTCGGGAGGCAGAGGCAGGCGGATTTCTGAGTTCACACCTTCAATCCCAGCATTCAGGAGGAAGAGGCAGGTGGATCTTGAGTTCAAGGCTGGCCTGGTCTGCAGAGCAAGTTCCAGGACAGCCAGGACTATACAGAGAAACCCTGTCTCAACAAACAAAAAAACTCTTAAAAGTTGTTTGATAAAAGACATTAAGACAAAGTTGAAACAAACCACAGACTGGGTGAAGATGCTTGGAAAATGTATTTAAACCAATAAAAAGATAACCTGGGGTAGGGGAAATGTTGCAAAGGTTACAAGTAGACAGTATATAGATTCAAATAATAGCCAGCAAACACAGAAAAAATTTACAGCTGCAGTTGTAACCTGCAAAAGTAGGAGAACACTTAAAGTCTCACCCAGGTCTTCAAAGGCATAGAAGGAGCCACTACACTGCTGGTAGGAGTGGAGTGTCCGTGCAGCCCCATCGGCAGCCATGTGGATAGGAGCTAACAGAGTGGGACTTCAGACCTAGCCCCAGGGCTGGCACAAATGTTTACTGAGCTCAGCCCCCAGACCTAGAACATTCTTGCCACATCATTTATAGTAACAGAACTTGGGAACTTAGGTCCATTCAGTAAGGAAATGGCATGTTGAGAGCATTTACGTGTTGAGCAGCTCAACGAGGGTAAATCTTAGACACGGTGTTGAATGAGAAAGGACATATACACGTGTGCTGTGGCCATTTATTTAAAAAGCAAGTGGAAGGAATGCACAGCAGTTTTAGGGGCTGTCAGAATAGAGTGGGCGACAGGCATTAACCTGTGTTTCTTTTAAAAGATGGGGATGGGGAGCAGCAGACGGATCAGTGGGTAAAGGCCCTGAGGGCGCACCTGGCGCTATGTTCAATTTCCATAGCCCAAGTAAAGGAGTAAGGAGAGAGCGTCCACAGGTAGTCCTCATCCCTCCATGCATATGCATGCCTACATGCATAGATCTTACACACACACACACTGCAAGCACAAAGACCAGAGTGTGGTTGAGCCCTCGTCCTGTATGCTTGGTGAATGAACCAATACTGTCTGACTTTGAGAGAGATATAATTTCTTCTTTTTTTTTTTTTAATGTTTTTAGGAGCTTGAAATTGTCATTGGAGATGAACACATTTCTTTCACAACATCAAAAATTGGTTCCCTTATTGATGTCAACCAGTCCAAGTAAGCATGCATGACATTTATCATCAGTTGTGTCTGTTGTTGGAGATTCAACCACACGAGGCCAGCAGAGAAAGATGTGCAGACATAACACAAAAGTGGATGGTGTGGCCGGGCGTGGTGGCGCACGCTTTTAATCCCAGCACTCGGGAGGCAGAGGCAGGCGGATTTCTAAGTTCAAGGCCAGCCTGGTCTATAGAGTGAGTTCCAGGACAGACAGGGCTACACAGAGAAACGCTGTCTCAAAAAAAAAAAAAAAAAAAAAAAGTGGGTGGTGTGGTCCTCCTCATAGGGGCTCCAGGTCACAGTGGTTCAGTATCATGGAAGGGTTGGTTTCAGGAATTCTGGTACTAGAGTCTTTAGTGCTTAATTTCCTTATATAAATTAGTGTCATGTTTGCTTGAAGCCTATGTACTTCCCATATAAGTCATCTTTATAAAACCAAATTCTGGGAAATAGCCGTTATAATGTATCGCTTAGGAAATGATAAGAGAAAATGTCTGAACATACATGTGACAGTTGGAAACCCCATAGACCTAACTATATCCACTCATGGCTGAGCCCACAAATGCAGATAGAGTTGGGCCAGTTGTATTTTCAGAAGTTGCTTCTTGTAGTTAATGTAGTTACTACTTCTCAGTGACATGGAAGAATAAATAGTGACAGCTGCTTCTCAGTGACATGGAGGAATGTGTAGTGACAACCAGAAGAGGAAATGACATGAGGCCACACAGTGCTGTGTGACCCTCACTGGGCGAACAGCTTCTCTGTGCTGACTGTTCGGACTAGCTCATCTTAGTCTTGGTGAAATTTGAAATCTTGCATCTAAGTTTTAAAATGCATGTTGCCAATGGTGTGACTTCTAACACTAGGATGTGATTCTATTTGCTATAAAGAACCTTAGAATTTGGCAGGCTCTCTGCTTTCTGGACACACTTGTCAGTGCTGCTTGCTACTTTAAATTTTCTTCTTCAACTCTTAGAACAATAGATGGTCATTGTAGAAAATACAGGAGCTATAGAAAAGAGAAAGGGGGAGTTCTTTCATATCCTTAATAGACAGCCAGTGATAACATCTTTTTGGTTTCAGAAAGGCTCTTATTATCTAGCTATGACTGTCCAGGAACTCAGCTATAGTGGTCAGGCCAGCCTTGAACTTTGAATAGAAGCATGTGTGTCTCCTCTGCCCAGCTCTACCTAACATCTCCACGTGTAATGTCTTAGTCTTAGAGAGCACCAGGAGCTGAGGCAGGTGGTGCATGCTTGTAATCTCCAGTACTCGGGAGGAATAGCGCAGAAGATCAGCTCACGCTGCGAACCCGAGATTGTGTTACTTACTTTGAAATACCCTGCCTTTAGGTGTGGTGTGGCTCAGCCTTAGCACACACCTGTAATCCAGGAGCTTTCCGCTTGAATATTATAAACATGATTAAGTCGACCATAGGCCAAAAGGCAGAGCAATCAGTTGACAGAGAGTGAACATAGGAAAAAACTAGAGAGTAACAGGGAGTTGGGAGAGCTGAGAGGTGCAGGACGTAGAAGGGAGGGGCATCCAGTTTGAAGGAGGAGCTTCGGAGACGCTTCTAGGACATTGGTTGATGAGGAACGTCAGCTGGGCGCTTTCTCTGCCCCTCTGAGCTTTCACTCCAGTATCTGGCTCTTGGAGGCTTCATTGATAAAACCAAACAATTCAGATTTTGTTTTAAAGAAACAACATAGGAATCTCATGATTGAGCCATTCTGATGTGTGTATATATATAACAAGACCCAGCCTCAAAAACAAACAACTTTTAGCCCCCTCACCCTGTGTTGGGGTGGAGGTAGAACTCTTTGTTTAGGTTTGTGGTACTAGGAGTTGAACATAGAGCATCTATCCATCACTGACCTGGTTTCCAGCTCTATGTATAGTTTTGTTTTAAAAGCACAAGAGACAAAATCTGTTTTAGAAATCACAGTTTTTCCCCTAAACTTTATATATTTTCACAGTAAAAACAGCATGGCTTCCTAATATATCATTTTAGTAAGTGGCCCTTGTTAATGGACATGTGCTTCCTCAGGGTTTATTACTGTAAATATCTTTATAAGGAGCATTTTTATAGTAATCGGGGTTATTAATTTTTTTTTGGTATTTGCCAGTTTTCCTCTGCTTCTTAAACATTTTGGTTTTCTTTTGTGTTTTAGGGATCCGGAAGGCTTGCGAGTATTTTATTATCTTGTCCAGGACCTGAAGTGTTTAGTCTTCAGTCTGATTGGATTACACTTCAAGATTAAACCAATCTAGATATTGGATATTGTGGACACAAGGCGGGTGGGAGTTTTTAGTTACCATAATTAGGATTTTTTTTCTGTATATTGGGGCAATTTTTATAAACAATAAATGATGATCTTTAATAAATGCGATAACATCTTTTTTTGTTATTTTTCTAAACACCTGAATATGTGAATTCTCAGTCTGTAAGATACAAACATTCTGTGGGAGACTTGACAAAGCAAAGAAAAAAACAAACCTAAGCAACTAAGAACTGCCATTTACAGGAAATGATGGGGAAAGGTTTAAAAATTCAGTGAGGGCCAAGGAGATGGTTCTGGCAGGAAAAGCTTTAATGCATAAACTTGACCACTACCCACAGCCCTGGGACCTATGCTGGGCCTGGACTAAGCCACCCAGGAGCAGAAAGCGATCCTGTCTGAGCAAGGTGGAAGGCAAGAACTGACTCAGAACTTCCACCCCTTTGCTGTGCCATGGGTGTGCGCTAGCACACACACTGCTGAATATTTTTTTCAATACATTGAAGTTGAGAACCCCATTAGCAATATTCTAGGACAAGGTACCTGGGTTTTGTTTTGACCACGCCTCCCCTCCCTTTCCTGTCCAGGATGACTTTGAACTTGGGATCTGTCTCCCAAGTGCTGGGATTTTAGGCAGGTGCCACCACACATAGTTCAACCTGGATTTTTAAGTTTCAAGGGAAATGGAAACCCTGAAGATTTACAAGATGACTAATTGCTGGAGTTATAGCTCAGTAGTAAAACACCTGACTAGCATTCATAGCTTCTTGGGCATAAAATTTTATTGTGGTTGGGCATTTATTTTTTATTTATGTATATGGGTACATTGTAGCTATCTTCAGACACACCAGAAGAGGGCATCAGATCCCATTACAGATGGTTGTGAGCCACCATGTGGTTACTGGGAATTGAACTCATGACTTGTAGAAGAGCAGTCAGTGCTCTTAACCACTGAGCCATCTCTCCAGCCAATGGCTGGGCTTTTTAACATATCCTTTATTTCCGTATGAAGGAAAACTGTTCAATAGGTAGATTGGCAGGAACTTTCTCTTGCCATTACTTAAATTTCATGGCTTGCTGAAAATAGCTGATTAGATGGCATCAGAAGGAATGGGACTTGATAGGGTTCATTGGTCTGAAGGGACACGAGCCTAAATACATATCCTTAGAGACATTCCATTCTGAGACAAGGTCCCAAGCATCCTCAAGACTTTTCATACTCCGTTAGGGATATCATTAATATGTGACATGTCAGGATGCCAGACTTCTGAGACACTTAAAGACCAGTCTGGTGGTGTCCAACAGGCAGGGGGATGGCTCAGCGGTTAAGAGAACTTGCTGCTGTAGTAGATGACCTCATTTCTGTTCCTAACATCCATAGGGTGGCTCTATCAGTGTGTCACAGAGTGTTGCGGCCGGCTCACATGTCTGGGTTCTAGCCTGGGAGGCATCTTGGAATCTGGAAGAGAAGAGGGAGCTAGGCGGCGGGAGAGAGAATGGAACCAAGACAACTAGTCTGCTCAAGGTTCAATTTTACTATTCCCAGGCACTGGTTTATGAAGAAGGGGAAGGAACCCATTCCCGCCAAATCATCCTTGGAGTCCAGTTTCAGGTGACAACTTGATTAACTCCGGAACTGCTAGGCGGCAGGCAGTAGCAGTGGGAGTGGTAGAACGATAAGGTGGCAGGCTCCAACCCCCCCCCCCATGCTCTCTTCGTGCTATCAGTGAAACCTGTTCAGCCAGGTTTCAGGCTGAGGGGGGGGAGGGTACAAGAGGGTTATTTATGGTGCCCTCTTTTAGCCTTGGTGGGAGCTGCATGCATGTGGAGCACATACATACTACCTGCCAAAACCAAAATAAAATTTAAAAAGACTGGGCCATAAAAGTGGGAGCCAAGCATGGTGACACACGCCTTTAATCCCAGCATTCGAGAGGCAGAGGCAGGTGGATCTCTTTTGAGTTCGAGGCCAGCCAGGTCTACAAAGCGAGTCTAGGAGAGCCAGGGCTATAATTACACAGAGAAACCCTGTCTCTAAAAAATAAAAATGGGGCATGTTTTCGAATGTTGGTGCTCCCAGCTCCTGCAGTGTCGGTTAAATATATGACTAAGGTGGGGGAAAGTCAGCTCTGTTCAGGCATAGCTACCACGAGGACATGGACACAGGGCAACCCTGTGGGAAAAGTCGCAGCATCAAATCGTGTACATCCAGTGGGCAGTTTAGAGGGCGACTACCCATCATCTGGGAGGCTGCAGCGTAATCTGAGCCTCAGGACCACAGGTAGTGAGAAGTCGGATAGAGAACCGAGAGCCTAGAGAGGTCTGGCAGAGGTTTCCAGCCCGACTATCTTGCCTGCTCAGTGAAGGCACAGATTGAGAATCAGGAACCATCTCTGGCATTTGCGTTTACATCGGTTCCAGCAAACCTACCGAAAACAGCCGAGCCCGGCAGGTTAAGGAGGGACAAGCTAGAAAACGCCAGCCTACAGTACCACTCACTAACGCCCCGCTCCCCGCCCACCCGCACTGAGGCTGCGCGGCGACGCCGGCCTTTTACGACGGGTCGGAAAGCAGCTGTCGCAGCGACTTAACGTGGACCGGCAGCTATGGGGGTAAGGAGAGGCTAGTCGCCATTGGGGCATCCCGTCTGGTAGTAGCCCAGTGAGAGATGGGTCCGAGGCGGCGAGGGGCTCAGAGTGGCGAGCTCAGAGCAGGAGAGAATGGAAGGCGTGAGGCTCGGGTGGCGGGGCTTGAGTCGGGAGGGGCGGGGTGGGGCGTGGCACGCAGCTGAGCGGACGAGGCCTTGCACTCAGCGTGTCCCGCCCTCTTCTCAGAAAATCGCACTGCAGCTCAAAGCCACGCTGGAGAACGTCACGAACCTTCGGCCAGTGGGCGAGGACTTCCGGTGGTACCTGAAGGTGCGACGGAAGGCGGGTTCCTCTAGGGAAGGGAGGAGCATCCGGAGGCAGTGGGGCATCTTAGGGCTCAGGGCCCAGCCTTGATCACAGTGTTGAACTGGGAGCTTTTCTAAAAGTTCCACCGGGTCTGAGGTGCTTAACCAGGCATCTAAGTGAGATCTTCAGGATGGAATTTTAGATTTTATTTTTATTGATTAAACGTTAGTCTTATGTAATCTAGGCTGGCCTTGCGCTCTTTATGTAGCGAGGGATGACTTTGAACTCCTGATCTTCTTACTAGGATTACAGATGTTCGGCCTCCTCACACGGTGGAGTTTTGTGGTTTTATCCCTCTTCTGTTCTGGCGGGTATATCTGAATTTGGGGCCTCACGCTAGCACTCTCCTGATGTGAAATCCTTCCAGCTCTTAGTTTATAAACATACACGGAACAAAATATCATTTGAAGGGACCCTGTGCTTACTTAATATAGTGAATAAACCCACCTTGTTTTATTTGCTGGCTTTACTTATTGGGAAAGTTGGCCACCCTTTGACCTCACACAGTGCTAGTAAACTGGGTAGGTACCCTGCCCTAGAGGCCCAAACAGTGTGACACCCTTCATCGTCCCAGGCTGTGCTTTATTCTCCTAGTCTATCTCAGTGCCTCACATACCCAACCAAAGCCATAACTGATCACTCTTATTCCGCCACCCCCGCCCCAGCACTAGACAAGTGCAACACCATCGCACCCACAGCTCCTATTTCAAAATGTTTGGAGCAGGAGTTCCAGGGCCCATCTGAAGAACTTTGACTTGAAGAAACACAGAATAACAAAGGAGA
D3_15 107566267 107581317 15051 AGTCTTTAGACAAGGGAACTTCAGAGACTGTAGTGTGCCAGAGTCCGTTAGTAAGCAGGGGCTGGATTTGAACCCAGGTCTGTCTGAATCTTATAGTCAGTGCTCATCCTCTTGTTTGTACATTTTTACTCACAGTAAATCTGTGGGGTAAGTTAGAAAAGATGGTATCGGCATCCCCATCTCATAAACAAAATCACAGATAAAAAGTTTAAGGCCAGCCTGGAATCCCTGAGGACCTGTCTCAAAAAACAAATAAAACCCAGGTTCAGAGCCAGGCATAGTGCATTCCACCTATAATCCCAGCACTCAAGAGGCTGAGGCAGGTGGATTTCTATTGAGTTCAAAGACAACCCAGTGTACATAGCAAGTTCCAGGAATGCCAGATATATCAGAGAGACCCTGTCTCACCAAATAAATACCCCACAAACTAAGGTTCAGAGAGGGAGTGGGGTGCATACCCAGGTCCTTGAGCAGATAGAGTGATGGGAGAGCTTACCCCCACTCCGGCCTTTAACTTGGTTTTTTGATAACACAAACTAGAACCACCTGAGTAGGGACCCTCAACTGGAGAACGGTCCCAATTGCTATATAAGAAAAATAGCTGAGGCTAGACATGGTTACACACCTTTAATCCCAGCACTTGAGGGGCAGAGGCAGGTGGATCTCTGTGAGCTCAAAACCAGCCTGGTTTACATAGTAAGTTCCAGGTCAACCAGAACTACATAGTGAGACACTGTCTCAAGAGAGGGCGTACGGGGGAGGGAGAGAGGGAGGAGAGAAGGAGGGAGGGAGGGAAAGAAAGAGAATATGAGAGAATGAATGAATTGGGGAAAGGATGGGAAAGAAAAATAGCTGAGCAAGCCAGGAGGCACTCTTCCTAGATGGCCTCTGCTCTAGTTCCTACCTGTAGGATCCTGCCTTTGTGTCCCTGGATAATGGGCTGTATGAAAAGTTAACCCTTGCTCTCCCAAGTTGCTTTTGAGTCCTGCTGCTTATCACAGCAACAGAAAGGAAACCAAGGCAGTCTTCTGGGCCAGGGCTGTAATTTAGATACCACAGCAGTGCCGAGTAAGTTGGGAACCCGAGATTTTCGGGAGCAGCTGTTGTTCTGAGGTTGCCTTGAGGGCTTTGCTAGGAAGAGCAGCCCTGGGCCGGTCCTCACAGGCTCCTTCTTTCCCCCACCCTCCCTGCTGCCTTCCTGTCTCCTGCAGGCTGGGTTTGCTGCTGACGGTGTGGAGTCAGGGACAGTCTTCAGTGACATTAATCTGCAAGAAAAGGTGAGACTTGGGGAGCCTGTAAGGTGTTCCATGGTACCTGGTGGGAATTCTTTTCTGCGTTAGCTCCAGATGTTTGTGCCTTTGGTTGGTGATTCTGCTATGGAAATGGCCATAAATATAATGTTTAAGGGCAGTGGCTAGAGTCCAGCTCTAGCAGGCCAGGGTTCTGAGGAGGACCTGTGAAGGTGGCAGTAAGATGATGCATAGACGTGTTATGGTTGAAGCAAGCTTGTATTTCCTCCTGTTCTCGCTAATGTTATTTTTTCTCTTATTCCTCATATACTACTCATAACAGAAGTCTTTACACAGAAATCACTACATAATAAGTCACATATTTCAGAAAACAAATTTCCCCAGAAGCCCACATGTAGTTAAACATTCGCCCCCACCATCTTTCCTACCATAATCACATCTTTATCCCAAAGCAGTAATGCTTTTATTATTGATTAACAAAGTTTATGCAGTCAAAGTATATTTCAGCCAGTTTTCTTGTCCTGGCTGGCAGCAGTTTGTGGTACCGTGTGGCCGACTGGTGTTTTTGTTCTAGTCTACAAAGCCTTGCTGAGCTGACCTTGCTAACCATCTACTTTCCTTCTCTTTCACTCCCAACAGGCTCATGTGTTTTCCTCTTACAACTGTTTTCTCCAGGTGCATACCAAAAACCTGTAAATATGTCTGTAAGCTACATGACAGGAGACTCAGTAACCTTAGTTACAGAAACATAATTGCTTTTTTGATCATTGGCCTGGCTCTCACAGGCAAGACACGTGGGCTAGCAATGCCCGAAATTTCCCTGTTCTTATTTCCTACTCCTGTAAATCTCACATCCAGCTGGAAAAAGTTTTTTTTGTTTTTTTTTTTTTTTTAGTTTTATTGCAATCTTCTCTAGATCCCTCATAAGCAGCCCTGGCCACTTGTATCTTTAAACTATTCTCAGAAAGTTCAGCTGAGTCTTTAACCCATCTAAACAGCACTGTCCTGGGGAGACCGTCATCGCACTTAAGTGCTACAGGTAAACTGCCCAGAGAGGGGTGGGACTCTCCCACAAAATAACCACACTACCACAAACACAAGAAGAACATCCAAGTATGAAGCATGATCAGGCCTAGCAGCAGCAGCAAGAGGCACTCTGAGCACCATCGGGCCTCTGCCTCTCCAAGGAACACCCATGGCTGCTCTGCTGAACGGTCACCCGAACTCCATAAGCTTCATTGCTGACTGCAATTCCTCCAGCATGGTCACCACCAGGCGATCCCATGGTTATGCATGCAGGAAGGCTGGTGTGCCTGACATGGAAAGTGCACAGTAGATAAGCTTCATTTAGGCCCACGTCACAGTGCTGCTGGCTGAGCAATATAAATATAGTAAATATGCTACTCTTAAACAAACCTATGAAGCAGAGGTGTTTACTGGTTGATGAAAGTTGTGTGACCAGATGCTTATGAGAAGCTAACTCTGTTTCTCTAGGAACAGTAGCTGAAGTGTTTGCAGTGATCACTGTAGTATTGATTCAACCCTGTAGATAGATGAGTCTATTGCTCTAGCTGGGAAGGAAGAACACCGGCTCATTCTATTTACCTGGCTCCTTTTGACAGCAGTAGGTAGCATTCTGTGCCCCTGGTTACTGTGCTAAGTGTGTTTTCATACAAATGGAAAATGAAATGTTTCATTTCATTCTTTTAACATTCACTCTAAAGTCTCCTGTTTTTCTTTTTTAATAAAGGAAGGAACTCAAGTTTGGGAAAATGACATGATTTTCCTGGTTAGAAGACCAAGAGATGGAGTTTAGGCCTGGGTGGTCCGCTTAAAGGTCTCCTGCGTTCATGACTAGCTGAGTCAGAGCCTGGATTGGGCTTTGGAACTTCTGGTTCTCCACTGTCCACATTGTACTGTTCTGCCTTGAAAGGCTAATGCTGCCTTCTTATTTCATAGGACTGGACAGACTATGATGAAAAGGCTCAGGAGTCTGTGGGGATTTTCGAGGTCACCCATCAGTTTGTGAAGTGCTGAACTGTCTGCCCGCAAACTTGCCTGTAAGAACTAAGGAGAGACACAGCGCCCTGAGCAGCAGTTCCCATGGAGGCTTCTCATCTCTGCTCTCCTAGCACCTGTACCAAGTCTGCATGCCAGGGTTTGCCGCAGTTCTAAGTCCCACCAATAAAGCCCCTGTTGGTGCCACAGTGCTGCGTGAAGGTGGTCTGAGAAATACTCCCTCCATTAATAAGATTGGACTCTGGAGGTCTTTGCTTTCTAATCCCTATTCTGTACCTGATCCAGTTTGCATGTGGCTTATATAAAGGCTCTCTATCTAGCTCTTAAGAAATAGGCAGGTCAGCCTCCAGGATCAAAGGCATGAAAGCACAAATGGCAGAGAATCCTATGGAGTGCTGCTGTGAACCCAGTAGTTCCAGCCTAAAACACTCCCCGATGATGATGGCACCTCCGTTAGCTGCTCATCTCACACCCAGAGCTCACTCTATAGACCATCAGGCCACCGCGGGCACATACCCATCTACTCTACAAAGTTCCTGGCTGATGGCTCTGTTCACTTGCTGTGATAGAGTACTTCCTGTCAGAGTCAACATGAAAGTTCTGTGGAATCAGACTCTGCATCCCCTGAAGCACCTATTGCTGGTACAATGTATACCCTGTTCTACCTGCAGACAACTCTTGGAGTGAAGACAGCAGTCATTGCCTCTTAAGTCTCGTGGGACCAAAGATCCCACACAGCAGACAGAGCTATTGAGCGCAGTACTAGGCAATAAGTATGTTGTGCCTTCATACCTGGGAAACCTGTTTCCACACACTATTTCTCCAATATTCTACTGGAGAGAAAAAAAAAAGATTGTATTTTTAAATTATGTATACTTGTGTGTATTTATGTGTAGATATGTGGGTGTGAGTGCAGGTCAGGTGCCTTTGGAGACCAGAAGAGGACGTCCTGTCTGGAGTTACACACTATTGTGACTCACCTGATGTGGATCCTAGGAACCAACTTGGGTTTTCTGCAACAGCATTATGTGCTCTTAACTGCTGCGCCATCTAGTCTGTAGCCCATGTGTTCCACTGCTGAGAGAAGAAAATGGCATGCTGTCCCCAGGCTGGGTCAGAGGGTCTAACAGAGGGAGCTGGCAAACTAGCCACATCTGAGAATGGCAGGAAGGTCCCTGCTTTTCCTCCCTTCGAGTCTGGCAACCATGTTGAGTATACTAAACCCCCTGTAGAAGTTTGGTCTGGTGCTTGCTTCCAGTCCCATGCGGTGTCTGAAGAGAGACCACAAGGAGAAGGGGAGGAAGAAGAGGAAGTGCCATGGGAAGGTGGATCGTGAGCGCATGGCCCTGAGCCCCATGCATTGGAATAGGAGAGGCCCAAGCAGAACATGCAGGTGATATCTCGGGGCTATTTTTGTGTCTTACTTGGGAACTAAATGACCCAAGGAGGAGTAGGAACCCCTAATATTTGCTGCAACAGCCATGTTGCCTGCTTCCTGGGTGCTTCTGTAACTGACAGAGAGGGGTTCCAGCCTCCCTCAGGGCAGTCTCTCTCTCACCAGGCCCAAGCACAGTCTACCCTAGAAGCAAGCAGGCAGCTCTGGACTGTGGAAGTAGCTTTTCTTGTTTCTAGTCTCTATTCAGCCCGGGTGTGTTTGAGTTCATGAAATTACTCTTGGTTGAAGAAGGTTGGGGAACTCAAGTAGCCATCAGGAAGTGAGGGGAAGTGAAGTAGGTTATGCAGCCAGGTAACATTCAATACCTATTTAACCAAAACCACAACAGAGCCCTTAATAGACGAAGAATTAAGAGAAAGCCAACAGCAAGGGCTGCTTATGAGTGAGGAAAGGTCAGGGTAGCGAGGACTCCCTGTCACTGCTTCTGGTGGCTTTGCTGGGTCCTACCAGTGTGATGAAAAAAGGGTGAAAAGAAGAAAGAACTTAGTAGAAAGTACAGAGGAGTTCAGAGGTGCTGCTAGATTTAAGATCTGTGGGGAACTAAAGGCATTTCAATTCATTGACAAGTAAAAATTCAAGAAGATGTCTCTTACAGTAGCAGCCTAGGTGGGTGTCTTTCAGGGACAGAGCATGTGCAGAGCATGAAAGAATCCTGGTTATACTCGAGGACCATAAAAAAATACAACAGCCAGAAAATAGACCCGCTCCCCAAACTAACAAGGATTTTACCTCAAATTTATAACAGTGGAGAATACTATTGAGCTTCGCTGAAAGTCATTAAAGATCCATGTTATGATCACAGATAAGTAGGCAGTGTTCAGACACTCATTTTCAAAAACTTTATAAATTTAGTTGAAATTACTTGTGTTCAGTAGAACAAATCAATTCTGAAATCCCTGTGAGTCACAGATGGGAGACTGGTGTAGCAGATGCCCCAGTGTACAGAGCAGTGGCAGCTAGCCTTGTGATAGCCAAAGAGATCAATAAACAGGTTAAACAGACCTAGTGATGAAAAACATTAATGACAGATGGTGTTGCAAATGAACATGTTAATTATTAACTGTGTGTAAAGACATGATAAATTACAACGGGGCAGGTTAGAGCCCTACTTCACTCTGCACTGAATACATGTTCCAACCGAGGCTTGGAAGCTTGGGTGTTGGATGCTGACCTATGTGGGAGGAGTGGATTACTGGGCTCGCATCTGCCTCACTGAAAACCCTGGGCAAGTGTCTCCCATCTTGGGACCTTATTTTCTTCATGTAAACAGGACAGTTTCAGCTCTGTAGTATGTTACTCAATGAGATCAGTCCAAATGCTGCATCTGAGGACATCAGAGCACACATGCTCCTCCCATACACAAGCCTGATAACCTGCCCCTCCTCATCAGGCCTACGCACTGTACAAGCTGTAAATAAGGTAGTTTCGGGGGTCTGGGGAGATGACAAGATGGGCAGAATAATCTGGAGGTCAGAGGACACTGCAGGACTTGGCTCTCTCCTTCTACTATGCAAATTCCAAGGATCTAATTCAGGTTATCAGGCTTGCCAGCAAGTGCCACTCCATGCCGAGCGAGCCACCATCTCCTGAGTCCACTTTTTAGAATATGTATGTGCATGGGAGGGACATGTGTGCTGTGAGGCATGCACGTTGGTCAAAACATGACTGTAAGTCTGTTCTCTCCTCCATGTGGACTCCTGGGGACTGAGATCAGGCTGGTGACAAGCACTTACCCACTGAGACAGCTCACTGCTCCCAACTGTTGGCTTCTATTTGGACTTTAAAGGTGCTTGGTCTCCCCTTGAGCAGCTCCCCCCGCCCCACATACCATCTTTATGTGTATTTTCTTAGCTAGACTGTGCGTAAGCTTGGCTTTTTGTGAATGTGTTGTGGTTGTGGTGTACTGGGCTTTGTGCTTTGTGTACAACAGCCTTTTCTACTTCTCAGAGCTTAATGCCCAGGGACTCTGCTTAGCTGACTGTAGCAATCATTACACAACACTGTCCTAATCCATGTGCCAGTGGGTGAGCCCTGGGATGGGGGTGGGGAGTTTTCAAGCCAGGCCTGGGGAGGACTCTGTGAGATACAGTTGTGCAAAAAGTAGTGATTTAACCAAGGGAGAAACACTAGGGAGGTGAGGAGAAGGGGCAGGCATGATCGGCTTTTAGAGAGCCAAGGAGACAACCCAGCTCCATCAAACTCGGCACACCCATGTTGGGTACAGTAGCATAGACAGGAGGCACTAACTTAGCTTTTCAGAGCCCTCAGTCATCTCTCACCTGTTCCACTTCCATACTGTGCTGGATAGTTCTTGTCAACTTGAAAAACTAAAGTCATCTAAGAGGAGGGAATCTCAATTTTAAAAATGTTTTCATAAGATGGGGCTCTAGGCAAGCCTATGGGTATTTTCTTAATTAGTGACTGATGGGGGAGGGTCATGCCCACTGTGGGTGGTGCCATCCCTGGGCTGGTGGTCCTGGGTTCTATAAGAAAGCAGGCTGAGCAAGCCATGGGGAGCAAGGCAGTAAGCAGCACTTCTCTATGGCTTCTGCATCAGCTCCTGCCTCCAGGGTCCTGCCCTGTTTGAATTTCTATCCTGACTTCCTTCAGTGGAACAATGATAAGGAAGTGTAAGCCAAATAGACCCTTTCCTCCTCCTGACTTGCTTTTTGGTCACGGTGTTTCATCAAAGCAGTAGAAACCCTAGCTAGGACACAGACCCTGGAGCTCTTCCATGAAGCCTCCCTGAATCTCCCCACCCAGTAGCTTGGTAAGGCTGCCTCATAATTCTTAGGCCTACCTAGAGTTAACGGGAGGTCCTGCTCTCCCCTGCTGAACTTGCTCATGCTGGCTCCCTGAGTCAGGAGGGCTCTGGGCTGGCACTGTGGCTATAGCTGCAGCAGATGCCCACTCCCTGAATAGGCTCCATCTTCTGCGCTGTGTGCATTTATCATGGAGGCCTTCTATCAACTGCTTGCTCCTCGGGCTTTAAAGCCTTCCTGAAGTTCACTAACATACACTTTGGCTGTTTTGGATGAAAGCCTGACACAAACCTTACCATATTTAGCTTTAGTGACCCAGACCGCCTCCTCCCTCCCTCCCTCCCTCCCTCTAGTTCTCTCTCTCTCTCCTCTCTCTCTTCTTTCTCCTCTCCTCTCCTCTCCTCCCCTCCCCTCCCCTCCCCTCCCCTCCCCTCCCCTCCCCTCCCCTCCCCTCTCGTCTGTTCTGCCTCTCGTCTAGGCTGCTCTCCTTCGTGACAGATACTTTGTCCTACCTTATAAAGTCCCTGCCTGCCCCACCACAGGCTCAGCCAAGCTCTGAAGCTCCATGTCTGTCTCAGGTCCTTGGTAAAGGCAGTTCTTCCTAAGGTCTCTGGTGGGCAGAGGCCTATTGACACCAGTCAACTGGACATCACACACTGCTTCCCTCAACAGAGCTTGTCTCTCCTCTGCTGTCCTCTGGCCCGATATCCATGGGGACTTCTACTGGTGATGACCAACCCTCTCTAATAGCTCTAATGAACCAGTCCATCAGAGACCGAATCCCCTTGAATTGCCTCAGGCTATGCAGCTGTCTCAAGGACTGGTGTGTGGTTACACTGCCCAATTTCTCTGCTTCTGCAACACTGGGACTCACCTCCATCTGTCCCCATACCCACAGCCTCACAAGCCAGATTTTTTTGTGACCAGGTTCCTCCCAGGGGTACCAGATTTAGGGGTTCCAGTAGGGACTGTATGTTATGGGCCTTCTTTCCTTTTGGCCCCTTAGCCATAGAAAACACCTCCATTTTCCCATCTGTTTTACCTAATTTACTTGCTTAGTCAGGAATGCCAATGCTAAAGCCAGTCTGCCTCTGGGCTGTCCCTACCCCTGGCCTCAGACGGATCTTTTGTTACCCACCGCAGACACTTGTTGATACCTCTACCCACGGTGTGCTACTCCCAGGACTTGCAATGCCTGCTCTAGACCATTGGCAGTTCTCAAAACATCTTGCTACTTCCATCAAAACCCCAGCCATCAAGCAGTAATACCACTCCATACCGCCTGGTAGAAGCCTGCCACCATGGGATTCCCCCACTGACAGCTCCTGCCCTGCTGGCCACACCTTAGTTACACATCTCACTACTTTCTGCACTGTCCATGCCTGGGCCACTATTCCTACAACGCCCTATAGGTAATACCACCATGCCAAAGTTTCCTCCACAAACACCAACCTCCAACCCCAATTCCCACAACTTCACTTCATCTGTTTGTTTCATTCCTCATATGGGGGATTCCGCTGCTCCTCATAAACTCATCCTGTCTGTCACACCCTACTAACTATGCCAAATGTTAGAATGTATTCCCAGGGGAAATGTAAGCCACACATACCTACCTGCCCCTTTTCCTAAGGTCCCAACAACACACTGAAGCACAGTTCCACCACAGTTTACTCTGAGGAGCTAATGAGTCTTTGGGCTTCCTTACAGCACAGGGGTGAGAGGTTACCTACAGTGGTGTGCCTTCTCTTCCAACTGGTCATACCTGGAAGGCTTCCCTGTAGCTGCACAGATGGAGTGCCACCCCATTCCACCCCCTCAGGCGTCCCTGTCTCAGCTGCTGGCCCATCTCCCTGCCACCTCATAACGGCTCAGTGGTTAAGAGCAATGGTCTTCCAAAGGACTTGGATTCAATTCCCAGCACCCACATGGCATCTAACAACTGTCTGTAACTATAGTACCAGGGCATCTGGCACCCTCACTCCAATGAACTTAAAATAAAAATAAATTTAAAAAAATAAGCAGGTGGTGATGGCCTAGCACTTGGGAGGCAGAGGCAGGTGGATCTCTGAGTTTGAGGCCAGCCTGGCCTGCAGAGCAAGTTCCAGGATACAGAGAAACACCGTCTTAAAAAGAAAAAATAGTCGGGCATGTTGGCACATGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGCAGATTTCTGAGTTCGAGGCCAGCATGGTTTACAGAGTGAGTTCCAGGACAGCCAAGGTTACACAGAGAAACCCTGTCTCAAATAAGAAAACAAAACAAAACAAAACAAAACAAACAAAAGAGCCGGGCTGGTGGCGCACACCTTTAATCCTAGCACCCAGGAGGCAGAGACTGGCGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAAAGTGAGCTCCAGGACAGCCAGGGCTATACAGAGAAACCCTGCCTCGAAAAACCAAGAAAAAAAGAAAAAGAAAAAATAATAATTATTTAAAGAAAAACTAAAAATATAAACAAATTCTAGAAAGAAAAAGAAAGAAAGAAAAAGGAAGGAAGGAAGGAAAGAACGAACGAACGAACAAACTAGAGTTTCTTCCCTGGCTAGAGAAGAATAAAATGAAGTAGTCTTCTAGCCATGGACGAGCTCCTGCTCCAGCTGGAGTGCTTTTAAATAGACTGAATCCCAAAGACCAGGATAAGCTTACAGGCAAACAGGACCCATGCCACCCCAAGATTGGTACCCCAAGGTCACTGTGCAACCTGTACATGCCGTTGGAAAGTCCTTTGGGGGATTAGGAAACAAGGTGGAGGATAAGGAAAAAGGAACCAGATCTGCAAGCAACACTGGGTTTATTTCTATTTAAACAATAAATACAGCTGAGTTAGCTTTCCAACCCGATCTCCTTAAGAAAGGGCTTTAGAGCTGCAGTCTCTCATTACCTTCAGTTGGGATCTTCCGCTCACACCTGCAGCACTGGCTGCTCAAGCACCAGGAACTAGTTTTGTTGACAAGATGGTACCTTCCAGCTACATGAACACCAATGTTCATGAGGAAGAATGGAGGCTTTTCATCGACCAAGAAGCTAAGTTTTGATGGCTTTGCCTTCGAGGGCATCGAACATGTCTTCCAAGCACTTCTGGACACAGTGGAGAAACTCTCGGGCATTGCGTCCTGAGTAGGAGGAGACATTGCAGCCTATCCAGTCATCGTGAACAGCATACGCAATGCCAAAGCCATCAGGGACCACAGGGGCAAAGCCACCGAGGCTCACTGCTGGGCTGCTCAGAGTGCTGGTGGACAGGATGTTGTGGTTTATCCGCTGGTATGCAGGGTCCTGATAGAGCTCAGGCAGGGTGACCCCTCTGGCTGCTGCCAGATACCGTAGAGCAAACAAGTGTCGGTCAAAGCCCTGGCCTGTCAGAGACAAAATGAAAATTCAGACTCTCAGGACCTCACAGTGAAGACCCCCAACTACAGTAGGAACCACTACACAAAAACTGAGAGAAGGGCCTTCTCTAGCACTGCACGCACGCCTCCAGCTTACTATATTCTCAGCTGCCAACAGATGGGCTAAACATGAACCTAACATGGACACATGAGGCTAAAACCACTGAACGCGGTACATAACTGTACTCCCAGCACTAGGGAAGCTGAGGCAGGAGGATTACAAGTTTAAGGACAGCATGGACAACGTGGCAAAAACCATGTGTCAAAAACAAATGAAGGCCATGCATGGTGGCACACACCTTTAATATCCCAAAACTCAGGAGGCAGAGACAGGAGGATCTCTGTGAGTTCATGGCCAGTCTGGTACACTCATTGATTTTCAGGTCAGCCAGGACTACATAGAGAGAAACCAACCAACCAAACAAACAAACAAGGGCTATAGAGGTAGCCTAGTGGAGCATTAGTTGCAGATGGCCTGGTTCAATTCTCAGAACTGACATGGCGGCTCACAACTCCTGTAACTCTAGTTCCAGGTTATGATGCCCTTTTCTGACCTCCACAGGCATCAGGAATGCACATGGTGCACATACATACAGGTTCAGCAAAACACTCACACAATAAAATAATACATCTAAAATAATTAAACAAAAAGACTGAATCATTTCAGAGCCAGATGGTACAATGAACTTCACAGCTGAAATAAGGCTCAATGGGTAAGGCCCTGGGTTCATTCCTCAACAACAACAACAGCACACACACACACAAACATGTGCCTCACCCATGCCTTGCCCATCACTGCTTCTTGAGTGGGTAAAGAAAAGAAAACTCAAAGTTCACACGTAACAGACTAACTGGGTGGGAAAGCAGTAAGGACATCTACCCAGGGTTCTAATCTCAACCATGTGTAACCTGGGCCAGTGGCTTAGCTTCCTAACTTAAAAGTGGACAAAGAGTAACTACACGCCTTGAGCACTTCTTCATTCCAGGGTGCTATTAAATGCTACATAACAGGACTGGACTATGAGAATCCTCAAAGTTCTTTCCAGCTCTTGAATTTTATCACAAAGATTTGAAGGTGTTAGACCTAGTGGGGAAACCCCCACTCAATTGCCGATTCAGCGTGCACCCAAAAATCACGAAGGACCATCTCTTGATGTAATTACATGAGGACTTTTAATAACGGAGCTCGGGACCGACATGCATCCCACACAGGAGATAACGGATGTCGGCCACGAGGCTTGAAAGCTAGGGGTTTTTATGGGGTAAGGGGCTTAGGAGTGTGGAATTCAGCATAGCGACACACTACTGGCTTATTCAAACATTAACAGAAAGATTGCAGGGCATCAGGACTTTGTTCATGTGGGCTGGGGGCTTATCTTGTTCACATAGCAACCAGTTGATGTATGACTTTACCTGGTGTCAAGGGGCAGTAGACAGAGGGGAGGTTCCGGCCAGGTGGTGTTGACCCAGACAAGATAGCCCTGCTTGTACAATCAAGCTGTTCTTAGGAATGTCTTAACAACAGCCCTGTCTGTTCTGCTTTGTTCTCGGCCCCAGGCCAGAGGCTCATAGACAACTCTTTTACATGAATCACAAGATACAAAATCTTATTTTCTTTCAAAGGAAAATAACCCCAGCAGAAACAGAGGCAGGCAGATCTCTGAGGACAGCCTGGTTTACATAGAGTTCCAGGACAGCCAGAGCTACACTGGGAAACCCTGTCTCAGAAACCCAAATAAAATTAGTAACTGTCATGAGCTTCTGAGATGAACTGTTTACAGAGCCAACCCACTGTAGCTGAGATGAAATAAGAGGGCAGGCCTAGAAATCCTAAACAGGCCGGGCGGTGGTAGCGCACGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGCGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAAAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGAGACCCTGTCTCGAAAAACAAACAAACAAACAAACAAAAAGAAATCTTAAACAGGCAAAAACCGTGTCTGATGACCCAAGAGGACCAGGGGAAAACAAAGCAACAACAAAACAAGCCATTTGCTGCATCTGAGATCAACTTTAACTGAGTGGAAGTTTCCTGCTGTGTCACCCTAGCTTCTGGTCGCTAGGGGCTGCTTTGGCTGTTTCGACACAGCACAGGAAAAAGACCATTTGGGAGTTGGCAAGTAGATTAAACCTAGTGGTGGGTAAGGGATCGGATGTGAGTGGAGCATTACCGAGGCTCACGGAGGGCCAGACCCAAGGTGTTCTCCCCACCCGTGCCTTACCCAGCATGCCTTACCCATCGCTGCTTCTTTGGTCAGCTGGCCATGGTATTTGGAGCACTCAGCCATCATATGCTGAAGCTCGCCCACACTGTGCTTGGAGGGCTCCCTGACAAATGCCTCGGAGCATCTCTTAGTAAAGATGGAAGCTGGGCGAATAGTCTCTGTGCGGCCGTGTTTGAAGGCTGCAGTGCTGCAGGATTCATAGGTAGCCACTGTCTGGCCATACTGTCGCAGGAAAGCCATCTGGAAGGCCAGCTGGGCCACTGCATCAGGGCTCAGCTTCTTCTTCTTCAAGAATTCCTTGCCACCTCTCTGAAACTGAATGGCGTCAATGGTGAGGGTTTTCATGGTGGCATCAAACTTCTCCTTAGCAGCGGTGACGCCAGCCTTTAGAGCACTGCTGAGCTTAAAACTGAGCTTCTGCACAGACACGGAGGAGTCGGTGGCGGCCGGCTGGCTCTGGGGAGCAATGGCAGGGGTCTGAGTGCTGTCTCTGAACACTTCATTGAAAAACCTAAGGACTGCTACACCATCCCCCCACGCATGCTCGAAGTGGACTGCAGCAGTGCCATCTTTGGCTACAATGAGGTTAAAGGACTTATCAAACCAGCGGTTCGTGCCGTCACCGTGCAGCATGGTGTGTGACAAGTGAACAAGATCCTTCATCGGGAAGTCATCTAAGCAGAGGCAGAAGACAGCAGAGTCCACTTTCCTCAGGGTTTCCTCATTGCCACCATGAATCAACTTCTGTCTGAGCTCTGCCCAGACATCTCGGTTCTCACTGGTCAAATAAGCCAGGGGAAACTCGGGCACAGGGCTGCTGTCTGAGAGAATGTACTTTAGATGTGCCTGGATTTCTGAGGGATTCACAATGTTCCCATCTTGATCGAGGACATCAAAGACATAGAAATGTCCTTTTCTTAGGACCAGGAGGTGTCTAGCCTTGGTATCAGTAAAGAGTTCATCACGACTGGGTTTGGGTATACGAGTTGAATTGAAAAGCCGAAAATATTGGGACATATCCAGGGGATATGCATTGACCAGGTAGGCTCCATACCAGGAGAGAGAGGAAGGAACAAAGCGGATGAGTCTTTTGAAGGCATCTGTGTCACTTCTGGCAGGGTTCAAGTGGAACACTTCTGGCTCTAGAAGGCCAGCCCGAAGTGTCTTCAGAAACCGCACTGCAGAAACAGTCAAGTTGGTGGCCCTGGTGAGCTGGTCATTATACTCAGACTTCGGGTCCGGATTGAATGCCATGAATGGATTAAAGTTTAAAACGACAGAGTCTCGAGCAGTTAAATACATATCAAACCAGGGGCCTAAGAAAGAGAAAATATGAAGAGCTAATGCTATATCTAAAAATAAAATTTAAGAAAGAAGAGAACTCCAGCTCAGGTGGCAGAAATGATACCAACTTCAAGAAGGCGAGTGTATTTGGTGCACAGTGATTTATGCCATATTAGCAGTATCTTAGCATATTAGCATGGTCTTACGCATCTGGATTCTGTTACTTTCAATAATGGTTCTGAGGTTCACCCAGGTGTAACATGCATGTAACATGGATATAGTACATTCTGTTTATCCATTCATCAGTTAATGGATATCTGGGTTGTTTTGGTTTTTTTTTTTTTTTCACCTCTTAGCCAAGCATGATAATCCTATGAGCCTTTATATGCAAGTTTCTATGTGGACATATGTTCTCACTTTTTAAAAGAATATATGTAAGGAAGTTAAGAATCTCCTAAGCCAGCCGGGCGTGGTGGCGCACGCCTTTGATCCAAGCACTTGGGAGGCAGAGGCAGGCGG
GF3 -1 -1 1 GTAAGGAGAGAGCGTCCACAGGTAGTCCTC
GF4 -1 -1 1 CTGCTGGTAGGAGTGGAGTGTCCGTGC
EX52 -1 -1 1 GAGAAGTTCAAGACGATAGTGGAGTTTG
EX32 -1 -1 1 GAAGTCAACTGGTTCAAGGCCCCGGC
GR3 -1 -1 1 GCCTAGTACTGCGCTCAATAGCTC
GR4 -1 -1 1 CTTATTGCCTAGTACTGCGCTCAATAGCTC
Comments:
Created
Target: 2803Ensembl ENSMUSG00000028608 -- 107564070 -- 107566016 ENSMUSE00000180570 -- ENSMUSE00000180574
creating candidate regions
attempting to insert candidate regions into db
done inserting candidate regions
running aos on us and ds
running aos on gaps
finished running aos
AOS Produced 8 oligo candidates from u/d regions
AOS Produced 14 oligo candidates altogether
inserted results of aos runs
Aligned target to NCBIM37 assembly: chr: chromosome:NCBIM37:4:1:155630120:1, start 107564069: end 107566016
Found 10 RP24 black6 bacs on NCBIM36
Found enough RP24 bacs: not looking for RP23
Entered all non-repetitive oligos
Sequence count unchanged by blasting
finished aligning oligos to bac
ACCEPT (0) gap pair G5:4:107557570:107558569_487 G3:4:107569516:107570515_288
REJECT (1) gap pair G5:4:107557570:107558569_487 G3:4:107569516:107570515_248
ACCEPT (0) gap pair G5:4:107557570:107558569_487 G3:4:107569516:107570515_300
REJECT (2) gap pair G5:4:107557570:107558569_880 G3:4:107569516:107570515_288
REJECT (2) gap pair G5:4:107557570:107558569_880 G3:4:107569516:107570515_248
REJECT (2) gap pair G5:4:107557570:107558569_880 G3:4:107569516:107570515_300
REJECT (2) gap pair G5:4:107557570:107558569_885 G3:4:107569516:107570515_288
REJECT (2) gap pair G5:4:107557570:107558569_885 G3:4:107569516:107570515_248
REJECT (2) gap pair G5:4:107557570:107558569_885 G3:4:107569516:107570515_300
DESIGN COMPLETE
U-type: U1
D-type: D1
Creating display features: mapping to reference assembly
Created display features
Inserted short and long range genomic sequence arms

webmaster@sanger.ac.uk

Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SA, UK  Tel:+44 (0)1223 834244