FT CDS 1..1566 FT /class="II.A.5" FT /colour=2 FT /gene="dnaA" FT /gene="ML0001" FT /note="Similar to M. tuberculosis dnaA, chromosomal FT replication initiator protein, SW:DNAA_MYCTU (P49993) (507 FT aa); Fasta score E(): 0, 87.2% identity in 507 aa overlap FT and Mycobacterium smegmatis dnaA, SW:DNAA_MYCSM (P49992) FT (495 aa); Fasta score E(): 0, 69.2% identity in 441 aa FT overlap. Previously sequenced as SW:DNAA_MYCLE (P46388) FT (521 aa); Fasta score E(): 0, 99.8% identity in 521 aa FT overlap. Contains Pfam match to entry PF00308 bac_dnaA, FT Bacterial dnaA protein. Contains PS00017 ATP/GTP-binding FT site motif A (P-loop). Contains PS01008 DnaA protein FT signature." FT /product="putative chromosomal replication initiator FT protein" FT /tb_orthologue="dnaA" FT misc_feature 544..1482 FT /colour=0 FT /note="Pfam match to entry PF00308 bac_dnaA, Bacterial FT dnaA protein, score 712.20, E-value 8.3e-240" FT misc_feature 664..687 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature 1426..1482 FT /colour=8 FT /note="PS01008 DnaA protein signature" FT CDS 2081..3280 FT /EC_number="2.7.7.7" FT /class="II.A.5" FT /colour=2 FT /gene="dnaN" FT /gene="ML0002" FT /note="Similar to M. tuberculosis dnaN, DNA polymerase FT III, [beta] subunit, SW:DP3B_MYCTU (Q50790) (402 aa); FT Fasta score E(): 0, 80.9% identity in 403 aa overlap and FT Mycobacterium smegmatis dnaN, SW:DP3B_MYCSM (P52851) (397 FT aa); Fasta score E(): 0, 77.3% identity in 397 aa overlap. FT Previously sequenced as SW:DP3B_MYCLE (P46387) (399 aa); FT Fasta score E(): 0, 100.0% identity in 399 aa overlap. FT Contains Pfam match to entry PF00712 DNA_pol3_beta, DNA FT polymerase III beta subunit." FT /product="putative DNA polymerase III, [beta] subunit" FT /tb_orthologue="dnaN" FT misc_feature 2117..3214 FT /colour=0 FT /note="Pfam match to entry PF00712 DNA_pol3_beta, DNA FT polymerase III beta subunit, score 592.70, E-value FT 2.2e-174" FT CDS 3281..4438 FT /class="II.A.5" FT /colour=2 FT /gene="recF" FT /gene="ML0003" FT /note="Similar to M. tuberculosis recF, DNA replication FT and SOS induction protein, SW:RECF_MYCTU (Q59586) (385 FT aa); Fasta score E(): 0, 76.4% identity in 385 aa overlap FT and Mycobacterium smegmatis recF, SW:RECF_MYCSM (P50916) FT (384 aa); Fasta score E(): 0, 70.0% identity in 383 aa FT overlap. Previously sequenced as SW:RECF_MYCLE (P46391) FT (385 aa); Fasta score E(): 0, 99.5% identity in 385 aa FT overlap. Contains 2 Pfam matches to entry PF00470 RecF, FT RecF protein. Contains PS00617 RecF protein signature 1. FT Contains PS00017 ATP/GTP-binding site motif A (P-loop). FT Contains PS00618 RecF protein signature 2." FT /product="putative DNA replication and SOS induction FT protein" FT /tb_orthologue="recF" FT misc_feature 3287..3415 FT /colour=0 FT /note="Pfam match to entry PF00470 RecF, RecF protein, FT score 18.90, E-value 0.00024" FT misc_feature 3368..3391 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature 3614..3691 FT /colour=8 FT /note="PS00617 RecF protein signature 1" FT misc_feature 4100..4423 FT /colour=0 FT /note="Pfam match to entry PF00470 RecF, RecF protein, FT score 5.20, E-value 1.5" FT misc_feature 4244..4297 FT /colour=8 FT /note="PS00618 RecF protein signature 2" FT CDS 4435..5004 FT /class="V" FT /colour=10 FT /gene="ML0004" FT /note="Similar to hypothetical proteins from mycobacteria FT e.g. M. tuberculosis Rv0004, ypothetical protein, FT TR:P71573 (EMBL:AL123456) (187 aa); Fasta score E(): 0, FT 77.2% identity in 167 aa overlap. Previously sequenced as FT TR:Q50181 (EMBL:Z70722) (199 aa); Fasta score E(): 0, FT 99.5% identity in 187 aa overlap." FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv0004" FT RBS 5211..5216 FT /note="possible RBS" FT CDS 5229..7265 FT /EC_number="5.99.1.3" FT /class="II.A.5" FT /colour=2 FT /gene="gyrB" FT /gene="ML0005" FT /note="Similar to M. tuberculosis gyrB, DNA gyrase subunit FT B, SW:GYRB_MYCTU (P41514) (686 aa); Fasta score E(): 0, FT 87.5% identity in 679 aa overlap and to Mycobacterium FT smegmatis gyrB, SW:GYRB_MYCSM (P48355) (675 aa); Fasta FT score E(): 0, 85.0% identity in 679 aa overlap. Previously FT sequenced as SW:GYRB_MYCLE (Q59533) (697 aa); Fasta score FT E(): 0, 100.0% identity in 678 aa overlap. Contains Pfam FT match to entry PF00986 DNA_gyraseB_C, DNA gyrase B FT subunit, carboxyl terminus. Contains Pfam match to entry FT PF00204 DNA_topoisoII, DNA topoisomerase II (N-terminal FT region). Contains PS00177 DNA topoisomerase II signature." FT /product="putative DNA gyrase subunit B" FT /tb_orthologue="gyrB" FT misc_feature 5274..7001 FT /colour=0 FT /note="Pfam match to entry PF00204 DNA_topoisoII, DNA FT topoisomerase II (N-terminal region), score 1031.00, FT E-value 0" FT misc_feature 6606..6632 FT /colour=8 FT /note="PS00177 DNA topoisomerase II signature" FT misc_feature 7029..7229 FT /colour=0 FT /note="Pfam match to entry PF00986 DNA_gyraseB_C, DNA FT gyrase B subunit, carboxyl terminus, score 154.30, E-value FT 2.1e-42" FT CDS 7318..11067 FT /EC_number="5.99.1.3" FT /class="II.A.5" FT /colour=2 FT /gene="gyrA" FT /gene="ML0006" FT /note="Similar to M. tuberculosis gyrA, DNA gyrase subunit FT A, SW:GYRA_MYCTU (Q07702) (838 aa); Fasta score E(): 0, FT 91.1% identity in 695 aa overlap and to Mycobacterium FT smegmatis gyrA, SW:GYRA_MYCSM (P48354) (842 aa); Fasta FT score E(): 0, 88.2% identity in 692 aa overlap. Previously FT sequenced as SW:GYRA_MYCLE (Q57532) (1273 aa); Fasta score FT E(): 0, 99.9% identity in 1246 aa overlap. Contains a FT probable intein from aa 131 to 550 inclusive. Contains 2 FT Pfam matches to entry PF00521 DNA_topoisoIV, DNA FT gyrase/topoisomerase IV, subunit A. Contains PS00018 FT EF-hand calcium-binding domain. Contains PS00881 Protein FT splicing signature." FT /product="putative DNA gyrase subunit A" FT /tb_orthologue="gyrB" FT misc_feature 7435..7707 FT /colour=0 FT /note="Pfam match to entry PF00521 DNA_topoisoIV, DNA FT gyrase/topoisomerase IV, subunit A, score 239.20, E-value FT 6e-75" FT misc_feature 8947..8970 FT /colour=8 FT /note="PS00881 Protein splicing signature" FT misc_feature 8968..10053 FT /colour=0 FT /note="Pfam match to entry PF00521 DNA_topoisoIV, DNA FT gyrase/topoisomerase IV, subunit A, score 669.60, E-value FT 7.4e-211" FT misc_feature 10090..10128 FT /colour=8 FT /note="PS00018 EF-hand calcium-binding domain" FT RBS 11184..11189 FT /note="possible RBS" FT repeat_region complement(11189..11473) FT /note="285 bp repeat, shares 98% sequence identity 280/285 FT with bases 3145214..3145498" FT CDS 11195..12106 FT /class="II.C.4" FT /colour=3 FT /gene="ML0007" FT /note="Similar to M. tuberculosis Rv0007, hypothetical FT protein, TR:P71575 (EMBL:AL123456) (304 aa); Fasta score FT E(): 0, 53.8% identity in 316 aa overlap. Previously FT sequenced as TR:O32870 (EMBL:Z70722) (303 aa); Fasta score FT E(): 0, 99.7% identity in 303 aa overlap. Contains FT hydrophobic, possible membrane-spanning regions." FT /note="Contains a region identical to ML2630" FT /product="putative membrane protein" FT /tb_orthologue="Rv0007" FT tRNA 12194..12270 FT /colour=4 FT /note="tRNA Ile anticodon GAT, Cove score 88.84" FT /gene="ileT" FT tRNA 12404..12479 FT /colour=4 FT /note="tRNA Ala anticodon TGC, Cove score 86.68" FT /gene="alaT" FT CDS complement(12856..13230) FT /class="VI" FT /colour=8 FT /gene="ML0008" FT /note="Unknown function." FT /product="hypothetical protein" FT RBS 13763..13766 FT /note="possible RBS" FT CDS 13775..13966 FT /class="VI" FT /colour=8 FT /gene="ML0009" FT /note="Unknown function." FT /product="hypothetical protein" FT CDS complement(15426..15767) FT /class="V" FT /colour=0 FT /gene="ML0010" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv0008c (Best blastx score 124)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT CDS 15993..16541 FT /EC_number="5.2.1.8" FT /class="II.A.6" FT /colour=2 FT /gene="ppiA" FT /gene="ML0011" FT /note="Similar to M. tuberculosis ppiA, peptidyl-prolyl FT cis-trans isomerase, SW:CYPA_MYCTU (P71578) (182 aa); FT Fasta score E(): 0, 90.1% identity in 182 aa overlap and FT Streptomyces chrysomallus ScCypB, peptidyl-prolyl FT cis-trans isomerase B, TR:P77949 (EMBL:U64692) (175 aa); FT Fasta score E(): 0, 63.3% identity in 166 aa overlap. FT Contains Pfam match to entry PF00160 pro_isomerase, FT Cyclophilin type peptidyl-prolyl cis-trans isomerase." FT /note="Similar to ML0492" FT /product="putative peptidyl-prolyl cis-trans isomerase" FT /tb_orthologue="ppiA" FT misc_feature 16062..16529 FT /colour=0 FT /note="Pfam match to entry PF00160 pro_isomerase, FT Cyclophilin type peptidyl-prolyl cis-trans isomerase, FT score 193.30, E-value 2.8e-55" FT CDS complement(16566..16979) FT /class="II.C.4" FT /colour=3 FT /gene="ML0012" FT /note="Similar to M. tuberculosis Rv0010c, hypothetical FT protein, SW:Y010_MYCTU (P71580) (141 aa); Fasta score E(): FT 0, 71.5% identity in 137 aa overlap. Contains hydrophobic, FT possible membrane-spanning regions." FT /product="putative membrane protein" FT /tb_orthologue="Rv0010c" FT CDS complement(17134..17415) FT /class="V" FT /colour=10 FT /gene="ML0013" FT /note="Similar to M. tuberculosis Rv0011c, hypothetical FT protein, SW:Y011_MYCTU (P71581) (93 aa); Fasta score E(): FT 0, 89.2% identity in 93 aa overlap. Contains hydrophobic, FT possible membrane-spanning regions." FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv0011c" FT RBS complement(17421..17424) FT /note="possible RBS" FT CDS 17483..18283 FT /class="III.C" FT /colour=0 FT /gene="ML0014" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv0012 (Best blastx score 411)" FT /product="possible cell division protein (pseudogene)" FT /pseudo FT CDS 18325..19023 FT /EC_number="4.1.3.-" FT /class="I.G.2" FT /colour=7 FT /gene="pabA" FT /gene="ML0015" FT /note="Similar to M. tuberculosis pabA, p-aminobenzoate FT synthase glutamine amidotransferase, TR:Q50183 FT (EMBL:Z70722) (232 aa); Fasta score E(): 0, 100.0% FT identity in 232 aa overlap (EMBL:AL123456) (232 aa); Fasta FT score E(): 0, 100.0% identity in 232 aa overlap and to FT Azospirillum brasilense trpG, anthranilate synthase FT component II, SW:TRPG_AZOBR (P26922) (196 aa); Fasta score FT E(): 0, 56.1% identity in 187 aa overlap. Previously FT sequenced as TR:Q50183. Contains Pfam match to entry FT PF00117 GATase, Glutamine amidotransferase class-I. FT Contains PS00442 Glutamine amidotransferases class-I FT active site." FT /product="putative p-aminobenzoate synthase glutamine FT amidotransferase" FT /tb_orthologue="pabA" FT misc_feature 18334..18900 FT /colour=0 FT /note="Pfam match to entry PF00117 GATase, Glutamine FT amidotransferase class-I, score 264.50, E-value 1.4e-75" FT misc_feature 18556..18591 FT /colour=8 FT /note="PS00442 Glutamine amidotransferases class-I active FT site" FT CDS complement(19001..20869) FT /EC_number="2.7.1.-" FT /class="I.J.3" FT /colour=9 FT /gene="pknB" FT /gene="ML0016" FT /note="Similar to M. tuberculosis pknB, serine/threonine FT protein kinase, SW:PKNB_MYCTU (P71584) (626 aa); Fasta FT score E(): 0, 86.3% identity in 626 aa overlap and to FT Streptomyces coelicolor pksC, serine/threonine protein FT kinase, TR:Q9ZFS8 (EMBL:AF094711) (556 aa); Fasta score FT E(): 0, 47.8% identity in 297 aa overlap. Previously FT sequenced as SW:PKNB_MYCLE (P54744) (622 aa); Fasta score FT E(): 0, 99.7% identity in 622 aa overlap. Contains Pfam FT match to entry PF00069 pkinase, Eukaryotic protein kinase FT domain. Contains PS00108 Serine/Threonine protein kinases FT active-site signature. Contains PS00107 Protein kinases FT ATP-binding region signature." FT /note="Similar to ML0017 and ML0897 and to part of ML0304" FT /product="putative serine/threonine protein kinase" FT /tb_orthologue="pknB" FT misc_feature complement(20054..20839) FT /colour=0 FT /note="Pfam match to entry PF00069 pkinase, Eukaryotic FT protein kinase domain, score 191.50, E-value 1.4e-53" FT misc_feature complement(20432..20470) FT /colour=8 FT /note="PS00108 Serine/Threonine protein kinases FT active-site signature" FT misc_feature complement(20750..20821) FT /colour=8 FT /note="PS00107 Protein kinases ATP-binding region FT signature" FT CDS complement(20879..22192) FT /EC_number="2.7.1.-" FT /class="I.J.3" FT /colour=9 FT /gene="pknA" FT /gene="ML0017" FT /note="Similar to M. tuberculosis pknA, serine/threonine FT protein kinase, SW:PKNA_MYCTU (P71585) (431 aa); Fasta FT score E(): 0, 81.0% identity in 431 aa overlap and to FT Streptomyces coelicolor pksC, serine/threonine protein FT kinase, TR:Q9ZFS8 (EMBL:AF094711) (556 aa); Fasta score FT E(): 2.1e-29, 39.9% identity in 346 aa overlap. Previously FT sequenced as SW:PKNA_MYCLE (P54743) (437 aa); Fasta score FT E(): 0, 84.6% identity in 448 aa overlap. Contains Pfam FT match to entry PF00069 pkinase, Eukaryotic protein kinase FT domain. Contains PS00108 Serine/Threonine protein kinases FT active-site signature." FT /note="Similar to ML0016 and ML0897 and to part of ML0304" FT /product="putative serine/threonine protein kinase" FT /tb_orthologue="pknA" FT misc_feature complement(21410..22156) FT /colour=0 FT /note="Pfam match to entry PF00069 pkinase, Eukaryotic FT protein kinase domain, score 187.90, E-value 1.6e-52" FT misc_feature complement(21746..21784) FT /colour=8 FT /note="PS00108 Serine/Threonine protein kinases FT active-site signature" FT CDS complement(22189..23667) FT /class="II.C.3" FT /colour=3 FT /gene="pbpA" FT /gene="ML0018" FT /note="Similar to M. tuberculosis pbpA, penicillin-binding FT protein, TR:P71586 (EMBL:AL123456) (491 aa); Fasta score FT E(): 0, 85.7% identity in 490 aa overlap. Also similar to FT Bacillus subtilis penicillin-binding protein 3, pbpC, FT SW:PBPC_BACSU (P42971) (668 aa); Fasta score E(): 2.8e-15, FT 24.5% identity in 444 aa overlap. Previously sequenced as FT TR:Q50185 (EMBL:Z70722) (474 aa); Fasta score E(): 0, FT 96.4% identity in 472 aa overlap. Contains a probable FT N-terminal signal sequence. Contains Pfam match to entry FT PF00905 Transpeptidase, Penicillin binding protein FT transpeptidase domain." FT /note="Similar to region of ML1577" FT /product="putative penicillin-binding protein" FT /tb_orthologue="pbpA" FT misc_feature complement(22222..23250) FT /colour=0 FT /note="Pfam match to entry PF00905 Transpeptidase, FT Penicillin binding protein transpeptidase domain, score FT 351.70, E-value 8.2e-102" FT CDS complement(23664..25061) FT /class="II.C.3" FT /colour=3 FT /gene="rodA" FT /gene="ML0019" FT /note="Similar to M. tuberculosis ftsW, cell-division FT protein, SW:FTSW_MYCTU (P71587) (469 aa); Fasta score E(): FT 0, 82.3% identity in 469 aa overlap and to Streptomyces FT coelicolor ftsW, cell-division protein, TR:Q9ZBA6 FT (EMBL:AL109663) (456 aa); Fasta score E(): 3.3e-25, 32.1% FT identity in 377 aa overlap. Previously sequenced as FT SW:FTSW_MYCLE (Q50186) (465 aa); Fasta score E(): 0, 99.6% FT identity in 465 aa overlap. Contains hydrophobic, possible FT membrane-spanning regions. Contains Pfam match to entry FT PF01098 FTSW_RODA_SPOVE, Cell cycle protein. Contains FT PS00428 Cell cycle proteins ftsW / rodA / spoVE FT signature." FT /note="Similar to ML0913" FT /product="putative cell-division protein" FT /tb_orthologue="rodA" FT misc_feature complement(23736..24830) FT /colour=0 FT /note="Pfam match to entry PF01098 FTSW_RODA_SPOVE, Cell FT cycle protein, score 563.80, E-value 1.1e-165" FT misc_feature complement(23796..23870) FT /colour=8 FT /note="PS00428 Cell cycle proteins ftsW / rodA / spoVE FT signature" FT CDS complement(25058..26587) FT /class="V" FT /colour=10 FT /gene="ML0020" FT /note="Similar to M. tuberculosis ppp, putative protein FT phosphatase, TR:P71588 (EMBL:AL123456) (514 aa); Fasta FT score E(): 0, 76.4% identity in 513 aa overlap and to FT Streptomyces coelicolor SCH69.15, possible protein FT phosphatase, TR:Q9XA19 (EMBL:AL079308) (515 aa); Fasta FT score E(): 0, 40.2% identity in 532 aa overlap. Also FT similar to many other proteins of undefined function. FT Previously sequenced as TR:Q50188 (EMBL:Z70722) (509 aa); FT Fasta score E(): 0, 99.6% identity in 509 aa overlap. FT Contains hydrophobic, possible membrane-spanning region. FT Proline-rich C-terminus." FT /product="conserved hypothetical protein" FT /tb_orthologue="ppp" FT CDS complement(26584..27051) FT /class="V" FT /colour=10 FT /gene="ML0021" FT /note="Similar to M. tuberculosis Rv0019c, hypothetical FT protein, TR:P71589 and to Streptomyces coelicolor FT SCH69.14, hypothetical protein, TR:Q9XA20 (EMBL:AL079308) FT (172 aa); Fasta score E(): 2e-21, 44.4% identity in 171 aa FT overlap. Previously sequenced as TR:Q50189 (EMBL:Z70722) FT (155 aa); Fasta score E(): 0, 100.0% identity in 155 aa FT overlap. Contains Pfam match to entry PF00498 FHA, FHA FT domain." FT /note="Similar at the C-terminus to ML2076" FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv0019c" FT misc_feature complement(26611..26805) FT /colour=0 FT /note="Pfam match to entry PF00498 FHA, FHA domain, score FT 74.50, E-value 2.2e-18" FT RBS complement(27058..27063) FT /note="possible RBS" FT CDS complement(27173..28639) FT /class="V" FT /colour=10 FT /gene="ML0022" FT /note="Similar to M. tuberculosis Rv0020c, hypothetical FT protein, TR:P71590 (EMBL:AL123456) (527 aa); Fasta score FT E(): 0, 71.9% identity in 531 aa overlap. Previously FT sequenced as TR:Q50190 (EMBL:Z70722) (463 aa); Fasta score FT E(): 0, 100.0% identity in 463 aa overlap. Contains Pfam FT match to entry PF00498 FHA, FHA domain." FT /note="Similar at the C-terminus to ML2076" FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv0020c" FT misc_feature complement(27203..27394) FT /colour=0 FT /note="Pfam match to entry PF00498 FHA, FHA domain, score FT 89.70, E-value 5.9e-23" FT tRNA 28890..28972 FT /colour=4 FT /note="tRNA Leu anticodon CAG, Cove score 63.58" FT /gene="leuT" FT CDS complement(28954..29265) FT /class="VI" FT /colour=8 FT /gene="ML0023" FT /note="Improbable CDS, possibly the remains of a disrupted FT gene." FT /product="hypothetical protein" FT CDS 29775..30026 FT /class="VI" FT /colour=8 FT /gene="ML0024" FT /note="Unknown function." FT /product="hypothetical protein" FT CDS complement(30293..30583) FT /class="VI" FT /colour=8 FT /gene="ML0025" FT /note="Unknown function." FT /product="hypothetical protein" FT CDS complement(31015..31651) FT /class="IV.C.2" FT /colour=0 FT /gene="PPE" FT /gene="ML0026" FT /note="Possible pseudogene of M. tuberculosis orthologue FT PPE (Best blastx score 99)" FT /product="PPE-family protein (pseudogene)" FT /pseudo FT CDS complement(32113..32920) FT /class="II.C.5" FT /colour=0 FT /gene="ML0027" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv0037c (Best blastx score 178)" FT /product="probable membrane protein (pseudogene)" FT /pseudo FT CDS 33100..33705 FT /class="V" FT /colour=10 FT /gene="ML0028" FT /note="Similar to M. tuberculosis Rv0038, hypothetical FT protein, TR:P71608 (EMBL:AL123456) (202 aa); Fasta score FT E(): 0, 88.1% identity in 202 aa overlap. Similar to FT Streptomyces coelicolor SCE59.07C, hypothetical protein, FT TR:CAB72194 (EMBL:AL138851) (193 aa); Fasta score E(): FT 3.5e-28, 45.6% identity in 182 aa overlap and shows weak FT similarity to many other bacterial hypothetical proteins. FT Previously sequenced as TR:Q50191 (EMBL:Z70722) (202 aa); FT Fasta score E(): 0, 100.0% identity in 201 aa overlap." FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv0038" FT CDS complement(34033..34638) FT /class="V" FT /colour=10 FT /gene="ML0029" FT /note="Contains a region similar to part of several FT bacterial hypothetical membrane proteins e.g. Streptomyces FT coelicolor SC4B5.06, putative transmembrane protein, FT TR:Q9ZBW2 (EMBL:AL034443) (345 aa); Fasta score E(): FT 2.4e-14, 54.1% identity in 109 aa overlap. The coding FT frame predicted by GC frameplot changes to either side of FT this region of similarity, suggesting that an ancestral FT CDS was disrupted. Given this, ML0029 may not be FT functional. Contains hydrophobic, possible FT membrane-spanning regions." FT /product="possible membrane protein" FT CDS complement(34750..35091) FT /class="II.C.4" FT /colour=3 FT /gene="ML0030" FT /note="Similar to M. tuberculosis Rv0039c, hypothetical FT protein, TR:P71696 (EMBL:AL123456) (115 aa); Fasta score FT E(): 2.2e-25, 63.2% identity in 114 aa overlap. Previously FT sequenced as TR:O32871 (EMBL:Z70722) (113 aa); Fasta score FT E(): 0, 100.0% identity in 113 aa overlap. Contains FT hydrophobic, possible membrane-spanning regions." FT /product="putative membrane protein" FT /tb_orthologue="Rv0039c" FT CDS complement(35287..36123) FT /class="II.C.2" FT /colour=3 FT /gene="ML0031" FT /note="Similar to M. tuberculosis MTC28, Rv0040c, proline FT rich 28 KDa antigen precursoR, SW:PR28_MYCTU (P71697) (311 FT aa); Fasta score E(): 0, 65.1% identity in 258 aa overlap. FT Previously sequenced as TR:O33075 (EMBL:Y14967) (278 aa); FT Fasta score E(): 0, 100.0% identity in 278 aa overlap. FT Contains a probable N-terminal signal sequence." FT /note="C-terminal half is similar to a region of ML0246" FT /tb_orthologue="Rv0040c" FT RBS complement(36133..36137) FT /note="possible RBS" FT CDS 36321..39239 FT /EC_number="6.1.1.4" FT /class="II.A.3" FT /colour=2 FT /gene="leuS" FT /gene="ML0032" FT /note="Similar to M. tuberculosis leuS, leucyl-tRNA FT synthetase, SW:SYL_MYCTU (P71698) (969 aa); Fasta score FT E(): 0, 83.6% identity in 972 aa overlap and to Bacillus FT subtilis leuS, leucyl-tRNA synthetase, SW:SYL_BACSU FT (P36430) (804 aa); Fasta score E(): 0, 45.7% identity in FT 941 aa overlap. Previously sequenced as SW:SYL_MYCLE FT (Q50192) (972 aa); Fasta score E(): 0, 99.9% identity in FT 972 aa overlap. Contains Pfam match to entry PF00133 FT tRNA-synt_1, tRNA synthetases class I (I, L, M and V). FT Contains PS00178 Aminoacyl-transfer RNA synthetases FT class-I signature." FT /product="leucyl-tRNA synthase" FT /tb_orthologue="leuS" FT misc_feature 36480..38816 FT /colour=0 FT /note="Pfam match to entry PF00133 tRNA-synt_1, tRNA FT synthetases class I (I, L, M and V), score 241.00, E-value FT 1.7e-68" FT misc_feature 36558..36590 FT /colour=8 FT /note="PS00178 Aminoacyl-transfer RNA synthetases class-I FT signature" FT repeat_region 39269..39991 FT /note="Dispersed repeat, RLEP, copy 1" FT /label=RLEP FT /colour=5 FT CDS 39947..40211 FT /class="V" FT /colour=0 FT /gene="ML0033" FT /note="Possible pseudogene similar to M. tuberculosis FT paralogue Rv3906c (Best blastx score 95)" FT /product="conserved hypothetical protein (pseudogene)" FT /pseudo FT CDS 40825..41032 FT /class="V" FT /colour=0 FT /gene="ML0034" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3890c (Best blastx score 54)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT CDS 42222..43083 FT /class="V" FT /colour=0 FT /gene="ML0035" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3888c (Best blastx score 182)" FT /product="conserved hypothetical protein (pseudogene)" FT /pseudo FT CDS 43199..43699 FT /class="II.C.4" FT /colour=0 FT /gene="ML0036" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3887c (Best blastx score 186)" FT /product="probable membrane protein (pseudogene)" FT /pseudo FT CDS 44077..45332 FT /class="II.B.3" FT /colour=0 FT /gene="ML0037" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3886c (Best blastx score 160)" FT /product="protease (pseudogene)" FT /pseudo FT CDS 45397..46827 FT /class="V" FT /colour=0 FT /gene="ML0038" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3885c (Best blastx score 128)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT stem_loop complement(45886..45945) FT /note="60 bp palindrome" FT CDS 47271..48642 FT /class="V" FT /colour=0 FT /gene="ML0039" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3884c (Best blastx score 288)" FT /product="conserved hypothetical protein (pseudogene)" FT /pseudo FT repeat_region 49168..50496 FT /note="1329 bp repeat. 100% identical to region FT 3042159..3043487" FT CDS complement(49689..49946) FT /note="Possible transposase remnant, similar to the FT N-terminus of M.tuberculosis Rv2424c, probable transposase FT for IS1558, TR:P71924" FT /blastp_match="TR:P71924 (EMBL:AL123456)" FT /class="IV.B.1.c" FT /colour=0 FT /gene="ML0040" FT /product="putative transposase remnant" FT /pseudo FT RBS 50644..50647 FT /note="possible RBS" FT CDS 50656..51996 FT /class="II.B.3" FT /colour=7 FT /gene="ML0041" FT /note="Similar to M. tuberculosis putative proteases e.g. FT Rv3883c, probable secreted protease, TR:O05461 FT (EMBL:AL123456) (446 aa); Fasta score E(): 0, 79.1% FT identity in 446 aa overlap. Shows weaker similarity to FT known bacterial proteases e.g. Bacteroides nodosus aprV5, FT acidic protease V5, TR:Q46541 (EMBL:L18984) (595 aa); FT Fasta score E(): 1.8e-07, 28.1% identity in 442 aa FT overlap. Previously sequenced as TR:O33076 (EMBL:Y14967) FT (446 aa); Fasta score E(): 0, 99.8% identity in 446 aa FT overlap. Contains a probable N-terminal signal sequence. FT Contains 2 Pfam matches to entry PF00082 Peptidase_S8, FT Subtilase family." FT /note="Similar to ML1538 and ML2528" FT /product="probable secreted protease" FT /tb_orthologue="Rv3883c" FT misc_feature 50860..51102 FT /colour=0 FT /note="Pfam match to entry PF00082 Peptidase_S8, Subtilase FT family, score 13.30, E-value 0.011" FT misc_feature 51184..51819 FT /colour=0 FT /note="Pfam match to entry PF00082 Peptidase_S8, Subtilase FT family, score 56.80, E-value 8.5e-15" FT CDS 51993..53396 FT /class="II.C.4" FT /colour=3 FT /gene="ML0042" FT /note="Similar to M. tuberculosis Rv3882c, conserved FT hypothetical protein, TR:O05462 (EMBL:AL123456) (462 aa); FT Fasta score E(): 0, 72.1% identity in 462 aa overlap. FT Shows weak similarity to M.tuberculosis Rv3885c, FT hypothetical protein, TR:O05459 (EMBL:AL123456) (537 aa); FT Fasta score E(): 3.1e-09, 28.0% identity in 382 aa FT overlap. Previously sequenced as TR:O33077 (EMBL:Y14967) FT (467 aa); Fasta score E(): 0, 100.0% identity in 467 aa FT overlap. Contains hydrophobic, possible membrane-spanning FT regions near the N-terminus." FT /note="Shows weak similarity to ML1537" FT /product="putative membrane protein" FT /tb_orthologue="Rv3882c" FT CDS 53719..54695 FT /class="V" FT /colour=0 FT /gene="ML0043" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3881c (Best blastx score 163)" FT /product="conserved hypothetical protein (pseudogene)" FT /pseudo FT RBS 54684..54689 FT /note="possible RBS" FT CDS 54698..55039 FT /class="V" FT /colour=10 FT /product="conserved hypothetical protein" FT /gene="ML0044" FT /note="Similar to M. tuberculosis Rv3880c, hypothetical FT protein, TR:O69744 (EMBL:AL123456) (115 aa); Fasta score FT E(): 2.6e-21, 56.4% identity in 110 aa overlap. Previously FT sequenced as TR:O33080 (EMBL:Y14967) (113 aa); Fasta score FT E(): 0, 100.0% identity in 113 aa overlap." FT CDS 55581..56699 FT /class="V" FT /colour=0 FT /gene="ML0045" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3879c (Best blastx score 189)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT CDS complement(57567..57922) FT /class="V" FT /colour=0 FT /gene="ML0046" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3878 (Best blastx score 118" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT CDS complement(58020..59558) FT /class="II.C.4" FT /colour=3 FT /gene="ML0047" FT /note="Similar to M. tuberculosis putative membrane FT protein e.g. Rv3877, hypothetical protein, TR:O69741 FT (EMBL:AL123456) (511 aa); Fasta score E(): 0, 74.0% FT identity in 512 aa overlap. Similarity is weaker to FT Rv1795, probable membrane protein, TR:O53944 FT (EMBL:AL123456) (503 aa); Fasta score E(): 2.1e-13, 22.7% FT identity in 519 aa overlap and Rv0290, hydrophobic FT protein, TR:O86362 (EMBL:AL123456) (472 aa); Fasta score FT E(): 2.4e-11, 26.6% identity in 512 aa overlap. Previously FT sequenced as TR:O33081 (EMBL:Y14967) (480 aa); Fasta score FT E(): 0, 100.0% identity in 480 aa overlap. Contains FT hydrophobic, possible membrane-spanning regions." FT /note="Similar to ML1539 and ML2529" FT /product="putative membrane protein" FT /tb_orthologue="Rv3877" FT CDS complement(59555..61315) FT /class="V" FT /colour=10 FT /gene="ML0048" FT /note="Has a proline-rich N-terminus. Similar to several FT proteins from M. tuberculosis, some of which also contain FT proline-rich regions e.g. M.tuberculosis Rv3876, FT hypothetical protein, TR:O69740 (EMBL:AL123456) (666 aa); FT Fasta score E(): 0, 50.7% identity in 672 aa overlap, and FT Rv0530, hypothetical protein, TR:O06396 (EMBL:AL123456) FT (405 aa); Fasta score E(): 1.3e-19, 30.5% identity in 417 FT aa overlap. Similar to the C-terminal half of Streptomyces FT coelicolor SC3C3.03C, hypothetical protein, TR:O86637 FT (EMBL:AL031231) (1083 aa); Fasta score E(): 5.9e-27, 31.6% FT identity in 580 aa overlap, which contains Pro-Gln FT repeats. Previously sequenced as TR:O33082 (EMBL:Y14967) FT (478 aa); Fasta score E(): 0, 100.0% identity in 478 aa FT overlap." FT /note="C-terminal half is similar to that of ML0798" FT /product="conserved hypothetical protein" FT CDS complement(61406..61693) FT /class="II.C.2" FT /colour=3 FT /gene="ML0049" FT /note="Similar to M. tuberculosis ESAT6, Rv3875, 6 KDa FT early secretory antigenic target, SW:ESA6_MYCTU (Q57165) FT (94 aa); Fasta score E(): 4.2e-10, 36.3% identity in 91 aa FT overlap. Also shows weak similarity to others e.g. FT M.tuberculosis CFP7, Rv0288, 10 KDa antigen, SW:CFP7_MYCTU FT (O53693) (95 aa); Fasta score E(): 0.17, 25.6% identity in FT 78 aa overlap. Other members of this family include FT Rv3019c, hypothetical protein, TR:O53266 and Rv3444c, FT hypothetical protein, TR:O06261. Previously sequenced as FT SW:ESA6_MYCLE (Q50206) (95 aa); Fasta score E(): 0, 100.0% FT identity in 95 aa overlap." FT /product="possible secreted protein" FT RBS complement(61700..61703) FT /note="possible RBS" FT CDS complement(61720..62022) FT /class="II.C.2" FT /colour=3 FT /gene="ML0050" FT /note="Similar to M. tuberculosis lhp, Rv3874, culture FT filtrate protein 10 kDa CFP-10, TR:O69739 (EMBL:AF004671) FT (100 aa); Fasta score E(): 1.8e-10, 40.0% identity in 100 FT aa overlap. Also shows weak similarity to others e.g. M. FT tuberculosis Rv1197, hypothetical protein, TR:O05299 FT (EMBL:AL123456) (98 aa); Fasta score E(): 0.061, 21.9% FT identity in 96 aa overlap, and Rv1038c, hypothetical FT protein, TR:P96363 (EMBL:AL123456) (98 aa); Fasta score FT E(): 0.084, 21.9% identity in 96 aa overlap. These and FT others form a protein family typically found downstream of FT a member of the ESAT6 family. Other members include . FT Previously sequenced as TR:O33084 (EMBL:Y14967) (100 aa); FT Fasta score E(): 0, 100.0% identity in 100 aa overlap." FT /product="possible secreted protein" FT CDS complement(62201..63109) FT /class="IV.C.2" FT /colour=6 FT /gene="ML0051" FT /note="Similar to PPE-family proteins from M. tuberculosis FT e.g. Rv3873, PPE-family protein, TR:O69738 (EMBL:AL123456) FT (368 aa); Fasta score E(): 6.1e-32, 46.2% identity in 288 FT aa overlap. Lacks the PPE motif at the N-terminus. FT Previously sequenced as TR:O33085 (EMBL:Y14967) (302 aa); FT Fasta score E(): 0, 100.0% identity in 302 aa overlap. FT Contains Pfam match to entry PF00823 PPE, PPE family." FT /note="N-terminus is similar to the N-termini of ML0539, FT ML1828 and ML1991" FT /product="PPE-family protein" FT misc_feature complement(62720..63082) FT /colour=0 FT /note="Pfam match to entry PF00823 PPE, PPE family, score FT -37.40, E-value 1e-05" FT RBS complement(63118..63121) FT /note="possible RBS" FT CDS complement(63319..65112) FT /class="V" FT /colour=10 FT /gene="ML0052" FT /note="Similar to putative ATP/GTP-binding proteins from FT M. tuberculosis and Streptomyces coelicolor e.g. M. FT tuberculosis Rv3871, hypothetical protein, TR:O69736 FT (EMBL:AL123456) (591 aa); Fasta score E(): 0, 80.9% FT identity in 596 aa overlap. In several of these cases this FT protein is similar to the C-terminal half of a larger FT protein, while the upstream ML0053 is similar to the FT corresponding N-terminal half e.g. M. tuberculosis FT Rv3447c, unknown membrane protein, TR:O06264 FT (EMBL:AL123456) (1236 aa); Fasta score E(): 0, 35.2% FT identity in 588 aa overlap and Streptomyces coelicolor FT SC3C3.20C, ATP/GTP binding protein, TR:O86653 FT (EMBL:AL031231) (1321 aa); Fasta score E(): 0, 35.0% FT identity in 575 aa overlap. Related proteins are also FT found in Bacillus spp. Previously sequenced as TR:O33086 FT (EMBL:Y14967) (597 aa); Fasta score E(): 0, 99.7% identity FT in 597 aa overlap. Contains 2 Pfam matches to entry FT PF01580 FtsK_SpoIIIE, FtsK/SpoIIIE family. Contains 2 x FT PS00017 ATP/GTP-binding site motif A (P-loop)." FT /note="Similar to the C-terminal halves of ML1543 and FT ML2535" FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv3871" FT misc_feature complement(63559..64119) FT /colour=0 FT /note="Pfam match to entry PF01580 FtsK_SpoIIIE, FT FtsK/SpoIIIE family, score 178.70, E-value 9.4e-50" FT misc_feature complement(63961..63984) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature complement(64234..64992) FT /colour=0 FT /note="Pfam match to entry PF01580 FtsK_SpoIIIE, FT FtsK/SpoIIIE family, score 162.10, E-value 9.2e-45" FT misc_feature complement(64837..64860) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT RBS complement(65124..65127) FT /note="possible RBS" FT CDS complement(65186..67420) FT /class="II.C.4" FT /colour=3 FT /gene="ML0053" FT /note="Similar to putative ATP/GTP-binding proteins from FT M. tuberculosis and Streptomyces coelicolor e.g. M. FT tuberculosis Rv3870, hypothetical protein, TR:O69735 FT (EMBL:AL123456) (747 aa); Fasta score E(): 0, 85.4% FT identity in 746 aa overlap. In several of these cases this FT protein is similar to the N-terminal half of a larger FT protein, while the downstream ML0052 is similar to the FT corresponding C-terminal half e.g. M.tuberculosis Rv3447c, FT unknown membrane protein, TR:O06264 (EMBL:AL123456) (1236 FT aa); Fasta score E(): 0, 37.2% identity in 732 aa overlap FT and Streptomyces coelicolor SC3C3.20C, ATP/GTP binding FT protein, TR:O86653 (EMBL:AL031231) (1321 aa); Fasta score FT E(): 0, 34.7% identity in 760 aa overlap. Related proteins FT are also found in Bacillus spp. Contains hydrophobic, FT possible membrane-spanning region near the N-terminus. FT Contains Pfam match to entry PF01580 FtsK_SpoIIIE, FT FtsK/SpoIIIE family. Contains PS00017 ATP/GTP-binding site FT motif A (P-loop)." FT /note="Similar to the N-terminal halves of ML1543 and FT ML2535" FT /product="putative membrane protein" FT /tb_orthologue="Rv3870" FT misc_feature complement(65513..66145) FT /colour=0 FT /note="Pfam match to entry PF01580 FtsK_SpoIIIE, FT FtsK/SpoIIIE family, score 250.40, E-value 2.4e-71" FT misc_feature complement(65969..65992) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT CDS complement(67417..68862) FT /class="II.C.4" FT /colour=3 FT /gene="ML0054" FT /note="Similar to several M. tuberculosis hypothetical FT proteins e.g. Rv3869, conserved hypothetical protein, FT TR:O69734 (EMBL:AL123456) (480 aa); Fasta score E(): 0, FT 75.7% identity in 478 aa overlap. Previously sequenced as FT TR:O33088 (EMBL:Y14967) (481 aa); Fasta score E(): 0, FT 100.0% identity in 481 aa overlap. Contains hydrophobic, FT possible membrane-spanning region near the N-terminus." FT /note="Similar to ML1544 and ML2536" FT /product="putative membrane protein" FT /tb_orthologue="Rv3869" FT RBS complement(67428..67431) FT /note="possible RBS" FT CDS complement(68866..70587) FT /class="V" FT /colour=10 FT /gene="ML0055" FT /note="Similar to several M. tuberculosis hypothetical FT proteins e.g. Rv3868, hypothetical protein, SW:Y2G8_MYCTU FT (O69733) (573 aa); Fasta score E(): 0, 89.2% identity in FT 573 aa overlap. C-terminus is similar to many members of FT the CBXX/CFQX family e.g. Bacillus subtilis SpoVK/SpoVJ, FT stage V sporulation protein, SW:SP5K_BACSU (P27643) (322 FT aa); Fasta score E(): 3.5e-26, 33.7% identity in 332 aa FT overlap. Previously sequenced as SW:Y2G8_MYCLE (O33089) FT (573 aa); Fasta score E(): 0, 100.0% identity in 573 aa FT overlap. Contains Pfam match to entry PF00004 AAA, ATPases FT associated with various cellular activities (AAA). FT Contains PS00017 ATP/GTP-binding site motif A (P-loop)." FT /note="Similar to ML1536 and ML2537. Shows weak similarity FT to ML0798" FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv3868" FT misc_feature complement(68872..69603) FT /colour=0 FT /note="Pfam match to entry PF00004 AAA, ATPases associated FT with various cellular activities (AAA), score 15.30, FT E-value 1.7e-06" FT misc_feature complement(69565..69588) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT CDS complement(70584..71093) FT /class="V" FT /colour=10 FT /gene="ML0056" FT /note="Similar to M. tuberculosis Rv3867, conserved FT hypothetical protein, TR:O06269 (EMBL:AL123456) (184 aa); FT Fasta score E(): 1.1e-12, 38.4% identity in 172 aa overlap FT and to Rv3614c, hypothetical protein, TR:O69732 FT (EMBL:AL123456) (183 aa); Fasta score E(): 1e-20, 48.2% FT identity in 166 aa overlap. Previously sequenced as FT TR:Q49730 (EMBL:U00015) (216 aa); Fasta score E(): FT 1.7e-13, 40.2% identity in 169 aa overlap." FT /note="Similar to ML0407" FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv3867" FT CDS complement(71142..72064) FT /class="V" FT /colour=0 FT /gene="ML0057" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3866 (Best blastx score 427)" FT /product="conserved hypothetical protein (pseudogene)" FT /pseudo FT RBS complement(71605..71608) FT /note="possible RBS" FT repeat_region 71670..71773 FT /note="2 copies of 52 bp repeat, Consensus FT TTGTTGTTGCCAACATTGCGACGCCACTACCGAGTCTCCACTCCCGGTCCGG " FT /colour=5 FT CDS complement(72683..73686) FT /class="V" FT /colour=0 FT /gene="ML0058" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3864 (Best blastx score 110)" FT /product="conserved hypothetical protein (pseudogene)" FT /pseudo FT repeat_region 73074..73136 FT /note="3 copies of 21 bp repeat, Consensus FT GATCAAGCCAGGAATCAAGTT " FT /colour=5 FT CDS complement(73832..74366) FT /class="V" FT /colour=0 FT /gene="ML0059" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3863 (Best blastx score 119)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT repeat_region complement(74457..75125) FT /note="Dispersed repeat, RLEP, copy 2" FT /label=RLEP FT /colour=5 FT stem_loop complement(75139..75188) FT /note="50 bp palindrome" FT CDS complement(76494..76713) FT /class="V" FT /colour=0 FT /gene="ML0060" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3860 (Best blastx score 354)" FT /product="conserved hypothetical protein (pseudogene)" FT /pseudo FT CDS 77709..82292 FT /EC_number="1.4.1.13" FT /class="I.D.1" FT /colour=7 FT /gene="gltB" FT /gene="ML0061" FT /note="Similar to M. tuberculosis Rv3859c, putative FT ferredoxin-dependent glutamate synthase, TR:P96218 FT (EMBL:Al123456) (1527 aa); Fasta score E(): 0, 90.2% FT identity in 1527 aa overlap and to Synechocystis sp. gltB, FT ferredoxin-dependent glutamate synthase 1, SW:GLTB_SYNY3 FT (P55037) (1550 aa); Fasta score E(): 0, 57.2% identity in FT 1525 aa overlap. Contains Pfam match to entry PF01493 FT DUF14, Domain of unknown function. Contains Pfam match to FT entry PF01645 Glu_synthase, Conserved region in glutamate FT synthase. Contains PS00095 C-5 cytosine-specific DNA FT methylases C-terminal signature." FT /product="putative ferredoxin-dependent glutamate FT synthase" FT /tb_orthologue="gltB" FT misc_feature 80163..81278 FT /colour=0 FT /note="Pfam match to entry PF01645 Glu_synthase, Conserved FT region in glutamate synthase, score 778.30, E-value FT 3.1e-230" FT misc_feature 81510..82103 FT /colour=0 FT /note="Pfam match to entry PF01493 DUF14, Domain of FT unknown function, score 324.10, E-value 1.6e-93" FT misc_feature 81627..81683 FT /colour=8 FT /note="PS00095 C-5 cytosine-specific DNA methylases FT C-terminal signature" FT RBS 82274..82277 FT /note="possible RBS" FT CDS 82285..83751 FT /EC_number="1.4.1.13" FT /class="I.D.1" FT /colour=7 FT /gene="gltD" FT /gene="ML0062" FT /note="Similar to M. tuberculosis Rv3858c, gltD, putative FT NADH-dependent glutamate synthase small subunit, TR:P96219 FT (EMBL:Al123456) (488 aa); Fasta score E(): 0, 87.7% FT identity in 488 aa overlap and to many other putative FT glutamate synthase small subunits e.g. Escherichia coli FT gltD, glutamate synthase [NADPH] small chain, FT SW:GLTD_ECOLI (P09832) (471 aa); Fasta score E(): 0, 37.8% FT identity in 474 aa overlap. Contains Pfam match to entry FT PF00070 pyr_redox, Pyridine nucleotide-disulphide FT oxidoreductase." FT /product="NADH-dependent glutamate synthase small subunit" FT /tb_orthologue="gltD" FT misc_feature 82723..83619 FT /colour=0 FT /note="Pfam match to entry PF00070 pyr_redox, Pyridine FT nucleotide-disulphide oxidoreductase, score 114.20, FT E-value 6e-33" FT CDS 84980..85727 FT /class="V" FT /colour=0 FT /gene="ML0063" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3856c (Best blastx score 211)" FT /product="conserved hypothetical protein (pseudogene)" FT /pseudo FT CDS complement(85968..86612) FT /class="I.J.1" FT /colour=9 FT /gene="ML0064" FT /note="Similar to M. tuberculosis Rv3855, putative FT transcriptional regulator, TR:P96222 (EMBL:Al123456) (216 FT aa); Fasta score E(): 0, 77.0% identity in 213 aa overlap. FT Contains a probable helix-turn-helix motif at aa 45-66 FT (Score 1261, SD +3.48) Contains Pfam match to entry FT PF00440 tetR, Bacterial regulatory proteins, tetR family." FT /note="Similar to ML1070" FT /product="putative transcriptional regulator" FT /tb_orthologue="Rv3855" FT misc_feature complement(86388..86528) FT /colour=0 FT /note="Pfam match to entry PF00440 tetR, Bacterial FT regulatory proteins, tetR family, score 56.20, E-value FT 5.6e-13" FT CDS 86681..88165 FT /class="I.B.7" FT /colour=7 FT /gene="ML0065" FT /note="Similar to putative monooxygenases from M. FT tuberculosis e.g. Rv3854c, probable monooxygenase, FT TR:P96223 (EMBL:AL123456) (489 aa); Fasta score E(): 0, FT 80.1% identity in 488 aa overlap. Others are Rv0892 and FT Rv1393c. Also similar to the C-terminal half of FT Deinococcus radiodurans plasmid MP1 DRB0033, putative FT arylesterase/monoxygenase, TR:Q9RZT0 (EMBL:AE001826) (833 FT aa); Fasta score E(): 0, 51.5% identity in 480 aa overlap. FT Shows weaker similarity to Rhodococcus rhodochrous steroid FT monooxygenase, TR:O50641 (EMBL:AB010439) (549 aa); Fasta FT score E(): 2e-15, 24.9% identity in 469 aa overlap. FT Contains Pfam match to entry PF00743 FMO-like, FT Flavin-binding monooxygenase-like." FT /note="Similar to pseudogene ML1732" FT /product="putative monooxygenase" FT /tb_orthologue="Rv3854c" FT misc_feature 86714..88111 FT /colour=0 FT /note="Pfam match to entry PF00743 FMO-like, FT Flavin-binding monooxygenase-like, score -279.10, E-value FT 1.7e-07" FT CDS complement(88246..88719) FT /class="I.G.11" FT /colour=7 FT /gene="menG" FT /gene="ML0066" FT /note="Similar to M. tuberculosis Rv3853, menG, putative FT S-adenosylmethionine:2-demethylmenaquinone FT methyltransferase, TR:P96224 (EMBL:AL123456) (157 aa); FT Fasta score E(): 0, 87.1% identity in 155 aa overlap. FT Similar to Escherichia coli menG, FT S-adenosylmethionine:2-demethylmenaquinone FT methyltransferase, SW:MENG_ECOLI (P32165) (161 aa); Fasta FT score E(): 2.4e-20, 45.6% identity in 149 aa overlap." FT /product="putative FT S-adenosylmethionine:2-demethylmenaquinone FT methyltransferase" FT /tb_orthologue="menG" FT CDS complement(88741..89106) FT /class="II.A.4" FT /colour=2 FT /gene="hns" FT /gene="ML0067" FT /note="Similar to M. tuberculosis Rv3852, hns, HU-histone FT protein, TR:P96225 (EMBL:AL123456) (134 aa); Fasta score FT E(): 6.1e-12, 51.5% identity in 134 aa overlap. Contains FT PAKKX repeats similar to those in histone H1 proteins." FT /product="histone-like protein" FT /tb_orthologue="hns" FT RBS complement(89114..89118) FT /note="possible RBS" FT CDS complement(89620..90336) FT /class="V" FT /colour=10 FT /gene="ML0068" FT /note="Similar to M. tuberculosis Rv3850, hypothetical FT protein, TR:P96227 (EMBL:AL123456) (218 aa); Fasta score FT E(): 0, 78.3% identity in 217 aa overlap." FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv3850" FT RBS complement(90347..90351) FT /note="possible RBS" FT CDS complement(90521..90919) FT /class="V" FT /colour=10 FT /gene="ML0069" FT /note="Similar to M. tuberculosis Rv3849, hypothetical FT protein, TR:P96228 (EMBL:AL123456) (132 aa); Fasta score FT E(): 0, 84.0% identity in 131 aa overlap." FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv3849" FT RBS complement(90927..90932) FT /note="possible RBS" FT CDS complement(91296..91559) FT /class="VI" FT /colour=8 FT /gene="ML0070" FT /note="Unknown function." FT /product="hypothetical protein" FT CDS complement(91913..92446) FT /class="V" FT /colour=10 FT /gene="ML0071" FT /note="Similar to M. tuberculosis Rv3847, hypothetical FT protein, TR:P96230 (EMBL:AL123456) (177 aa); Fasta score FT E(): 0, 96.6% identity in 177 aa overlap." FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv3847" FT RBS complement(92452..92456) FT /note="possible RBS" FT CDS complement(92647..93270) FT /EC_number="1.15.1.1" FT /class="III.F" FT /colour=0 FT /gene="sodA" FT /gene="ML0072" FT /note="Similar to M. tuberculosis Rv3846, sodA, superoxide FT dismutase, SW:SODF_MYCTU (P17670) (207 aa); Fasta score FT E(): 0, 80.1% identity in 206 aa overlap, and to many FT other mycobacterial superoxide dismutases. Previously FT sequenced as SW:SODM_MYCLE (P13367) (206 aa); Fasta score FT E(): 0, 100.0% identity in 206 aa overlap. Contains Pfam FT match to entry PF00081 sodfe, Iron/manganese superoxide FT dismutases (SODM). Contains PS00088 Manganese and iron FT superoxide dismutases signature." FT /product="superoxide dismutase" FT /tb_orthologue="sodA" FT misc_feature complement(92674..93264) FT /colour=0 FT /note="Pfam match to entry PF00081 sodfe, Iron/manganese FT superoxide dismutases (SODM), score 427.70, E-value FT 1e-124" FT misc_feature complement(92770..92793) FT /colour=8 FT /note="PS00088 Manganese and iron superoxide dismutases FT signature" FT RBS complement(93277..93285) FT /note="possible RBS" FT CDS 94092..95126 FT /class="II.C.4" FT /colour=3 FT /gene="ML0073" FT /note="Similar to M. tuberculosis Rv3843c, putative FT membrane protein, TR:P96235 (EMBL:Z83864) (342 aa); Fasta FT score E(): 0, 63.0% identity in 349 aa overlap. Contains FT hydrophobic, possible membrane-spanning regions." FT /product="putative membrane protein" FT /tb_orthologue="Rv3843c" FT CDS 95132..95947 FT /EC_number="3.1.4.46" FT /class="I.C.1" FT /colour=7 FT /gene="glpQ" FT /gene="ML0074" FT /note="Similar to M. tuberculosis Rv3842c, glpQ1, FT glycerophosphoryl diester phosphodiesterase, TR:P96236 FT (EMBL:AL123456) (274 aa); Fasta score E(): 0, 88.8% FT identity in 269 aa overlap. Similar to Bacillus subtilis FT glpQ, glycerophosphoryl diester phosphodiesterase, FT SW:GLPQ_BACSU (P37965) (293 aa); Fasta score E(): 2.3e-20, FT 32.0% identity in 250 aa overlap." FT /product="putative glycerophosphoryl diester FT phosphodiesterase" FT /tb_orthologue="glpQ1" FT CDS complement(95965..96439) FT /class="I.G.14" FT /colour=0 FT /gene="bfrB" FT /gene="ML0075" FT /note="Possible pseudogene of M. tuberculosis orthologue FT bfrB (Best blastx score 190)" FT /product="bacterioferritin (pseudogene)" FT /pseudo FT CDS complement(97037..97282) FT /colour=0 FT /gene="ML0076" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3840 (Best blastx score 196)" FT /product="hypothetical protein (pseudogene)" FT /class="I.J.1" FT /pseudo FT CDS complement(97832..98119) FT /class="V" FT /colour=0 FT /gene="ML0077" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3839 (Best blastx score 251)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT CDS 98425..99393 FT /EC_number="4.2.1.51" FT /class="I.D.4" FT /colour=7 FT /gene="pheA" FT /gene="ML0078" FT /note="Similar to M. tuberculosis Rv3838c, pheA, FT prephenate dehydratase, TR:P96240 (EMBL:AL123456) (321 FT aa); Fasta score E(): 0, 83.9% identity in 311 aa overlap. FT Similar to Amycolatopsis methanolica pheA, prephenate FT dehydratase, SW:PHEA_AMYME (Q44104) (304 aa); Fasta score FT E(): 0, 44.4% identity in 315 aa overlap. Contains Pfam FT match to entry PF01842 ACT, ACT domain. Contains Pfam FT match to entry PF00800 PDT, Prephenate dehydratase. FT Contains PS00858 Prephenate dehydratase signature 2." FT /product="putative prephenate dehydratase" FT /tb_orthologue="pheA" FT misc_feature 98440..99006 FT /colour=0 FT /note="Pfam match to entry PF00800 PDT, Prephenate FT dehydratase, score 313.20, E-value 3e-90" FT misc_feature 99034..99267 FT /colour=0 FT /note="Pfam match to entry PF01842 ACT, ACT domain, score FT 55.20, E-value 1.4e-12" FT misc_feature 99115..99138 FT /colour=8 FT /note="PS00858 Prephenate dehydratase signature 2" FT CDS 99390..100085 FT /class="I.B.1" FT /colour=7 FT /gene="ML0079" FT /note="Similar to M. tuberculosis Rv3837c, putative FT phosphoglycerate mutase, TR:P96241 (EMBL:AL123456) (232 FT aa); Fasta score E(): 0, 71.6% identity in 232 aa overlap. FT Similar to Amycolatopsis methanolica pgm, 2,3-PDG FT dependent phosphoglycerate mutase, TR:Q9ZAX0 (EMBL:U73808) FT (205 aa); Fasta score E(): 9.3e-24, 39.7% identity in 204 FT aa overlap. Contains Pfam match to entry PF00300 PGAM, FT Phosphoglycerate mutase family. Contains PS00175 FT Phosphoglycerate mutase family phosphohistidine FT signature." FT /note="Similar to ML1452" FT /product="putative phosphoglycerate mutase" FT /tb_orthologue="Rv3837c" FT misc_feature 99405..99869 FT /colour=0 FT /note="Pfam match to entry PF00300 PGAM, Phosphoglycerate FT mutase family, score 27.40, E-value 2e-06" FT misc_feature 99408..99437 FT /colour=8 FT /note="PS00175 Phosphoglycerate mutase family FT phosphohistidine signature" FT CDS complement(100374..100651) FT /class="V" FT /colour=0 FT /gene="ML0080" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3836 (Best blastx score 137)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT CDS complement(100648..102000) FT /class="II.C.4" FT /colour=3 FT /gene="ML0081" FT /note="Similar to M. tuberculosis Rv3835c, hypothetical FT protein, TR:P96243 (EMBL:AL123456) (449 aa); Fasta score FT E(): 0, 69.4% identity in 457 aa overlap. Contains FT hydrophobic, possible membrane-spanning region near the FT N-terminus." FT /product="putative membrane protein" FT /tb_orthologue="Rv3835" FT CDS 102122..103375 FT /EC_number="6.1.1.11" FT /class="II.A.3" FT /colour=2 FT /gene="serS" FT /gene="ML0082" FT /note="Similar to M. tuberculosis Rv3834c, serS, FT seryl-tRNA synthetase, SW:SYS_MYCTU (P96244) (419 aa); FT Fasta score E(): 0, 85.8% identity in 416 aa overlap. FT Similar to Staphylococcus aureus serS, seryl-tRNA FT synthetase, SW:SYS_STAAU (Y09924) (428 aa); Fasta score FT E(): 0, 36.8% identity in 418 aa overlap. Contains Pfam FT match to entry PF00587 tRNA-synt_2b, tRNA synthetase class FT II (G, H, P, S and T). Contains PS00179 Aminoacyl-transfer FT RNA synthetases class-II signature 1." FT /product="putative seryl-tRNA synthase" FT /tb_orthologue="serS" FT misc_feature 102338..103348 FT /colour=0 FT /note="Pfam match to entry PF00587 tRNA-synt_2b, tRNA FT synthetase class II (G, H, P, S and T), score 132.30, FT E-value 8.8e-36" FT misc_feature 102881..102955 FT /colour=8 FT /note="PS00179 Aminoacyl-transfer RNA synthetases class-II FT signature 1" FT CDS complement(105732..106191) FT /class="V" FT /colour=0 FT /gene="ML0083" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3831 (Best blastx score 151)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT CDS complement(106286..106599) FT /class="V" FT /colour=0 FT /gene="ML0084" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3819 (Best blastx score 138)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT CDS complement(106635..108159) FT /class="V" FT /colour=0 FT /gene="ML0085" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3818 (Best blastx score 275)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT CDS complement(108258..108991) FT /class="IV.D" FT /colour=0 FT /gene="ML0086" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3817 (Best blastx score 203)" FT /product="probable aminoglycoside 3'-phosphotransferase FT (pseudogene)" FT /pseudo FT CDS 109049..109822 FT /class="IV.H" FT /colour=7 FT /gene="ML0087" FT /note="Similar to M. tuberculosis Rv3816c, probable FT acyltransferase, TR:O07807 (EMBL:AL123456) (259 aa); Fasta FT score E(): 0, 81.5% identity in 254 aa overlap. Also FT similar to the neighbouring putative acyltransferases in FT M. tuberculosis, Rv3815c and Rv3814c. Shows similarity to FT many putative bacterial acyltransferases. Contains Pfam FT match to entry PF01553 Acyltransferase, Acyltransferase." FT /note="Similar to ML0892" FT /product="putative acyltransferase" FT /tb_orthologue="Rv3816c" FT misc_feature 109136..109678 FT /colour=0 FT /note="Pfam match to entry PF01553 Acyltransferase, FT Acyltransferase, score 170.90, E-value 2.1e-47" FT CDS 109842..110234 FT /class="IV.H" FT /colour=0 FT /gene="ML0088" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3815c (Best blastx score 228)" FT /product="probable acyltransferase (pseudogene)" FT /pseudo FT CDS 110329..111174 FT /class="V" FT /colour=10 FT /gene="ML0089" FT /note="Similar to M. tuberculosis Rv3813c, conserved FT hypothetical protein, TR:O07810 (EMBL:AL123456) (273 aa); FT Fasta score E(): 0, 80.4% identity in 271 aa overlap. FT Similar to many other bacterial hypothetical proteins. FT Contains Pfam match to entry PF00592 DUF3, Cof family." FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv3813c" FT misc_feature 110401..111135 FT /colour=0 FT /note="Pfam match to entry PF00592 DUF3, Cof family, score FT 91.10, E-value 2.2e-23" FT CDS complement(111660..112884) FT /class="II.C.2" FT /colour=0 FT /gene="csp" FT /gene="ML0090" FT /note="Possible pseudogene of M. tuberculosis orthologue FT csp (Best blastx score 228)" FT /product="secreted protein (pseudogene)" FT /pseudo FT CDS complement(113153..113863) FT /class="II.C.2" FT /colour=3 FT /gene="ML0091" FT /note="Similar to M. tuberculosis Rv3810, erp, pirG, FT exported repetitive protein precursor, SW:ERP_MYCTU FT (Q50793) (284 aa); Fasta score E(): 1.8e-23, 52.7% FT identity in 281 aa overlap. Previously sequenced as FT SW:28KD_MYCLE (P19361) (236 aa); Fasta score E(): 0, 99.6% FT identity in 236 aa overlap. Contains a probable N-terminal FT signal sequence." FT /product="28 KDa antigen precursor" FT RBS complement(113870..113874) FT /note="possible RBS" FT CDS 114130..115371 FT /class="II.C.3" FT /colour=3 FT /gene="glf" FT /gene="ML0092" FT /note="Similar to M. tuberculosis Rv3809c, glf, FT UDP-galactopyranose mutase, TR:O06934 (EMBL:U96128) (399 FT aa); Fasta score E(): 0, 86.6% identity in 396 aa overlap. FT Similar to e.g. Escherichia coli glf, UDP-galactopyranose FT mutase, SW:GLF_ECOLI (P37747) (367 aa); Fasta score E(): FT 0, 43.1% identity in 378 aa overlap." FT /product="putative UDP-galactopyranose mutase" FT /tb_orthologue="glf" FT CDS 115371..117302 FT /class="V" FT /colour=10 FT /gene="ML0093" FT /note="Similar to M. tuberculosis Rv3808c, hypothetical FT protein, TR:O53585 (EMBL:AL123456) (637 aa); Fasta score FT E(): 0, 85.4% identity in 643 aa overlap." FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv3808c" FT CDS 117295..117873 FT /class="II.C.4" FT /colour=3 FT /gene="ML0094" FT /note="Similar to M. tuberculosis Rv3807c, possible FT membrane protein, TR:O53584 (EMBL:AL123456) (165 aa); FT Fasta score E(): 0, 72.8% identity in 151 aa overlap and FT to Streptomyces coelicolor SC5G8.11, putative integral FT membrane protein, TR:CAB89062 (EMBL:AL353872) (169 aa); FT Fasta score E(): 1.7e-15, 45.1% identity in 153 aa FT overlap. Contains hydrophobic, possible membrane-spanning FT region. Contains Pfam match to entry PF01569 PAP2, PAP2 FT superfamily." FT /product="putative membrane protein" FT /tb_orthologue="Rv3807c" FT misc_feature 117409..117825 FT /colour=0 FT /note="Pfam match to entry PF01569 PAP2, PAP2 superfamily, FT score 97.10, E-value 3.4e-25" FT CDS 117870..118778 FT /class="II.C.4" FT /colour=3 FT /gene="ML0095" FT /note="Similar to M. tuberculosis Rv3806c, possible FT integral membrane protein, TR:O53583 (EMBL:AL123456) (302 FT aa); Fasta score E(): 0, 83.8% identity in 302 aa overlap FT and to bacterial putative membrane proteins e.g. FT Streptomyces coelicolor SC5G8.12, putative integral FT membrane protein, TR:CAB89063 (EMBL:AL353872) (322 aa); FT Fasta score E(): 0, 48.6% identity in 290 aa overlap and FT Azorhizobium caulinodans noeC, possible integral membrane FT protein found near nod locus, SW:NOEC_AZOCA (Q43967) (307 FT aa); Fasta score E(): 1.1e-12, 31.4% identity in 191 aa FT overlap. Contains hydrophobic, possible membrane-spanning FT regions." FT /product="putative integral membrane protein" FT /tb_orthologue="Rv3806c" FT CDS 118819..120768 FT /class="II.C.4" FT /colour=3 FT /gene="ML0096" FT /note="similar to M. tuberculosis Rv3805c, possible FT membrane protein, TR:O53582 (EMBL:AL123456) (627 aa); FT Fasta score E(): 0, 80.9% identity in 629 aa overlap. FT Contains hydrophobic, possible membrane-spanning regions." FT /product="putative membrane protein" FT /tb_orthologue="Rv3805c" FT RBS 121138..121145 FT /note="possible RBS" FT CDS 121157..122149 FT /class="I.H.3" FT /colour=1 FT /gene="fbpA" FT /gene="ML0097" FT /note="Similar to mycobacterial fbpA, antigen 85-A FT precursors e.g. M. tuberculosis fbpA, antigen 85-A FT precursor, SW:A85A_MYCTU (P17944) (338 aa); Fasta score FT E(): 0, 83.0% identity in 329 aa overlap. Also similar to FT the B- and C- proteins of the mycobacterial antigen 85 FT complexes. Similar to N-terminal region of Corynebacterium FT glutamicum csp1, PS1 protein precursor, SW:CSP1_CORGL FT (Q01377) (657 aa); Fasta score E(): 5.2e-31, 38.6% FT identity in 290 aa overlap. Previously sequenced as FT SW:A85A_MYCLE (Q05861) (330 aa); Fasta score E(): 0, FT 100.0% identity in 330 aa overlap. Contains probable FT N-terminal signal sequence. Contains Pfam match to entry FT PF00756 Esterase, Putative esterase." FT /note="Similar to ML0098, ML2028 and ML2655" FT /product="antigen 85A, mycolytransferase" FT /tb_orthologue="fbpA" FT misc_feature 121241..121903 FT /colour=0 FT /note="Pfam match to entry PF00756 Esterase, Putative FT esterase, score 381.30, E-value 9.7e-111" FT RBS 122299..122304 FT /note="possible RBS" FT CDS 122310..123215 FT /class="I.H.3" FT /colour=1 FT /gene="fbpC" FT /gene="ML0098" FT /note="Similar to mycobacterial fbpC, antigen 85-C FT precursors e.g. M. tuberculosis fbpC, antigen 85-C FT precursor, SW:A85C_MYCTU (P17944) (340 aa); Fasta score FT E(): 0, 40.7% identity in 305 aa overlap. Also similar to FT the B- and C- proteins of the mycobacterial antigen 85 FT complexes. Similar to N-terminal region of Corynebacterium FT glutamicum csp1, PS1 protein precursor, SW:CSP1_CORGL FT (Q01377) (657 aa); Fasta score E(): 1.4e-14, 31.5% FT identity in 248 aa overlap. Previously sequenced as MPB51 FT precursor, TR:Q48923 (EMBL:D26486) (299 aa); Fasta score FT E(): 0, 77.5% identity in 302 aa overlap. Contains FT probable N-terminal signal sequence. Contains Pfam match FT to entry PF00756 Esterase, Putative esterase." FT /note="Similar to ML0097, ML2028 and ML2655" FT /product="antigen 85C, mycolyltransferase" FT /tb_orthologue="fbpC1" FT misc_feature 122382..122996 FT /colour=0 FT /note="Pfam match to entry PF00756 Esterase, Putative FT esterase, score 305.30, E-value 7.3e-88" FT RBS 123358..123363 FT /note="possible RBS" FT CDS 123370..124380 FT /class="V" FT /colour=10 FT /gene="ML0099" FT /note="Similar to M. tuberculosis Rv3802c, hypothetical FT protein, TR:O53581 (EMBL:AL123456) (336 aa); Fasta score FT E(): 0, 75.5% identity in 335 aa overlap." FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv3802c" FT CDS 124599..126506 FT /class="I.A.3" FT /colour=1 FT /gene="fadD32" FT /gene="ML0100" FT /note="Similar to several putative acyl-CoA synthases from FT M. tuberculosis e.g. M. tuberculosis Rv3801c, fadD32, FT putative acyl-CoA synthase, TR:O53580 (EMBL:AL123456) (637 FT aa); Fasta score E(): 0, 93.2% identity in 632 aa overlap. FT Similar to Mycobacterium bovis BCG ORF3, acyl-CoA FT synthase, TR:P71495 (EMBL:U75685) (582 aa); Fasta score FT E(): 0, 36.8% identity in 581 aa overlap and to domains of FT polyketide synthases e.g. Myxococcus xanthus safB, FT saframycin Mx1 synthetase B, TR:Q50857 (EMBL:U24657) (1770 FT aa); Fasta score E(): 0, 36.4% identity in 605 aa overlap. FT Contains Pfam match to entry PF00501 AMP-binding, FT AMP-binding enzyme." FT /note="Similar to ML0132, ML0138, ML1234 and ML2358" FT /product="putative acyl-CoA synthetase" FT /tb_orthologue="fadD32" FT misc_feature 124803..126158 FT /colour=0 FT /note="Pfam match to entry PF00501 AMP-binding, FT AMP-binding enzyme, score -85.00, E-value 1.1e-10" FT CDS 126518..131872 FT /class="I.I" FT /colour=1 FT /gene="pks13" FT /gene="ML0101" FT /note="Similar to many polyketide synthases from M. FT tuberculosis e.g. ppsA, M. tuberculosis phenolpthiocerol FT synthesis polyketide synthase, SW:PPSA_MYCTU (Q10977) FT (1876 aa); Fasta score E(): 0, 36.1% identity in 1277 aa FT overlap. Similar to many others e.g. Streptomyces noursei FT nysI, nystatin biosynthesis polyketide synthase, FT TR:AAF71766 (EMBL:AF263912) (9477 aa); Fasta score E(): 0, FT 33.4% identity in 1215 aa overlap. Contains Pfam match to FT entry PF00109 ketoacyl-synt, Beta-ketoacyl synthase. FT Contains Pfam match to entry PF00698 Acyl_transf, Acyl FT transferase domain. Contains Pfam match to entry PF00975 FT Thioesterase, Thioesterase domain. Contains 2 Pfam matches FT to entry PF00550 pp-binding, Phosphopantetheine attachment FT site. Contains PS00606 Beta-ketoacyl synthases active FT site." FT /note="Similar to ML0135, ML0139, ML1229, ML2353, ML2354, FT ML2355, ML2356, ML2357, and ML2607" FT /product="polyketide synthase" FT /tb_orthologue="pks13" FT repeat_unit 126536..126556 FT /note="21 bp direct repeat, CCCCAATTGAACCAGGACCCT" FT /colour=5 FT repeat_unit 126557..126577 FT /note="21 bp direct repeat, CCCCAATTGAACCAGGACCCT" FT /colour=5 FT misc_feature 126689..126889 FT /colour=0 FT /note="Pfam match to entry PF00550 pp-binding, FT Phosphopantetheine attachment site, score 55.80, E-value FT 8.4e-14" FT misc_feature 126971..128248 FT /colour=0 FT /note="Pfam match to entry PF00109 ketoacyl-synt, FT Beta-ketoacyl synthase, score 596.90, E-value 1.3e-175" FT misc_feature 127448..127498 FT /colour=8 FT /note="PS00606 Beta-ketoacyl synthases active site" FT repeat_region 128108..128677 FT /note="570 bp repeat, 100% identitical to region FT 3112112..3112681, occupied by pseudogene ML2067" FT misc_feature 128747..129730 FT /colour=0 FT /note="Pfam match to entry PF00698 Acyl_transf, Acyl FT transferase domain, score 213.30, E-value 3.7e-60" FT misc_feature 130316..130456 FT /colour=0 FT /note="Pfam match to entry PF00550 pp-binding, FT Phosphopantetheine attachment site, score 23.60, E-value FT 6.6e-05" FT misc_feature 131084..131836 FT /colour=0 FT /note="Pfam match to entry PF00975 Thioesterase, FT Thioesterase domain, score 40.90, E-value 2.8e-08" FT CDS 131869..133422 FT /class="I.H.1" FT /colour=1 FT /gene="accD4" FT /gene="ML0102" FT /note="Similar to many acyl-CoA carboxylase subunits e.g. FT M. tuberculosis pccB, acetyl/propionyl-CoA carboxylase FT [beta] subunit, TR:O53578 (EMBL:AL123456) (518 aa); Fasta FT score E(): 0, 91.2% identity in 512 aa overlap and FT Streptomyces coelicolor pccB, propionyl-CoA carboxylase FT complex B subunit, TR:Q9X4K7 (EMBL:AF113605) (530 aa); FT Fasta score E(): 0, 48.2% identity in 521 aa overlap. FT Contains Pfam match to entry PF01039 Carboxyl_trans, FT Carboxyl transferase domain." FT /note="Similar to ML0731 and ML1657" FT /product="putative acyl CoA carboxylase [beta] subunit" FT /tb_orthologue="accD4" FT misc_feature 131914..133419 FT /colour=0 FT /note="Pfam match to entry PF01039 Carboxyl_trans, FT Carboxyl transferase domain, score 544.70, E-value FT 6.3e-160" FT CDS complement(133849..135036) FT /class="I.A.3" FT /colour=0 FT /gene="fadE35" FT /gene="ML0103" FT /note="Possible pseudogene of M. tuberculosis orthologue FT fadE35 (Best blastx score 159)" FT /product="acyl-CoA dehydrogenase (pseudogene)" FT /pseudo FT CDS complement(136573..139824) FT /class="II.C.2" FT /colour=3 FT /gene="embB" FT /gene="ML0104" FT /note="Similar to M. tuberculosis embB, probable FT arabinosyl transferase, TR:P72030 (EMBL:AL123456) (1098 FT aa); Fasta score E(): 0, 78.0% identity in 1101 aa overlap FT and to other putative mycobacterial FT arabinosyltransferases. Involved in resistance to FT ethambutol in M. tuberculosis. Contains hydrophobic, FT possible membrane-spanning regions." FT /note="Similar to ML0105 and ML0106" FT /product="putative arabinosyl transferase" FT /tb_orthologue="embB" FT CDS complement(139821..143156) FT /class="II.C.2" FT /colour=3 FT /gene="embA" FT /gene="ML0105" FT /note="Similar to M. tuberculosis embA, probable FT arabinosyl transferase, TR:Q50394 (EMBL:AL123456) (1092 FT aa); Fasta score E(): 0, 64.2% identity in 1108 aa overlap FT and to other putative mycobacterial FT arabinosyltransferases. Involved in resistance to FT ethambutol in M. tuberculosis. Contains hydrophobic, FT possible membrane-spanning regions." FT /note="Similar to ML0104 and ML0106" FT /product="putative arabinosyl transferase" FT /tb_orthologue="embA" FT CDS complement(144115..147327) FT /class="II.C.2" FT /colour=3 FT /gene="embC" FT /gene="ML0106" FT /note="Similar to M. tuberculosis embC, probable FT arabinosyl transferase, TR:P72059 (EMBL:AL123456) (1094 FT aa); Fasta score E(): 0, 82.8% identity in 1075 aa overlap FT and to other putative mycobacterial FT arabinosyltransferases. Involved in resistance to FT ethambutol in M. tuberculosis. Contains hydrophobic, FT possible membrane-spanning regions." FT /note="Similar to ML0104 and ML0105" FT /product="putative arabinosyl transferase" FT /tb_orthologue="embC" FT CDS complement(147460..149358) FT /class="II.C.4" FT /colour=3 FT /gene="ML0107" FT /note="Similar to M. tuberculosis Rv3792, unknown membrane FT protein, TR:P72058 (EMBL:AL123456) (643 aa); Fasta score FT E(): 0, 77.5% identity in 631 aa overlap and to the FT C-terminal half of Mycobacterium smegmatis ORF3, FT hypothetical membrane protein, TR:O05765 (EMBL:U46844) FT (603 aa); Fasta score E(): 0, 67.8% identity in 267 aa FT overlap. Contains hydrophobic, possible membrane-spanning FT regions." FT /product="putative membrane protein" FT /tb_orthologue="Rv3792" FT CDS complement(149361..150125) FT /class="I.B.7" FT /colour=7 FT /gene="ML0108" FT /note="Similar To M. tuberculosis Rv3791, putative FT oxidoreductase, SW:Y1J1_MYCTU (P72057) (254 aa); Fasta FT score E(): 0, 89.0% identity in 254 aa overlap and to FT other putative oxidoreductases from the same organism. FT Shows weaker similarity to Alcaligenes eutrophus phbB, FT acetoacetyl-CoA reductase, SW:PHBB_ALCEU (P14697) (246 FT aa); Fasta score E(): 3e-09, 28.3% identity in 191 aa FT overlap. Contains Pfam match to entry PF00106 adh_short, FT short chain dehydrogenase. Contains PS00061 Short-chain FT dehydrogenases/reductases family signature." FT /note="Shows weak similarity to ML0429 and to the FT C-terminal half of ML2565" FT /product="putative oxidoreductase" FT /tb_orthologue="Rv3791" FT misc_feature complement(149538..150098) FT /colour=0 FT /note="Pfam match to entry PF00106 adh_short, short chain FT dehydrogenase, score 83.50, E-value 4.2e-21" FT misc_feature complement(149601..149687) FT /colour=8 FT /note="PS00061 Short-chain dehydrogenases/reductases FT family signature" FT CDS complement(150128..151510) FT /class="I.B.7" FT /colour=7 FT /gene="ML0109" FT /note="Similar to M. tuberculosis Rv3790, putative FT oxidoreductase, TR:P72056 (EMBL:AL123456) (461 aa); Fasta FT score E(): 0, 86.6% identity in 461 aa overlap. Also FT similar to many bacterial putative oxidoreductases. FT Contains Pfam match to entry PF01565 FAD_binding_4, FAD FT binding domain." FT /product="putative FAD-linked oxidoreductase" FT /tb_orthologue="Rv3790" FT RBS complement(150137..150140) FT /note="possible RBS" FT misc_feature complement(150956..151489) FT /colour=0 FT /note="Pfam match to entry PF01565 FAD_binding_4, FAD FT binding domain, score -2.30, E-value 4.3e-06" FT CDS complement(151578..151949) FT /class="II.C.4" FT /colour=3 FT /gene="ML0110" FT /note="Similar to M. tuberculosis Rv3789, hypothetical FT protein, SW:Y1I9_MYCTU (P72055) (121 aa); Fasta score E(): FT 0, 73.0% identity in 122 aa overlap. Contains hydrophobic, FT possible membrane-spanning regions." FT /product="possible membrane protein" FT /tb_orthologue="Rv3789" FT RBS complement(151953..151956) FT /note="possible RBS" FT CDS complement(152204..152371) FT /class="V" FT /colour=0 FT /gene="ML0111" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3788 (Best blastx score 157)" FT /product="conserved hypothetical protein (pseudogene)" FT /pseudo FT CDS complement(152783..153613) FT /class="II.C.4" FT /colour=3 FT /gene="ML0112" FT /note="Similar to M. tuberculosis Rv3783, integral FT membrane protein, TR:P72049 (EMBL:AL123456) (280 aa); FT Fasta score E(): 0, 84.3% identity in 280 aa overlap. FT Similar to Yersinia enterocolitica rfbD, O-antigen export FT system permease protein, SW:RFBD_YEREN (Z18920) (259 aa); FT Fasta score E(): 2.9e-32, 28.2% identity in 259 aa overlap FT and to other membrane proteins involved in FT lipopolysaccharide transport. Contains Pfam match to entry FT PF01061 ABC2_membrane, ABC-2 type transporter." FT /product="putative ABC transporter component" FT /tb_orthologue="Rv3783" FT misc_feature complement(152795..153556) FT /colour=0 FT /note="Pfam match to entry PF01061 ABC2_membrane, ABC-2 FT type transporter, score 276.20, E-value 4.3e-79" FT RBS complement(153624..153629) FT /note="possible RBS" FT CDS complement(153663..154514) FT /class="II.C.2" FT /colour=3 FT /gene="rfbE" FT /gene="ML0113" FT /note="Similar to M. tuberculosis Rv3782, putative FT glycosyl transferase, TR:P72048. Shows very weak FT similarity to proteins involved in lipopolysaccharide FT biosynthesis." FT /product="putative glycosyl transferase" FT /tb_orthologue="rfbE" FT CDS complement(154576..155394) FT /class="II.C.4" FT /colour=3 FT /gene="ML0114" FT /note="Similar to M. tuberculosis Rv3781, putative ABC FT transporter component, TR:P72047 (EMBL:AL123456) (273 aa); FT Fasta score E(): 0, 91.4% identity in 267 aa overlap. FT Similar to Yersinia enterocolitica rfbE, O-antigen export FT system ATP-binding protein, SW:RFBE_YEREN (Q56903) (239 FT aa); Fasta score E(): 0, 46.9% identity in 224 aa overlap FT and to other proteins involved in lipopolysaccharide FT transport. Contains Pfam match to entry PF00005 ABC_tran, FT ABC transporter. Contains PS00017 ATP/GTP-binding site FT motif A (P-loop)." FT /product="putative ABC transporter ATP-binding component" FT /tb_orthologue="Rv3781" FT misc_feature complement(154702..155214) FT /colour=0 FT /note="Pfam match to entry PF00005 ABC_tran, ABC FT transporter, score 118.80, E-value 1e-31" FT misc_feature complement(155170..155193) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT CDS complement(155413..155937) FT /class="V" FT /colour=10 FT /gene="ML0115" FT /note="Similar to M. tuberculosis Rv3780, hypothetical FT protein, SW:Y1I0_MYCTU (P72046) (178 aa); Fasta score E(): FT 0, 82.9% identity in 170 aa overlap and to Streptomyces FT coelicolor SCGD3.23C, hypothetical protein, TR:Q9XA56 FT (EMBL:AL096822) (179 aa); Fasta score E(): 0, 65.7% FT identity in 178 aa overlap." FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv3780" FT RBS complement(155949..155954) FT /note="possible RBS" FT CDS complement(155965..157929) FT /class="II.C.4" FT /colour=3 FT /gene="ML0116" FT /note="Similar to M. tuberculosis Rv3779, unknown membrane FT protein, TR:P72045 (EMBL:AL123456) (666 aa); Fasta score FT E(): 0, 66.5% identity in 666 aa overlap. Contains FT hydrophobic, possible membrane-spanning regions." FT /product="putative membrane protein" FT /tb_orthologue="Rv3779" FT RBS 158044..158050 FT /note="possible RBS" FT CDS 158056..159252 FT /class="V" FT /colour=10 FT /gene="ML0117" FT /note="Similar to M. tuberculosis Rv3778c, conserved FT hypothetical protein, TR:P72044 (EMBL:AL123456) (398 aa); FT Fasta score E(): 0, 83.4% identity in 398 aa overlap. Also FT similar to many bacterial hypothetical proteins." FT /note="Similar to ML0596 and to the C-terminal half of FT ML0842" FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv3778c" FT CDS complement(159249..160259) FT /class="I.B.7" FT /colour=7 FT /gene="ML0118" FT /note="Similar to M. tuberculosis Rv3777, putative FT oxidireductase, TR:P72043. Similar to many oxidoreductases FT from both bacteria and higher organisms e.g. Mus musculus FT cryZ, quinone oxidoreductase, SW:QOR_MOUSE (P47199) (331 FT aa); Fasta score E(): 5.5e-21, 31.0% identity in 306 aa FT overlap. Contains Pfam match to entry PF00107 adh_zinc, FT Zinc-binding dehydrogenases." FT /note="Similar to domains of polyketide synthases ML0135, FT ML0139, ML1229 and ML2355" FT /product="putative oxidireductase" FT /tb_orthologue="Rv3777" FT misc_feature complement(159294..160232) FT /colour=0 FT /note="Pfam match to entry PF00107 adh_zinc, Zinc-binding FT dehydrogenases, score 48.50, E-value 2.4e-12" FT tRNA 160312..160401 FT /colour=4 FT /note="tRNA Ser anticodon TGA, Cove score 59.58" FT /gene="serU" FT CDS complement(160495..161730) FT /class="II.B.5" FT /colour=7 FT /gene="lipE" FT /gene="ML0119" FT /note="Similar to M. tuberculosis Rv3775, probable FT hydrolase, TR:P72041 (EMBL:AL123456) (415 aa); Fasta score FT E(): 0, 84.7% identity in 406 aa overlap. Similar to FT bacterial esterases e.g. Streptomyces chrysomallus estA, FT esterase A, TR:O87861 (EMBL:Z15137) (389 aa); Fasta score FT E(): 2.6e-18, 29.9% identity in 348 aa overlap." FT /product="probable hydrolase" FT /tb_orthologue="lipE" FT RBS complement(161739..161742) FT /note="possible RBS" FT CDS complement(161741..162577) FT /class="I.A.3" FT /colour=1 FT /gene="echA1" FT /gene="ML0120" FT /note="Similar to M. tuberculosis Rv3774, putative FT enoyl-CoA hydratase, TR:P75019 (EMBL:AL123456) (274 aa); FT Fasta score E(): 0, 88.3% identity in 274 aa overlap. FT Similar to many e.g. Rattus norvegicus ech1, FT delta3,5-delta2,4-dienoyl-coa isomerase precursor, FT SW:ECH1_RAT (Q62651) (327 aa); Fasta score E(): 3.5e-31, FT 38.8% identity in 276 aa overlap and bacterial putative FT enoyl-CoA hydratases. Contains Pfam match to entry PF00378 FT ECH, Enoyl-CoA hydratase/isomerase family." FT /note="Similar to ML1241, ML1724, ML2118 and ML2402" FT /product="putative enoyl-CoA hydratase" FT /tb_orthologue="echA21" FT misc_feature complement(161975..162517) FT /colour=0 FT /note="Pfam match to entry PF00378 ECH, Enoyl-CoA FT hydratase/isomerase family, score 99.60, E-value 6.2e-26" FT CDS complement(163770..164039) FT /class="VI" FT /colour=10 FT /gene="ML0121" FT /note="Shares region of weak similarity with Streptomyces FT coelicolor SC6A5.32C, hypothetical protein, TR:Q9X7X8 FT (EMBL:AL049485) (155 aa); Fasta score E(): 0.0056, 43.1% FT identity in 58 aa overlap." FT /product="hypothetical protein" FT RBS complement(164048..164051) FT /note="possible RBS" FT CDS complement(164082..164876) FT /class="I.D.5" FT /colour=0 FT /gene="hisC2" FT /gene="ML0122" FT /note="Possible pseudogene of M. tuberculosis orthologue FT hisC2 (Best blastx score 574)" FT /product="histidinol-phosphate aminotransferase FT (pseudogene)" FT /pseudo FT tRNA 165035..165127 FT /colour=4 FT /note="tRNA Ser anticodon GCT, Cove score 56.23" FT /gene="serT" FT tRNA 165147..165219 FT /colour=4 FT /note="tRNA Arg anticodon ACG, Cove score 76.52" FT /gene="argU" FT CDS 166460..166833 FT /class="V" FT /colour=0 FT /gene="ML0123" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3767c (Best blastx score 169)" FT /product="conserved hypothetical protein (pseudogene)" FT /pseudo FT CDS complement(166949..167389) FT /class="V" FT /colour=10 FT /gene="ML0124" FT /note="Shows weak similarity to M. tuberculosis Rv2186c, FT hypothetical protein, TR:O53519 (EMBL:AL123456) (144 aa); FT Fasta score E(): 3.7e-06, 27.5% identity in 131 aa overlap FT and Streptomyces coelicolor SC6G10.02C, hypothetical FT protein, TR:Q9X7Y8 (EMBL:AL049497) (144 aa); Fasta score FT E(): 7e-05, 21.9% identity in 137 aa overlap. Previously FT sequenced as TR:O06090 (EMBL:Z95398) (156 aa); Fasta score FT E(): 0, 70.1% identity in 144 aa overlap." FT /note="Similar to ML2629 and shows weaker similarity to FT ML0889" FT /product="conserved hypothetical protein" FT CDS 167598..168914 FT /class="IV.H" FT /colour=7 FT /gene="ML0125" FT /note="Similar to M. tuberculosis Rv2958c, putative FT glycosyl transferase, TR:P95134 (EMBL:AL123456) (428 aa); FT Fasta score E(): 0, 74.6% identity in 418 aa overlap and FT Rv2962c, putative glycosyl transferase, TR:P95130 FT (EMBL:AL123456) (449 aa); Fasta score E(): 0, 77.5% FT identity in 426 aa overlap. Similar to Streptomyces FT venezuelae desVII, glycosyl transferase from a macrolide FT antibiotic biosynthesis gene cluster, TR:Q9ZGH7 FT (EMBL:AF079762) (426 aa); Fasta score E(): 1e-09, 30.0% FT identity in 237 aa overlap. Shows similarity to bacterial FT and eukaryotic glycosyl transferases." FT /note="Similar to ML0128 and shows weaker similarity to FT ML0985" FT /product="putative glycosyl transferase" FT /tb_orthologue="Rv2958c" FT /tb_orthologue="Rv2962c" FT repeat_region 167887..168892 FT /note="1006 bp repeat, 96% identical to region FT 171902..172907 in ML0128" FT RBS 169572..169578 FT /note="possible RBS" FT CDS 169585..170406 FT /class="VI" FT /colour=8 FT /gene="ML0126" FT /note="Unknown function." FT /product="hypothetical protein" FT RBS 170650..170655 FT /note="possible RBS" FT CDS 170662..171351 FT /class="VI" FT /colour=10 FT /gene="ML0127" FT /note="Similar to M. tuberculosis Rv2959c, hypothetical FT protein, TR:Q50457 (EMBL:AL123456) (245 aa); Fasta score FT E(): 0, 76.1% identity in 226 aa overlap. Shows weak FT similarity to Streptomyces clavuligerus cmcI, FT cephalosporin hydroxylase component of 7 FT alpha-cephem-methoxylase, TR:O85726 (EMBL:AF073896) (236 FT aa); Fasta score E(): 0.0001, 27.6% identity in 163 aa FT overlap and to other hypothetical proteins." FT /product="hypothetical protein" FT /tb_orthologue="Rv2959c" FT CDS 171616..172923 FT /class="IV.H" FT /colour=7 FT /gene="ML0128" FT /note="Similar to M. tuberculosis Rv2958c, putative FT glycosyl transferase, TR:P95134 (EMBL:AL123456) (428 aa); FT Fasta score E(): 0, 75.1% identity in 417 aa overlap and FT Rv2962c, putative glycosyl transferase, TR:P95130 FT (EMBL:AL123456) (449 aa); Fasta score E(): 0, 74.4% FT identity in 425 aa overlap. Similar to Streptomyces FT venezuelae desVII, glycosyl transferase from a macrolide FT antibiotic biosynthesis gene cluster, TR:Q9ZGH7 FT (EMBL:AF079762) (426 aa); Fasta score E(): 1.1e-09, 30.9% FT identity in 223 aa overlap. Shows similarity to bacterial FT and eukaryotic glycosyl transferases." FT /note="Similar to ML0125 and shows weaker similarity to FT ML0985" FT /product="putative glycosyl transferase" FT /tb_orthologue="Rv2958c" FT /tb_orthologue="Rv2962c" FT repeat_region 171902..172907 FT /note="1006 bp repeat, 96% identical to region FT 167887..168892 in ML0125" FT CDS complement(173170..174426) FT /class="V" FT /colour=10 FT /gene="ML0129" FT /note="Similar to M. tuberculosis Rv2953, conserved FT hypothetical protein, TR:P95139 (EMBL:AL123456) (418 aa); FT Fasta score E(): 0, 86.6% identity in 418 aa overlap and FT to Rv2449c, conserved hypothetical protein, TR:O53176 FT (EMBL:AL123456) (419 aa); Fasta score E(): 0, 64.9% FT identity in 419 aa overlap. Similar to many bacterial FT hypothetical proteins." FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv2449c" FT CDS complement(174466..175278) FT /class="V" FT /colour=10 FT /gene="ML0130" FT /note="Similar to M.tuberculosis Rv2952, hypothetical FT protein, TR:Q50464 (EMBL:AL123456) (270 aa); Fasta score FT E(): 0, 83.7% identity in 270 aa overlap. Similar to in FT part to Streptomyces hygroscopicus rapM, methyltransferase FT involved in rapamycin biosynthesis, TR:Q54303 FT (EMBL:X86780) (317 aa); Fasta score E(): 5e-14, 38.6% FT identity in 158 aa overlap and shows weak similarity to FT CDS associated with several gene clusters encoding FT polyketide biosynthesis." FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv2952" FT CDS 175441..176589 FT /class="I.B.7" FT /colour=7 FT /gene="ML0131" FT /note="Similar to M. tuberculosis Rv2951c, putative FT oxidoreductase, TR:P95140 (EMBL:AL123456) (381 aa); Fasta FT score E(): 0, 84.8% identity in 382 aa overlap. Similar to FT Archaeoglobus fulgidus AF2411, conserved hypothetical FT protein, TR:O30260 (EMBL:AE001109) (363 aa); Fasta score FT E(): 0, 31.5% identity in 362 aa overlap. Shows weak FT similarity to bacterial oxidoreductases e.g. Mycobacterium FT smegmatis fgd, F420-dependent glucose-6-phosphate FT dehydrogenase, TR:O68447 (EMBL:AF041061) (336 aa); Fasta FT score E(): 1.1e-09, 27.7% identity in 292 aa overlap." FT /note="Shows weak similarity to ML0269" FT /product="putative oxidoreductase" FT /tb_orthologue="Rv2951c" FT CDS 177170..179212 FT /class="I.A.3" FT /colour=1 FT /gene="fadD29" FT /gene="ML0132" FT /note="Similar to several putative acyl-CoA synthases from FT M. tuberculosis e.g. M. tuberculosis Rv2950c, fadD29, FT putative acyl-CoA synthase, TR:P95141 (EMBL:AL123456) (619 FT aa); Fasta score E(): 0, 80.2% identity in 620 aa overlap. FT Similar to Mycobacterium bovis BCG ORF3, acyl-CoA FT synthase, TR:P71495 (EMBL:U75685) (582 aa); Fasta score FT E(): 0, 58.5% identity in 585 aa overlap and to domains of FT polyketide synthases e.g. Myxococcus xanthus safB, FT saframycin Mx1 synthetase B, TR:Q50857 (EMBL:U24657) (1770 FT aa); Fasta score E(): 0, 36.2% identity in 589 aa overlap. FT Contains Pfam match to entry PF00501 AMP-binding, FT AMP-binding enzyme." FT /note="Similar to ML0100, ML0138, ML1234 and ML2358" FT /product="putative acyl-CoA synthetase" FT /tb_orthologue="fadD29" FT misc_feature 177581..178942 FT /colour=0 FT /note="Pfam match to entry PF00501 AMP-binding, FT AMP-binding enzyme, score -14.90, E-value 1.4e-14" FT CDS 179256..179888 FT /class="V" FT /colour=10 FT /gene="ML0133" FT /note="Similar to M. tuberculosis Rv2949c, hypothetical FT protein, TR:O86325 (EMBL:AL123456) (199 aa); Fasta score FT E(): 0, 62.6% identity in 195 aa overlap. Shows weaker FT similarity to Archaeoglobus fulgidus AF1396, hypothetical FT protein, TR:O28875 (EMBL:AE001008) (162 aa); Fasta score FT E(): 4.2e-05, 26.6% identity in 154 aa overlap. Contains FT Pfam match to entry PF01947 DUF98, Protein of unknown FT function." FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv2949c" FT misc_feature 179295..179786 FT /colour=0 FT /note="Pfam match to entry PF01947 DUF98, Protein of FT unknown function, score -37.20, E-value 0.0013" FT CDS 180027..182150 FT /class="I.A.3" FT /colour=1 FT /gene="fadD22" FT /gene="ML0134" FT /note="Similar to M. tuberculosis Rv2948c, acyl-CoA FT synthase, TR:P96283 (EMBL:AL123456) (705 aa); Fasta score FT E(): 0, 75.9% identity in 705 aa overlap. Similar to many FT acyl-CoA synthases e.g. Rhodopseudomonas palustris, badA, FT benzoate-coenzyme A ligase, TR:Q59760 (EMBL:L42322) (521 FT aa); Fasta score E(): 0, 31.4% identity in 494 aa overlap. FT Contains Pfam match to entry PF00550 pp-binding, FT Phosphopantetheine attachment site. Contains Pfam match to FT entry PF00501 AMP-binding, AMP-binding enzyme." FT /note="Similar to ML1051, ML1994, ML2257 and ML2546" FT /product="putative acyl-CoA synthetase" FT /tb_orthologue="fadD22" FT misc_feature 180120..181280 FT /colour=0 FT /note="Pfam match to entry PF00501 AMP-binding, FT AMP-binding enzyme, score 66.50, E-value 4e-19" FT misc_feature 181674..181877 FT /colour=0 FT /note="Pfam match to entry PF00550 pp-binding, FT Phosphopantetheine attachment site, score 43.60, E-value FT 2e-10" FT RBS 182156..182160 FT /note="possible RBS" FT CDS 182173..188484 FT /class="I.I" FT /colour=1 FT /gene="ML0135" FT /note="Similar to many polyketide synthases from M. FT tuberculosis e.g. N-terminus is similar to Rv2947c, pks15, FT probable polyketide synthase, TR:P96284 (EMBL:Z83858) (496 FT aa); Fasta score E(): 0, 90.5% identity in 485 aa overlap FT and the remainder is similar to Rv2946c, pks1, probable FT polyketide synthase, TR:P96285 (EMBL:Z83858) (1616 aa); FT Fasta score E(): 0, 82.5% identity in 1620 aa overlap. FT Similar to many others e.g. Streptomyces noursei NysC, FT nystatin biosynthesis polyketide synthase, TR:AAF71776 FT (EMBL:AF263912) (11096 aa); Fasta score E(): 0, 50.2% FT identity in 2161 aa overlap. Contains Pfam match to entry FT PF00107 adh_zinc, Zinc-binding dehydrogenases. Contains FT Pfam match to entry PF00109 ketoacyl-synt, Beta-ketoacyl FT synthase. Contains Pfam match to entry PF00698 FT Acyl_transf, Acyl transferase domain. Contains Pfam match FT to entry PF00550 pp-binding, Phosphopantetheine attachment FT site. Contains PS00012 Phosphopantetheine attachment site. FT Contains PS00606 Beta-ketoacyl synthases active site." FT /note="Similar to ML0101, ML0139, ML1229, ML2353, ML2354, FT ML2355, ML2356 and ML2357" FT /product="putative polyketide synthase" FT /tb_orthologue="pks1" FT /tb_orthologue="pks15" FT misc_feature 182302..183570 FT /colour=0 FT /note="Pfam match to entry PF00109 ketoacyl-synt, FT Beta-ketoacyl synthase, score 753.90, E-value 6.6e-223" FT misc_feature 182776..182826 FT /colour=8 FT /note="PS00606 Beta-ketoacyl synthases active site" FT misc_feature 183877..184821 FT /colour=0 FT /note="Pfam match to entry PF00698 Acyl_transf, Acyl FT transferase domain, score 226.70, E-value 3.4e-64" FT misc_feature 186370..187281 FT /colour=0 FT /note="Pfam match to entry PF00107 adh_zinc, Zinc-binding FT dehydrogenases, score -67.70, E-value 3.9e-06" FT misc_feature 188185..188388 FT /colour=0 FT /note="Pfam match to entry PF00550 pp-binding, FT Phosphopantetheine attachment site, score 76.30, E-value FT 1.7e-19" FT misc_feature 188263..188310 FT /colour=8 FT /note="PS00012 Phosphopantetheine attachment site" FT RBS 188537..188540 FT /note="possible RBS" FT CDS 188551..189252 FT /class="II.C.1" FT /colour=3 FT /gene="lppX" FT /gene="ML0136" FT /note="Similar to M. tuberculosis lipoproteins e.g. M. FT tuberculosis lppX, putative lipoprotein, SW:LPPX_MYCTU FT (Z83858) (233 aa); Fasta score E(): 0, 76.4% identity in FT 233 aa overlap. Similar to Mycobacterium bovis lprG, 27 FT kDa lipoprotein antigen, SW:LPRG_MYCTU (AJ000500) (236 FT aa); Fasta score E(): 2.5e-13, 31.2% identity in 202 aa FT overlap. Contains a probable N-terminal signal sequence. FT Contains PS00013 Prokaryotic membrane lipoprotein lipid FT attachment site." FT /note="Similar to ML0557" FT /product="putative lipoprotein" FT /tb_orthologue="lppX" FT misc_feature 188575..188607 FT /colour=8 FT /note="PS00013 Prokaryotic membrane lipoprotein lipid FT attachment site" FT CDS complement(189253..191961) FT /class="II.C.4" FT /colour=3 FT /gene="mmpL7" FT /gene="ML0137" FT /note="Similar to members of the M. tuberculosis mmpL FT family of membrane proteins e.g. Rv2942, mmpL7, putative FT membrane protein, SW:MML7_MYCTU (P96289) (920 aa); Fasta FT score E(): 0, 68.6% identity in 881 aa overlap. Contains FT hydrophobic, possible membrane-spanning regions." FT /note="Similar to ML1231 and ML2378. Similar to pseudogene FT ML2375" FT /product="putative membrane protein" FT /tb_orthologue="mmpL7" FT CDS complement(192013..193752) FT /class="I.A.3" FT /colour=1 FT /gene="fadD28" FT /gene="ML0138" FT /note="Similar to several putative acyl-CoA synthases from FT M. tuberculosis e.g. M. tuberculosis Rv2941, fadD29, FT putative acyl-CoA synthase, TR:P96290 (EMBL:AL123456) (580 FT aa); Fasta score E(): 0, 81.9% identity in 580 aa overlap. FT Similar to Mycobacterium bovis BCG ORF3, acyl-CoA FT synthase, TR:P71495 (EMBL:U75685) (582 aa); Fasta score FT E(): 0, 81.4% identity in 580 aa overlap and to domains of FT polyketide synthases e.g. Myxococcus xanthus safB, FT saframycin Mx1 synthetase B, TR:Q50857 (EMBL:U24657) (1770 FT aa); Fasta score E(): 0, 35.8% identity in 590 aa overlap. FT Contains Pfam match to entry PF00501 AMP-binding, FT AMP-binding enzyme." FT /note="Similar to ML0100, ML0132, ML0243, ML1234, ML2358" FT /product="acyl-CoA synthetase" FT /tb_orthologue="fadD28" FT misc_feature complement(192277..193635) FT /colour=0 FT /note="Pfam match to entry PF00501 AMP-binding, FT AMP-binding enzyme, score -8.20, E-value 5.9e-15" FT RBS 194207..194210 FT /note="possible RBS" FT CDS 194221..200571 FT /class="I.I" FT /colour=1 FT /gene="mas" FT /gene="ML0139" FT /note="Similar to many polyketide synthases from M. FT tuberculosis e.g. Rv2940c, mas, mycocerosic acid synthase, FT TR:P96291 (EMBL:AL123456) (2111 aa); Fasta score E(): 0, FT 88.0% identity in 2119 aa overlap. Similar to FT Mycobacterium bovis mas, mycocerosic acid synthase, FT SW:MCAS_MYCBO (Q02251) (2110 aa); Fasta score E(): 0, FT 85.1% identity in 2122 aa overlap. Contains Pfam match to FT entry PF00107 adh_zinc, Zinc-binding dehydrogenases. FT Contains Pfam match to entry PF00109 ketoacyl-synt, FT Beta-ketoacyl synthase. Contains Pfam match to entry FT PF00698 Acyl_transf, Acyl transferase domain. Contains FT Pfam match to entry PF00550 pp-binding, Phosphopantetheine FT attachment site. Contains PS00012 Phosphopantetheine FT attachment site. Contains PS00606 Beta-ketoacyl synthases FT active site." FT /note="Similar to ML0101, ML0135, ML1229, ML2353, ML2354, FT ML2355, ML2356 and ML2357" FT /product="putative mycocerosic synthase" FT /tb_orthologue="mas" FT misc_feature 194242..195510 FT /colour=0 FT /note="Pfam match to entry PF00109 ketoacyl-synt, FT Beta-ketoacyl synthase, score 619.80, E-value 1.6e-182" FT misc_feature 194722..194772 FT /colour=8 FT /note="PS00606 Beta-ketoacyl synthases active site" FT misc_feature 195832..196791 FT /colour=0 FT /note="Pfam match to entry PF00698 Acyl_transf, Acyl FT transferase domain, score 500.60, E-value 1.2e-146" FT misc_feature 198499..199440 FT /colour=0 FT /note="Pfam match to entry PF00107 adh_zinc, Zinc-binding FT dehydrogenases, score -26.80, E-value 2.5e-08" FT misc_feature 200299..200502 FT /colour=0 FT /note="Pfam match to entry PF00550 pp-binding, FT Phosphopantetheine attachment site, score 71.50, E-value FT 3.6e-18" FT misc_feature 200377..200424 FT /colour=8 FT /note="PS00012 Phosphopantetheine attachment site" FT CDS 200930..201848 FT /class="V" FT /colour=0 FT /gene="ML0140" FT /note="Possible pseudogene similar to M. tuberculosis FT paralogue Rv0221 (Best blastx score 157)" FT /product="conserved hypothetical protein (pseudogene)" FT /pseudo FT CDS complement(202307..202561) FT /class="VI" FT /colour=8 FT /gene="ML0141" FT /note="Improbable CDS suggested by GC frameplot. Possibly FT the remains of a disrupted gene." FT /product="hypothetical protein" FT CDS 204363..204611 FT /class="II.C.5" FT /colour=3 FT /gene="ML0142" FT /note="Unknown function. Contains hydrophobic, possible FT membrane-spanning region." FT /product="possible membrane protein" FT repeat_region complement(204703..207085) FT /note="Dispersed repeat, LEPREP, copy 1" FT /label=LEPREP FT /colour=5 FT CDS complement(204890..204988) FT /class="IV.B" FT /colour=0 FT /gene="ML0143" FT /note="Similar to Agrobacterium tumefaciens transposase FT TR:Q44454 (EMBL:Z18270) (366 aa) fasta scores: E(): FT 0.0002, 51.5% id in 33 aa, and to Pseudomonas putida FT transposase tnpa1 TR:Q9R9U9 (EMBL:AJ245436) (355 aa) fasta FT scores: E(): 0.00088, 48.5% id in 33 aa" FT /pseudo FT CDS complement(205253..206396) FT /class="IV.B" FT /colour=0 FT /gene="ML0144" FT /note="Similar to many e.g. Cryphonectria parasitica FT (Chesnut blight fungus) putative maturase TR:AAF27656 FT (EMBL:AF218567) (778 aa) fasta scores: E(): 7.8e-11, 29.2% FT id in 216 aa" FT /product="putative group II intron maturase-related FT protein" FT /pseudo FT stem_loop complement(205716..205769) FT CDS complement(206601..206740) FT /class="IV.B" FT /colour=0 FT /gene="ML0145" FT /note="Similar to Pseudomonas putida transposase tnpa1 FT TR:Q9R9U9 (EMBL:AJ245436) (355 aa) fasta scores: E(): FT 3.4e-05, 47.8% id in 46 aa, and to Agrobacterium FT tumefaciens transposase TR:Q44454 (EMBL:Z18270) (366 aa) FT fasta scores: E(): 0.00026, 41.3% id in 46 aa" FT /pseudo FT repeat_region complement(207086..207280) FT /note="195 bp sequence found at 5'-end of copies 1 and 3 FT of LEPREP" FT CDS complement(207844..207954) FT /class="V" FT /colour=0 FT /gene="ML0146" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv0941c (Best blastx score 108)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT repeat_region 208823..208975 FT /note="153 bp repeat, 95% identical to region FT 2409794..2409946" FT repeat_region 208823..208975 FT /note="153 bp repeat, 95% identical to region FT 2409794..2409946" FT misc_feature 208911..209192 FT /colour=0 FT /note="Pfam match to entry PF00934 PE, PE family, score FT 116.70, E-value 4.4e-31" FT CDS 208911..209279 FT /note="Similar to the N-terminal, non-repetitive domains FT of M.tuberculosis PE-family proteins e.g. Rv1803c, FT PE_family, PGRS-subfamily protein, TR:O53952. The start FT codon appears to have been mutated (ATG to ATA)" FT /class="IV.C.1" FT /colour=0 FT /product="putative PE-family protein (pseudogene)" FT /fasta_match="TR:O53952 (EMBL:AL123456)" FT /gene="ML0147" FT /pseudo FT CDS 209823..210314 FT /class="II.A.5" FT /colour=0 FT /gene="ML0148" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv0944 (Best blastx score 261)" FT /product="possible formamidopyrimidine-DNA glycosylase FT (pseudogene)" FT /pseudo FT CDS 210338..211058 FT /class="I.B.7" FT /colour=0 FT /gene="ML0149" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv0945 (Best blastx score 196)" FT /product="ketoacyl reductase (pseudogene)" FT /pseudo FT CDS complement(211150..212814) FT /EC_number="5.3.1.9" FT /class="I.B.1" FT /colour=7 FT /gene="pgi" FT /gene="ML0150" FT /note="Similar to M. tuberculosis Rv0946c, pgi, FT glucose-6-phosphate isomerase, SW:G6PI_MYCTU (P77895) (553 FT aa); Fasta score E(): 0, 85.5% identity in 552 aa overlap FT and Mycobacterium smegmatis pgi, glucose-6-phosphate FT isomerase, SW:G6PI_MYCSM (P96803) (442 aa); Fasta score FT E(): 0, 84.1% identity in 440 aa overlap. Contains Pfam FT match to entry PF00342 PGI, Phosphoglucose isomerase. FT Contains PS00765 Phosphoglucose isomerase signature 1. FT Contains PS00174 Phosphoglucose isomerase signature 2." FT /product="glucose-6-phosphate isomerase" FT /tb_orthologue="pgi" FT misc_feature complement(211186..212652) FT /colour=0 FT /note="Pfam match to entry PF00342 PGI, Phosphoglucose FT isomerase, score 794.70, E-value 3.5e-235" FT misc_feature complement(211270..211323) FT /colour=8 FT /note="PS00174 Phosphoglucose isomerase signature 2" FT misc_feature complement(211972..212013) FT /colour=8 FT /note="PS00765 Phosphoglucose isomerase signature 1" FT CDS complement(213175..213492) FT /class="V" FT /colour=10 FT /gene="ML0151" FT /note="Similar to M. tuberculosis Rv0948c, hypothetical FT protein, SW:Y948_MYCTU (P71562) (105 aa); Fasta score E(): FT 1.9e-32, 83.8% identity in 105 aa overlap. Also similar to FT Streptomyces coelicolor SCD63.16C, hypothetical protein, FT TR:CAB82023 (EMBL:AL161755) (110 aa); Fasta score E(): FT 3.9e-06, 44.4% identity in 72 aa overlap." FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv0948c" FT RBS complement(213504..213507) FT /note="possible RBS" FT CDS 214001..214189 FT /class="VI" FT /colour=8 FT /gene="ML0152" FT /note="Improbable CDS suggested by GC frameplot. Possibly FT the remains of a disrupted gene." FT /product="hypothetical protein" FT CDS 214272..216608 FT /class="II.A.5" FT /colour=2 FT /gene="uvrD" FT /gene="ML0153" FT /note="Similar to M. tuberculosis Rv0949, uvrD, putative FT DNA-dependent ATPase I and helicase II, TR:P71561 FT (EMBL:AL123456) (771 aa); Fasta score E(): 0, 81.4% FT identity in 780 aa overlap. Similar to many DNA helicases FT e.g. Bacillus stearothermophilus pcrA, ATP-dependent FT helicase, SW:PCRA_BACST (P56255) (724 aa); Fasta score FT E(): 0, 43.8% identity in 774 aa overlap. Contains Pfam FT match to entry PF00580 UvrD-helicase, UvrD/REP helicase. FT Contains PS00017 ATP/GTP-binding site motif A (P-loop)." FT /note="Similar to ML0637" FT /product="putative ATP-dependent DNA helicase" FT /tb_orthologue="uvrD" FT misc_feature 214335..215804 FT /colour=0 FT /note="Pfam match to entry PF00580 UvrD-helicase, UvrD/REP FT helicase, score 416.10, E-value 3.4e-121" FT misc_feature 214389..214412 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT CDS complement(217160..218161) FT /class="V" FT /colour=10 FT /gene="ML0154" FT /note="Similar to M. tuberculosis Rv0950c, hypothetical FT protein, TR:P71560 (EMBL:AL123456) (332 aa); Fasta score FT E(): 0, 71.0% identity in 331 aa overlap. Shows weaker FT similarity to many bacterial hypothetical proteins which FT contains a Peptidase family M23/M37 domain. Previously FT sequenced as TR:Q9Z5H9 (EMBL:AL035500) (343 aa); Fasta FT score E(): 0, 100.0% identity in 333 aa overlap. Contains FT Pfam match to entry PF01551 Peptidase_M37, Peptidase FT family M23/M37." FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv0950c" FT misc_feature complement(217202..217453) FT /colour=0 FT /note="Pfam match to entry PF01551 Peptidase_M37, FT Peptidase family M23/M37, score 144.20, E-value 2.2e-39" FT CDS 218458..219639 FT /EC_number="6.2.1.5" FT /class="I.B.3" FT /colour=7 FT /gene="sucC" FT /gene="ML0155" FT /note="Similar to M. tuberculosis Rv0951, sucC, putative FT succinyl-CoA synthase [beta] chain, SW:SUCC_MYCTU (P71559) FT (387 aa); Fasta score E(): 0, 86.7% identity in 391 aa FT overlap. Similar to many e.g. Thermus aquaticus sucC, FT succinyl-CoA synthase [beta] chain, SW:SUCC_THEFL (P25126) FT (378 aa); Fasta score E(): 0, 48.7% identity in 384 aa FT overlap. Previously sequenced as TR:Q9Z5H8 (EMBL:AL035500) FT (393 aa); Fasta score E(): 0, 100.0% identity in 393 aa FT overlap. Contains Pfam match to entry PF00549 ligase-CoA, FT CoA-ligases. Contains Pfam match to entry PF02222 FT ATP-grasp, ATP-grasp domain. Contains PS01217 ATP-citrate FT lyase / succinyl-CoA ligases family signature 3." FT /product="succinyl-CoA synthase [beta] chain" FT /tb_orthologue="sucC" FT misc_feature 218542..219027 FT /colour=0 FT /note="Pfam match to entry PF02222 ATP-grasp, ATP-grasp FT domain, score 164.40, E-value 1.9e-45" FT misc_feature 219187..219564 FT /colour=0 FT /note="Pfam match to entry PF00549 ligase-CoA, FT CoA-ligases, score 129.00, E-value 6.8e-35" FT misc_feature 219220..219294 FT /colour=8 FT /note="PS01217 ATP-citrate lyase / succinyl-CoA ligases FT family signature 3" FT RBS 219639..219644 FT /note="possible RBS" FT CDS 219659..220561 FT /EC_number="6.2.1.5" FT /class="I.B.3" FT /colour=7 FT /gene="sucD" FT /gene="ML0156" FT /note="Similar to M. tuberculosis Rv0952, sucD, putative FT succinyl-CoA synthase [alpha] chain, SW:SUCD_MYCTU FT (P71558) (303 aa); Fasta score E(): 0, 86.3% identity in FT 300 aa overlap. Similar to many e.g. Escherichia coli FT sucD, succinyl-CoA synthase [alpha] chain, SW:SUCD_ECOLI FT (P07459) (288 aa); Fasta score E(): 0, 50.3% identity in FT 298 aa overlap. Previously sequenced as TR:Q9S372 FT (EMBL:AL035500) (300 aa); Fasta score E(): 0, 100.0% FT identity in 300 aa overlap. Contains Pfam match to entry FT PF00549 ligase-CoA, CoA-ligases. Contains PS00017 FT ATP/GTP-binding site motif A (P-loop). Contains PS00399 FT ATP-citrate lyase / succinyl-CoA ligases family active FT site. Contains PS01216 ATP-citrate lyase / succinyl-CoA FT ligases family signature 1." FT /product="succinyl-CoA synthase [alpha] chain" FT /tb_orthologue="sucD" FT misc_feature 220088..220525 FT /colour=0 FT /note="Pfam match to entry PF00549 ligase-CoA, FT CoA-ligases, score 115.90, E-value 3.2e-31" FT misc_feature 220145..220228 FT /colour=8 FT /note="PS01216 ATP-citrate lyase / succinyl-CoA ligases FT family signature 1" FT misc_feature 220391..220432 FT /colour=8 FT /note="PS00399 ATP-citrate lyase / succinyl-CoA ligases FT family active site" FT misc_feature 220490..220513 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT CDS complement(220591..221452) FT /class="I.B.7" FT /colour=0 FT /gene="ML0157" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv0953c (Best blastx score 518)" FT /product="similar to alkanal monooxygenase beta chains FT (pseudogene)" FT /pseudo FT CDS 221657..222601 FT /class="II.C.2" FT /colour=3 FT /gene="ML0158" FT /note="Similar to M. tuberculosis Rv0954, 34 kDa antigenic FT protein homologue, SW:34KD_MYCTU (P71556) (303 aa); Fasta FT score E(): 0, 55.8% identity in 312 aa overlap and to FT Mycobacterium paratuberculosis 34 kDa antigenic protein, FT SW:34KD_MYCPA (Q04959) (298 aa); Fasta score E(): 0, 61.7% FT identity in 311 aa overlap. Previously sequenced as FT TR:O87894 (EMBL:U82111) (336 aa); Fasta score E(): 0, FT 99.7% identity in 314 aa overlap. Contains hydrophobic, FT membrane-spanning regions." FT /product=" 34 kDa antigen" FT RBS 222637..222640 FT /note="possible RBS" FT CDS 222650..223942 FT /class="II.C.4" FT /colour=3 FT /gene="ML0159" FT /note="Similar to M. tuberculosis Rv0955, possible FT membrane protein, SW:Y955_MYCTU (P71555) (455 aa); Fasta FT score E(): 0, 75.9% identity in 419 aa overlap. Previously FT sequenced as TR:Q9Z5H7 (EMBL:AL035500) (430 aa); Fasta FT score E(): 0, 99.8% identity in 430 aa overlap. Contains FT hydrophobic, possible membrane-spanning regions." FT /product="putative membrane protein" FT /tb_orthologue="Rv0955" FT CDS 223972..224619 FT /EC_number="2.1.2.2" FT /class="I.F.1" FT /colour=7 FT /gene="purN" FT /gene="ML0160" FT /note="Similar to M. tuberculosis Rv0956, purN, putative FT phosphoribosylglycinamide formyltransferase, TR:P71554 FT (EMBL:AL123456) (215 aa); Fasta score E(): 0, 79.4% FT identity in 214 aa overlap. Similar to many e.g. FT Mycobacterium avium subsp. paratuberculosis purN, FT phosphoribosylglycinamide formyltransferase I, TR:Q9RAJ6 FT (EMBL:AF191543) (209 aa); Fasta score E(): 0, 81.6% FT identity in 207 aa overlap. Previously sequenced as FT TR:Q9Z5H6 (EMBL:AL035500) (215 aa); Fasta score E(): 0, FT 99.5% identity in 215 aa overlap. Contains Pfam match to FT entry PF00551 formyl_transf, Formyl transferase." FT /product="putative phosphoribosylglycinamide FT formyltransferase" FT /tb_orthologue="purN" FT misc_feature 224008..224544 FT /colour=0 FT /note="Pfam match to entry PF00551 formyl_transf, Formyl FT transferase, score 156.30, E-value 6.8e-44" FT CDS 224616..226199 FT /EC_number="2.1.2.3" FT /EC_number="3.5.4.10" FT /class="I.F.1" FT /colour=7 FT /gene="purH" FT /gene="ML0161" FT /note="Similar to M. tuberculosis Rv0957, purH, putative FT phosphoribosylaminoimidazolecarboxamide formyltransferase FT / IMP cyclohydrolase, SW:PUR9_MYCTU (P71553) (523 aa); FT Fasta score E(): 0, 88.1% identity in 520 aa overlap. FT Similar to many e.g. Bacillus subtilis purN, FT phosphoribosylaminoimidazolecarboxamide formyltransferase FT / IMP cyclohydrolase, SW:PUR9_BACSU (P12048) (512 aa); FT Fasta score E(): 0, 43.2% identity in 519 aa overlap. FT Previously sequenced as SW:PUR9_MYCLE (Q9Z5H5) (527 aa); FT Fasta score E(): 0, 100.0% identity in 527 aa overlap. FT Contains Pfam match to entry PF01808 AICARFT_IMPCHas, FT AICARFT/IMPCHase bienzyme." FT /product="putative phosphoribosylaminoimidazolecarboxamide FT formyltransferase / IMP cyclohydrolase" FT /tb_orthologue="purH" FT misc_feature 225048..225992 FT /colour=0 FT /note="Pfam match to entry PF01808 AICARFT_IMPCHas, FT AICARFT/IMPCHase bienzyme, score 585.50, E-value 3.2e-172" FT CDS complement(227008..227286) FT /class="VI" FT /colour=8 FT /gene="ML0162" FT /note="Improbable CDS suggested by GC frameplot. Possibly FT the remains of a disrupted gene. Previously sequenced as FT TR:Q9Z5H3 (EMBL:AL035500) (92 aa); Fasta score E(): 0, FT 98.9% identity in 92 aa overlap." FT /product="hypothetical protein" FT CDS 228661..229628 FT /class="V" FT /colour=0 FT /gene="ML0163" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv0959 (Best blastx score 266)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT CDS 229629..230493 FT /class="I.A.3" FT /colour=0 FT /gene="fadE13" FT /gene="ML0164" FT /note="Possible pseudogene of M. tuberculosis orthologue FT fadE13 (Best blastx score 280)" FT /product="acyl-CoA dehydrogenase (pseudogene)" FT /pseudo FT CDS 230546..231663 FT /class="I.A.3" FT /colour=0 FT /gene="accD2" FT /gene="ML0165" FT /note="Possible pseudogene of M. tuberculosis orthologue FT accD2 (Best blastx score 451)" FT /product="acetyl/propionyl-CoA carboxylase, [beta] subunit FT (pseudogene)" FT /pseudo FT CDS 231672..233398 FT /class="I.A.3" FT /colour=0 FT /gene="accA2" FT /gene="ML0166" FT /note="Possible pseudogene of M. tuberculosis orthologue FT accA2 (Best blastx score 317)" FT /product="acetyl/propionyl-CoA carboxylase, [alpha] FT subunit (pseudogene)" FT /pseudo FT CDS 233449..234077 FT /class="I.A.3" FT /colour=0 FT /gene="fadE12" FT /gene="ML0167" FT /note="Possible pseudogene of M. tuberculosis orthologue FT fadE12 (Best blastx score 396)" FT /product="acyl-CoA dehydrogenase (pseudogene)" FT /pseudo FT CDS 234124..234820 FT /class="I.A.3" FT /colour=0 FT /gene="echA7" FT /gene="ML0168" FT /note="Possible pseudogene of M. tuberculosis orthologue FT echA7 (Best blastx score 174)" FT /product="enoyl-CoA hydratase/isomerase superfamily FT (pseudogene)" FT /pseudo FT CDS 234932..235534 FT /class="V" FT /colour=10 FT /gene="ML0169" FT /note="Similar to M. tuberculosis Rv0966c, hypothetical FT protein, SW:Y966_MYCTU (P71544) (230 aa); Fasta score E(): FT 0, 79.5% identity in 200 aa overlap. Also similar to FT Streptomyces coelicolor SCE6.30C, hypothetical protein, FT TR:CAB88834 (EMBL:AL353832) (277 aa); Fasta score E(): FT 3.3e-20, 41.0% identity in 205 aa overlap. Previously FT sequenced as TR:Q9Z5H1 (EMBL:AL035500) (200 aa); Fasta FT score E(): 0, 100.0% identity in 200 aa overlap." FT /product="conserved hypothetical protein" FT CDS 235667..235822 FT /class="V" FT /colour=0 FT /gene="ML0170" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv0965c (Best blastx score 115)" FT /product="conserved hypothetical protein (pseudogene)" FT /pseudo FT CDS 236614..237352 FT /class="V" FT /colour=0 FT /gene="ML0171" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv0963c (Best blastx score 311)" FT /product="conserved hypothetical protein (pseudogene)" FT /pseudo FT CDS 237609..238202 FT /class="V" FT /colour=0 FT /gene="ML0172" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv0962c (Best blastx score 310)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT repeat_region 238509..238529 FT /note="21 bp repeat found at 5'-ends of REPLEP copies 1, FT 2, 6 & 11. " FT repeat_region 238509..239454 FT /note="REPLEP region 1, 3'-end most similar to REPLEP 4, 5 FT and 6" FT repeat_region 238530..239409 FT /note="Dispersed repeat, REPLEP, copy 1, shows 55% ID to FT self on complement" FT /label=REPLEP FT /colour=5 FT repeat_region 239410..239454 FT /note="45 bp REPLEP-associated sequence" FT CDS 240237..240410 FT /note="probable ribosomal protein L32, rpmF,similar to FT many e.g. tr|Q9RL50|Q9RL50 PROBABLE 50S RIBOSOMAL PROTEIN FT (56 aa) E(): 1.5e-09; 63.462% identity in 52 aa overlap" FT /colour=2 FT /gene="rpmF" FT /gene="ML0173" FT /class="II.A.1" FT misc_feature 240531..240866 FT /colour=0 FT /note="Pfam match to entry PF00072 response_reg, Response FT regulator receiver domain, score 158.60, E-value 1.1e-43" FT CDS 240531..241217 FT /class="I.J.2" FT /colour=9 FT /gene="ML0174" FT /note="Similar to several putative two-component response FT regulators from M. tuberculosis e.g. Rv0981, putative FT two-component response regulator, TR:O53894 FT (EMBL:AL123456) (230 aa); Fasta score E(): 0, 94.3% FT identity in 228 aa overlap. Similar to many others e.g. FT Pseudomonas syringae copR, transcriptional activator FT protein involved in activation of copper resistance, FT SW:COPR_PSESM (Q02540) (227 aa); Fasta score E(): 6.4e-32, FT 43.9% identity in 223 aa overlap. Previously sequenced as FT TR:Q9Z5G8 (EMBL:AL035500) (253 aa); Fasta score E(): 0, FT 100.0% identity in 228 aa overlap. Contains Pfam match to FT entry PF00486 trans_reg_C, Transcriptional regulatory FT protein, C terminal. Contains Pfam match to entry PF00072 FT response_reg, Response regulator receiver domain." FT /note="Similar to ML0773, ML1286, ML2123 and ML2439" FT /product="putative two-component response regulator" FT /tb_orthologue="Rv0981" FT misc_feature 240975..241190 FT /colour=0 FT /note="Pfam match to entry PF00486 trans_reg_C, FT Transcriptional regulatory protein, C terminal, score FT 85.90, E-value 2.2e-24" FT RBS 241199..241205 FT /note="possible RBS" FT CDS 241217..242776 FT /class="I.J.2" FT /colour=9 FT /gene="ML0175" FT /note="Similar to several putative two-component system FT sensor kinases from M. tuberculosis e.g. Rv0982, putative FT two-component system sensor kinase, TR:O53895 FT (EMBL:AL123456) (504 aa); Fasta score E(): 0, 81.0% FT identity in 521 aa overlap. Similar to many others e.g. FT Pseudomonas syringae copS, sensor protein involved in FT activation of copper resistance, SW:COPS_PSESM (Q02541) FT (487 aa); Fasta score E(): 1.2e-18, 27.9% identity in 427 FT aa overlap. Previously sequenced as TR:Q9Z5G7 FT (EMBL:AL035500) (519 aa); Fasta score E(): 0, 100.0% FT identity in 519 aa overlap. Contains hydrophobic, FT possible membrane-spanning regions. Contains Pfam match to FT entry PF00672 DUF5, Domain found in bacterial signal FT proteins. Contains Pfam match to entry PF00512 signal, FT Histidine kinase. Contains PS00017 ATP/GTP-binding site FT motif A (P-loop)." FT /note="Similar to ML0774, ML2124 and ML2440" FT /product="putative two-component system sensor kinase" FT /tb_orthologue="Rv0982" FT misc_feature 241712..241921 FT /colour=0 FT /note="Pfam match to entry PF00672 DUF5, Domain found in FT bacterial signal proteins, score 65.20, E-value 1.4e-15" FT misc_feature 241961..242605 FT /colour=0 FT /note="Pfam match to entry PF00512 signal, Histidine FT kinase, score 137.60, E-value 2.2e-37" FT misc_feature 242690..242713 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT CDS 243054..244202 FT /class="II.B.3" FT /colour=7 FT /gene="ML0176" FT /note="Similar to M.tuberculosis Rv0983, probable serine FT protease, TR:O53896 (EMBL:AL123456) (464 aa); Fasta score FT E(): 0, 80.7% identity in 383 aa overlap and in part to FT M.tuberculosis htrA, putative serine protease, TR:O06291 FT (EMBL:AL123456) (549 aa); Fasta score E(): 0, 41.8% FT identity in 347 aa overlap. Similar to many e.g. putative FT serine protease expressed in vivo by Mycobacterium avium FT subsp. paratuberculosis, TR:Q50320 (EMBL:Z23092) (361 aa); FT Fasta score E(): 1.1e-19, 35.4% identity in 362 aa FT overlap. Previously sequenced as TR:Q9Z5G6 (EMBL:AL035500) FT (452 aa); Fasta score E(): 0, 100.0% identity in 382 aa FT overlap. Contains a possible N-terminal signal sequence. FT Contains Pfam match to entry PF00595 PDZ, PDZ domain (Also FT known as DHR or GLGF).. Contains Pfam match to entry FT PF00089 trypsin, Trypsin." FT /note="Similar to ML1078 and ML2659" FT /product="possible secreted serine protease" FT /tb_orthologue="Rv0983" FT misc_feature 243342..243899 FT /colour=0 FT /note="Pfam match to entry PF00089 trypsin, Trypsin, score FT 50.90, E-value 2.7e-15" FT misc_feature 243909..244151 FT /colour=0 FT /note="Pfam match to entry PF00595 PDZ, PDZ domain (Also FT known as DHR or GLGF)., score 16.80, E-value 0.025" FT CDS 244225..244770 FT /class="I.G.4" FT /colour=7 FT /gene="moaB" FT /gene="ML0177" FT /note="Similar to M.tuberculosis moaB2, putative FT molybdenum cofactor biosynthesis protein, TR:O53897 FT (EMBL:AL123456) (181 aa); Fasta score E(): 0, 92.7% FT identity in 179 aa overlap. Similar to many e.g. to the FT C-terminal halves of Arabidopsis thaliana cnx1, FT multifunctional two-domain protein involved in molybdenum FT cofactor biosynthesis, SW:CNX1_ARATH (Q39054) (670 aa); FT Fasta score E(): 7.7e-10, 36.4% identity in 187 aa overlap FT and Synechococcus sp. (strain PCC 7942) moaCB, molybdenum FT cofactor biosynthesis protein, SW:MOCB_SYNP7 (Q56208) (319 FT aa); Fasta score E(): 1.3e-09, 35.9% identity in 142 aa FT overlap. Previously sequenced as TR:Q9Z5G5 (EMBL:AL035500) FT (181 aa); Fasta score E(): 0, 99.4% identity in 181 aa FT overlap." FT /product="putative molybdenum cofactor biosynthesis FT protein" FT /tb_orthologue="moaB2" FT CDS complement(244787..245251) FT /class="II.C.4" FT /colour=3 FT /gene="mscL" FT /gene="ML0178" FT /note="Similar to M.tuberculosis mscL, Rv0985c, putative FT mechanosensitive channel protein, SW:MSCL_MYCTU (O53898) FT (151 aa); Fasta score E(): 0, 71.0% identity in 155 aa FT overlap. Similar to many e.g. Escherichia coli mscL, FT large-conductance mechanosensitive channel, SW:MSCL_ECOLI FT (P23867) (136 aa); Fasta score E(): 1.3e-07, 32.1% FT identity in 134 aa overlap. Previously sequenced as FT SW:MSCL_MYCLE (Q9Z5G4) (154 aa); Fasta score E(): 0, FT 100.0% identity in 154 aa overlap. Contains hydrophobic, FT possible membrane-spanning regions. Contains Pfam match to FT entry PF01741 MscL, Large-conductance mechanosensitive FT channel, MscL. Contains PS01327 Large-conductance FT mechanosensitive channels mscL family signature." FT /product="putative mechanosensitive channel protein" FT /tb_orthologue="Rv0985c" FT misc_feature complement(244868..245191) FT /colour=0 FT /note="Pfam match to entry PF01741 MscL, Large-conductance FT mechanosensitive channel, MscL, score 91.50, E-value FT 1.6e-23" FT misc_feature complement(245180..245221) FT /colour=8 FT /note="PS01327 Large-conductance mechanosensitive channels FT mscL family signature" FT RBS complement(245258..245263) FT /note="possible RBS" FT CDS complement(245324..245983) FT /class="V" FT /colour=0 FT /gene="ML0179" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv0990c (Best blastx score 338)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT CDS complement(246049..246348) FT /class="V" FT /colour=10 FT /gene="ML0180" FT /note="Similar to M.tuberculosis Rv0991c, hypothetical FT protein with Ser-rich C-terminus, TR:O05574 FT (EMBL:AL123456) (110 aa); Fasta score E(): 1.1e-23, 78.5% FT identity in 93 aa overlap. Similar to other bacterial FT Ser-rich hypothetical proteins e.g. Streptomyces FT coelicolor SCE22.04, hypothetical protein, TR:CAB90971 FT (EMBL:AL355832) (110 aa); Fasta score E(): 2.6e-15, 54.5% FT identity in 99 aa overlap. Previously sequenced as FT TR:Q9Z5G3 (EMBL:AL035500) (120 aa); Fasta score E(): FT 1.1e-32, 100.0% identity in 99 aa overlap." FT /product="conserved hypothetical protein. Ser-rich FT C-terminus" FT /tb_orthologue="Rv0991c" FT RBS complement(246354..246358) FT /note="possible RBS" FT CDS complement(246423..247016) FT /class="V" FT /colour=10 FT /gene="ML0181" FT /note="Similar to M.tuberculosis Rv0992c, conserved FT hypothetical protein, TR:O05575 (EMBL:AL123456) (197 aa); FT Fasta score E(): 0, 72.6% identity in 197 aa overlap. FT Similar to many hypothetical proteins and shows weak FT similarity to methenyltetrahydrofolate synthetases e.g. FT human mthfs, 5-formyltetrahydrofolate cyclo-ligase, FT SW:FTHC_HUMAN (P49914) (202 aa); Fasta score E(): 7e-06, FT 23.3% identity in 189 aa overlap. Previously sequenced as FT TR:Q9Z5G2 (EMBL:AL035500) (197 aa); Fasta score E(): 0, FT 100.0% identity in 197 aa overlap. Contains Pfam match to FT entry PF01812 5-FTHF_cyc-lig, 5-formyltetrahydrofolate FT cyclo-ligase." FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv0992c" FT misc_feature complement(246459..246971) FT /colour=0 FT /note="Pfam match to entry PF01812 5-FTHF_cyc-lig, FT 5-formyltetrahydrofolate cyclo-ligase, score 169.90, FT E-value 4.1e-47" FT RBS complement(247034..247037) FT /note="possible RBS" FT CDS 247094..248014 FT /EC_number="2.7.7.9" FT /class="I.A.1" FT /colour=7 FT /gene="galU" FT /gene="ML0182" FT /note="Similar to M.tuberculosis galU, Rv0993, FT UTP-glucose-1-phosphate uridylyltransferase, TR:O05576 FT (EMBL:AL123456) (306 aa); Fasta score E(): 0, 89.7% FT identity in 302 aa overlap. Similar to many e.g. FT Escherichia coli galU, UTP--glucose-1-phosphate FT uridylyltransferase, SW:GALU_ECOLI (P25520) (301 aa); FT Fasta score E(): 5.4e-33, 38.8% identity in 299 aa FT overlap. Previously sequenced as TR:Q9Z5G1 (EMBL:AL035500) FT (306 aa); Fasta score E(): 0, 100.0% identity in 306 aa FT overlap. Contains Pfam match to entry PF00483 FT NTP_transferase, Nucleotidyl transferase." FT /product="putative UTP-glucose-1-phosphate FT uridylyltransferase" FT /tb_orthologue="galU" FT misc_feature 247133..247948 FT /colour=0 FT /note="Pfam match to entry PF00483 NTP_transferase, FT Nucleotidyl transferase, score 54.30, E-value 2.7e-12" FT misc_feature 248102..249361 FT /colour=0 FT /note="Pfam match to entry PF00994 MoCF_biosynth, FT Molybdenum cofactor biosynthesis protein, score 551.80, FT E-value 4.7e-162" FT CDS 248102..249376 FT /class="I.G.4" FT /colour=7 FT /gene="moeA" FT /gene="ML0183" FT /note="Similar to M.tuberculosis moeA, Rv0994, putative FT molybdopterin biosynthesis protein, SW:MOEA_MYCTU (O05577) FT (426 aa); Fasta score E(): 0, 88.3% identity in 426 aa FT overlap. Similar to many e.g. Escherichia coli moeA, FT molybdopterin biosynthesis protein, SW:MOEA_ECOLI (P12281) FT (411 aa); Fasta score E(): 3.3e-23, 31.4% identity in 392 FT aa overlap. Previously sequenced as TR:Q9Z5G0 FT (EMBL:AL035500) (424 aa); Fasta score E(): 0, 99.8% FT identity in 424 aa overlap. Contains Pfam match to entry FT PF00994 MoCF_biosynth, Molybdenum cofactor biosynthesis FT protein." FT /product="putative molybdopterin biosynthesis protein" FT /tb_orthologue="moeA" FT CDS 249407..250051 FT /class="II.A.1" FT /colour=2 FT /gene="rimJ" FT /gene="ML0184" FT /note="Similar to M.tuberculosis rimJ, Rv0995, possible FT acetyltransferase, TR:O05578 (EMBL:AL123456) (203 aa); FT Fasta score E(): 0, 86.0% identity in 200 aa overlap. FT Similar to Escherichia coli rimJ, FT ribosomal-protein-alanine acetyltransferase, SW:RIMJ_ECOLI FT (P09454) (194 aa); Fasta score E(): 9.4e-12, 28.0% FT identity in 189 aa overlap and to other putative FT acetyltransferases. Previously sequenced as TR:Q9Z5F9 FT (EMBL:AL035500) (218 aa); Fasta score E(): 0, 100.0% FT identity in 214 aa overlap. Contains Pfam match to entry FT PF00583 Acetyltransf, Acetyltransferase (GNAT) family." FT /product="possible acetyltransferase" FT /tb_orthologue="rimJ" FT misc_feature 249482..249913 FT /colour=0 FT /note="Pfam match to entry PF00583 Acetyltransf, FT Acetyltransferase (GNAT) family, score 16.40, E-value FT 0.027" FT RBS 250205..250210 FT /note="possible RBS" FT CDS 250221..251249 FT /class="II.C.4" FT /colour=3 FT /gene="ML0185" FT /note="Similar to M.tuberculosis Rv0996, hypothetical FT protein, TR:O05579 (EMBL:AL123456) (358 aa); Fasta score FT E(): 0, 66.4% identity in 360 aa overlap. Previously FT sequenced as TR:Q9Z5F8 (EMBL:AL035500) (342 aa); Fasta FT score E(): 0, 100.0% identity in 342 aa overlap. Contains FT hydrophobic, possible membrane-spanning regions." FT /product="putative membrane protein" FT /tb_orthologue="Rv0996" FT tRNA 251305..251377 FT /colour=4 FT /note="tRNA Ala anticodon CGC, Cove score 82.84" FT /gene="alaV" FT CDS 251982..252266 FT /class="V" FT /colour=0 FT /gene="ML0186" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv0997 (Best blastx score 101)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT CDS 252658..253719 FT /class="V" FT /colour=10 FT /gene="ML0187" FT /note="Similar to M. tuberculosis Rv0998, hypothetical FT protein, TR:O05581 (EMBL:AL123456) (333 aa); Fasta score FT E(): 0, 69.7% identity in 330 aa overlap. Contains Pfam FT match to entry PF00027 cNMP_binding, Cyclic FT nucleotide-binding domain. Contains PS00889 Cyclic FT nucleotide-binding domain signature 2." FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv0998" FT misc_feature 252817..253098 FT /colour=0 FT /note="Pfam match to entry PF00027 cNMP_binding, Cyclic FT nucleotide-binding domain, score 74.70, E-value 1.9e-18" FT misc_feature 252976..253029 FT /colour=8 FT /note="PS00889 Cyclic nucleotide-binding domain signature FT 2" FT CDS 254028..254291 FT /class="VI" FT /colour=8 FT /gene="ML0188" FT /note="Unknown function. Contains PS01047 FT Heavy-metal-associated domain." FT /product="hypothetical protein" FT misc_feature 254181..254273 FT /colour=8 FT /note="PS01047 Heavy-metal-associated domain" FT CDS 254397..255092 FT /class="V" FT /colour=0 FT /gene="ML0189" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv0999 (Best blastx score 400)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT CDS complement(255125..255742) FT /note="Unknown but orthologue of equivalent to new M. FT tuberculosis CDS, Rv1000. Very similar to conserved FT hypothetical proteins in various bacteria e.g. FT Streptomyces coelicolor, Xylella fastidiosa. FASTA scores: FT gp|AL357613|AL357613_12 Streptomyces coelicolor cosmid FT (210 aa) E(): 2.4e-44; 55.122% identity in 205 aa overlap; FT AE003963|AE003963_5 Xylella fastidiosa, E(): 9.7e-14; 3 FT 9.894% identity in 188 aa overlap. Weak similarity to FT proteins involved in DNA repair" FT /colour=10 FT /gene="ML0190" FT /product="conserved hypothetical protein" FT /class="V" FT /tb_orthologue="Rv1000" FT CDS 255879..256895 FT /class="I.A.2" FT /colour=0 FT /gene="arcA" FT /gene="ML0191" FT /note="Possible pseudogene of M. tuberculosis orthologue FT arcA (Best blastx score 249)" FT /product="arginine deiminase (pseudogene)" FT /pseudo FT CDS complement(257035..258567) FT /class="II.C.4" FT /colour=3 FT /gene="ML0192" FT /note="Similar to M. tuberculosis Rv1002c, probable FT membrane protein, TR:O05586 (EMBL:AL123456) (503 aa); FT Fasta score E(): 0, 80.4% identity in 510 aa overlap. Also FT similar to Streptomyces coelicolor SCE87.05, putative FT integral membrane protein, TR:Q9RKD3 (EMBL:AL132674) (591 FT aa); Fasta score E(): 0, 36.7% identity in 531 aa overlap. FT Contains hydrophobic, possible membrane-spanning regions." FT /product="putative membrane protein" FT /tb_orthologue="Rv1002c" FT RBS complement(258582..258586) FT /note="possible RBS" FT CDS 258646..259491 FT /class="V" FT /colour=10 FT /gene="ML0193" FT /note="Similar to M. tuberculosis Rv1003, conserved FT hypothetical protein, SW:YA03_MYCTU (O05588) (285 aa); FT Fasta score E(): 0, 74.0% identity in 277 aa overlap. FT Similar to many bacterial hypothetical proteins e.g. FT Streptomyces coelicolor SCE87.04C, conserved hypothetical FT protein, TR:Q9RKD4 (EMBL:AL132674) (286 aa); Fasta score FT E(): 0, 50.5% identity in 277 aa overlap. Contains Pfam FT match to entry PF00590 TP_methylase, Tetrapyrrole FT (Corrin/Porphyrin) Methylases.." FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv1003" FT misc_feature 258658..259269 FT /colour=0 FT /note="Pfam match to entry PF00590 TP_methylase, FT Tetrapyrrole (Corrin/Porphyrin) Methylases., score 86.20, FT E-value 6.7e-22" FT repeat_region complement(259473..260254) FT /note="Dispersed repeat, RLEP, copy 3" FT /label=RLEP FT /colour=5 FT CDS complement(260507..260906) FT /class="IV.C.1.b" FT /colour=0 FT /gene="PE_PGRS" FT /gene="ML0194" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3653, PE_PGRS (Best blastx score 94)" FT /product="PE_PGRS-family protein (pseudogene)" FT /pseudo FT CDS complement(261342..262320) FT /class="V" FT /colour=0 FT /gene="ML0195" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3651 (Best blastx score 218)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT CDS complement(262754..262939) FT /class="IV.C.1.a" FT /colour=0 FT /gene="PE" FT /gene="ML0196" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3650, PE (Best blastx score 94)" FT /product="PE-family protein (pseudogene)" FT /pseudo FT CDS complement(263238..264560) FT /class="II.A.7" FT /colour=0 FT /gene="ML0197" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3649 (Best blastx score 213)" FT /product="ATP-dependent DNA/RNA helicase (pseudogene)" FT /pseudo FT RBS 264881..264886 FT /note="possible RBS" FT misc_feature 264898..265098 FT /colour=0 FT /note="Pfam match to entry PF00313 CSD, 'Cold-shock' FT DNA-binding domain, score 150.80, E-value 2.4e-41" FT CDS 264898..265101 FT /class="III.E" FT /colour=0 FT /gene="cspA" FT /gene="ML0198" FT /note="Similar to M. tuberculosis cspA, Rv3648c, probable FT cold shock protein, SW:CSPA_MYCTU (O06360) (67 aa); Fasta FT score E(): 3.9e-27, 97.0% identity in 67 aa overlap. FT Similar to many e.g. Arthrobacter globiformis csp, cold FT shock protein, SW:CSP_ARTGO (P54584) (67 aa); Fasta score FT E(): 8.8e-19, 71.6% identity in 67 aa overlap. Previously FT sequenced as TR:O69550 (EMBL:AL023093) (67 aa); Fasta FT score E(): 1.2e-27, 100.0% identity in 67 aa overlap. FT Contains Pfam match to entry PF00313 CSD, 'Cold-shock' FT DNA-binding domain. Contains PS00352 'Cold-shock' FT DNA-binding domain signature." FT /note="Similar to ML2147" FT /product="putative cold shock protein" FT /tb_orthologue="cspA" FT misc_feature 264940..264999 FT /colour=8 FT /note="PS00352 'Cold-shock' DNA-binding domain signature" FT CDS 265213..265815 FT /class="V" FT /colour=10 FT /gene="ML0199" FT /product="conserved hypothetical protein" FT /note="Similar to M. tuberculosis Rv3647c, hypothetical FT protein, TR:O06361 (EMBL:AL123456) (192 aa); Fasta score FT E(): 0, 80.4% identity in 199 aa overlap. Previously FT sequenced as TR:O69549 (EMBL:AL023093) (200 aa); Fasta FT score E(): 0, 99.5% identity in 200 aa overlap." FT /tb_orthologue="Rv3647c" FT CDS 266033..268876 FT /EC_number="5.99.1.2" FT /class="II.A.5" FT /colour=2 FT /gene="topA" FT /gene="ML0200" FT /note="Similar to M. tuberculosis topA, DNA topoisomerase FT I, SW:TOP1_MYCTU (Q59567) (934 aa); Fasta score E(): 0, FT 84.3% identity in 942 aa overlap. Previously sequenced as FT SW:TOP1_MYCLE (O69548) (947 aa); Fasta score E(): 0, FT 100.0% identity in 947 aa overlap. Contains Pfam match to FT entry PF01131 Topoisom_bac, Prokaryotic DNA topoisomerase. FT Contains Pfam match to entry PF01751 Toprim, Toprim FT domain. Contains PS00396 Prokaryotic DNA topoisomerase I FT active site." FT /product="putative DNA topoisomerase I" FT /tb_orthologue="topA" FT misc_feature 266078..266446 FT /colour=0 FT /note="Pfam match to entry PF01751 Toprim, Toprim domain, FT score 150.70, E-value 2.6e-41" FT misc_feature 266483..267805 FT /colour=0 FT /note="Pfam match to entry PF01131 Topoisom_bac, FT Prokaryotic DNA topoisomerase, score 657.00, E-value FT 9.7e-194" FT misc_feature 267029..267073 FT /colour=8 FT /note="PS00396 Prokaryotic DNA topoisomerase I active FT site" FT CDS complement(268857..270449) FT /class="II.C.4" FT /colour=3 FT /gene="ML0201" FT /note="Similar to M. tuberculosis Rv3645, probable FT transmembrane protein, TR:O06362 (EMBL:AL123456) (549 aa); FT Fasta score E(): 0, 85.3% identity in 530 aa overlap and FT to several other putative membrane proteins from M. FT tuberculosis. Shares regions of similarity with adenylate FT cyclases e.g. Anabaena sp. (strain PCC 7120) cyaA, FT adenylate cyclase, TR:P94180 (EMBL:D89622) (735 aa); Fasta FT score E(): 1.5e-16, 33.3% identity in 228 aa overlap. FT Previously sequenced as TR:O69547 (EMBL:AL023093) (530 FT aa); Fasta score E(): 0, 99.8% identity in 530 aa overlap. FT Contains hydrophobic, possible membrane-spanning regions. FT Contains Pfam match to entry PF00672 DUF5, Domain found in FT bacterial signal proteins. Contains 2 Pfam matches to FT entry PF00211 guanylate_cyc, Adenylate and Guanylate FT cyclase catalytic domain." FT /product="putative membrane protein" FT /tb_orthologue="Rv3645" FT misc_feature complement(269052..269162) FT /colour=0 FT /note="Pfam match to entry PF00211 guanylate_cyc, FT Adenylate and Guanylate cyclase catalytic domain, score FT 25.40, E-value 1.3e-05" FT misc_feature complement(269247..269450) FT /colour=0 FT /note="Pfam match to entry PF00211 guanylate_cyc, FT Adenylate and Guanylate cyclase catalytic domain, score FT 31.20, E-value 3.4e-07" FT misc_feature complement(269526..269735) FT /colour=0 FT /note="Pfam match to entry PF00672 DUF5, Domain found in FT bacterial signal proteins, score 63.60, E-value 4.3e-15" FT CDS 270605..271822 FT /class="V" FT /colour=10 FT /gene="ML0202" FT /note="Similar to M. tuberculosis Rv3644c, hypothetical FT protein, TR:O06363 (EMBL:AL123456) (401 aa); Fasta score FT E(): 0, 84.4% identity in 404 aa overlap. Similar to the FT N-termini of many DNA polymerase III subunits e.g. FT Escherichia coli holB, DNA polymerase III, delta' subunit, FT SW:HOLB_ECOLI (P28631) (334 aa); Fasta score E(): 2.9e-13, FT 35.1% identity in 205 aa overlap. Previously sequenced as FT TR:O69546 (EMBL:AL023093) (405 aa); Fasta score E(): 0, FT 100.0% identity in 405 aa overlap." FT /note="Similar to the N-terminus of ML2335" FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv3644c" FT tRNA 271901..271976 FT /colour=4 FT /note="tRNA Thr anticodon CGT, Cove score 85.20" FT /gene="thrU" FT CDS complement(273290..274999) FT /class="II.C.4" FT /colour=3 FT /gene="ML0203" FT /note="Similar to M. tuberculosis Rv3635, probable FT membrane protein, TR:O06372 (EMBL:AL123456) (591 aa); FT Fasta score E(): 0, 77.2% identity in 569 aa overlap. FT Previously sequenced as TR:O69545 (EMBL:AL023093) (569 FT aa); Fasta score E(): 0, 99.8% identity in 569 aa overlap. FT Contains hydrophobic, possible membrane-spanning regions." FT /product="putative membrane protein" FT /tb_orthologue="Rv3635" FT CDS 275049..276008 FT /class="I.C.3" FT /colour=7 FT /gene="rmlB2" FT /gene="ML0204" FT /note="Similar to M. tuberculosis rmlB2, possible FT dTDP-Glucose 4,6-dehydratase, TR:O06373 (EMBL:AL123456) FT (314 aa); Fasta score E(): 0, 86.1% identity in 309 aa FT overlap. Similar to bacterial sugar-nucleotide FT dehydratases (many putative) e.g. Streptomyces venezuelae FT desIV, TDP-glucose-4,6-dehydratase, TR:Q9ZGH3 FT (EMBL:AF079762) (337 aa); Fasta score E(): 1.4e-24, 34.3% FT identity in 321 aa overlap. Previously sequenced as FT TR:O69544 (EMBL:AL023093) (319 aa); Fasta score E(): 0, FT 100.0% identity in 319 aa overlap. Contains Pfam match to FT entry PF01370 Epimerase, NAD dependent FT epimerase/dehydratase family. Contains PS00061 Short-chain FT dehydrogenases/reductases family signature." FT /note="Similar to ML1964" FT /product="putative sugar-nucleotide dehydratase" FT /tb_orthologue="rmlB2" FT misc_feature 275070..275999 FT /colour=0 FT /note="Pfam match to entry PF01370 Epimerase, NAD FT dependent epimerase/dehydratase family, score 276.90, FT E-value 2.7e-79" FT misc_feature 275460..275546 FT /colour=8 FT /note="PS00061 Short-chain dehydrogenases/reductases FT family signature" FT repeat_region complement(276000..276785) FT /note="Dispersed repeat, RLEP, copy 4" FT /label=RLEP FT /colour=5 FT CDS complement(276707..277777) FT /class="II.C.4" FT /colour=3 FT /gene="ML0205" FT /note="Similar to M. tuberculosis Rv3629c, possible FT membrane protein, TR:O06378 (EMBL:AL123456) (365 aa); FT Fasta score E(): 0, 66.2% identity in 361 aa overlap. FT Similar to other bacterial hypothetical membrane proteins FT e.g. Streptomyces coelicolor SCC8A.24C, putative integral FT membrane protein, TR:CAB92842 (EMBL:AL356892) (380 aa); FT Fasta score E(): 1e-21, 47.5% identity in 377 aa overlap. FT Previously sequenced as TR:O69543 (EMBL:AL023093) (356 FT aa); Fasta score E(): 0, 100.0% identity in 356 aa FT overlap. Contains hydrophobic, possible membrane-spanning FT regions." FT /product="putative membrane protein" FT /tb_orthologue="Rv3629c" FT RBS complement(277782..277788) FT /note="possible RBS" FT CDS 277944..279039 FT /class="II.C.5" FT /colour=0 FT /gene="ML0206" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3630 (Best blastx score 392)" FT /product="unknown membrane protein (pseudogene)" FT /pseudo FT CDS 279051..279770 FT /class="IV.H" FT /colour=7 FT /gene="ML0207" FT /note="Similar to M. tuberculosis Rv3631, possible FT glycosyltransferase, TR:O06376 (EMBL:AL123456) (241 aa); FT Fasta score E(): 0, 80.8% identity in 239 aa overlap. FT Similar to many bacterial hypothetical proteins. FT Previously sequenced as TR:O69542 (EMBL:PS50167) (239 aa); FT Fasta score E(): 0, 99.6% identity in 239 aa overlap. FT Contains Pfam match to entry PF00535 Glycos_transf_2, FT Glycosyl transferases." FT /note="Similar to ML1440" FT /product="putative glycosyltransferase" FT /tb_orthologue="Rv3631" FT misc_feature 279081..279572 FT /colour=0 FT /note="Pfam match to entry PF00535 Glycos_transf_2, FT Glycosyl transferases, score 57.10, E-value 3.8e-13" FT RBS 279771..279776 FT /note="possible RBS" FT CDS 279784..280125 FT /class="II.C.4" FT /colour=3 FT /gene="ML0208" FT /note="Similar to M. tuberculosis Rv3632, hypothetical FT protein, TR:O06375 (EMBL:AL123456) (114 aa); Fasta score FT E(): 0, 82.0% identity in 111 aa overlap. Previously FT sequenced as TR:O69541 (EMBL:AL023093) (113 aa); Fasta FT score E(): 0, 100.0% identity in 113 aa overlap. Contains FT hydrophobic, possible membrane-spanning regions." FT /product="putative membrane protein" FT /tb_orthologue="Rv3632" FT repeat_region 279989..280838 FT /note="Dispersed repeat, RLEP, copy 5" FT /label=RLEP FT /colour=5 FT CDS complement(280783..281282) FT /class="V" FT /colour=0 FT /gene="ML0209" FT /note="Possible pseudogene similar to M. tuberculosis FT paralogue Rv1748 (Best blastx score 146)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT CDS complement(281543..282031) FT /EC_number="3.6.1.1" FT /class="I.A.4" FT /colour=7 FT /gene="ppa" FT /gene="ML0210" FT /note="Similar to M. tuberculosis ppa, Rv3628, probable FT inorganic pyrophosphatase, SW:IPYR_MYCTU (O06379) (162 FT aa); Fasta score E(): 0, 89.5% identity in 162 aa overlap. FT Similar to many e.g. Sulfolobus acidocaldarius ppa, FT inorganic pyrophosphatase, SW:IPYR_SULAC (P50308) (173 FT aa); Fasta score E(): 1.1e-27, 45.9% identity in 159 aa FT overlap. Previously sequenced as SW:IPYR_MYCLE (O69540) FT (162 aa); Fasta score E(): 0, 99.4% identity in 162 aa FT overlap. Contains Pfam match to entry PF00719 FT Pyrophosphatase, Inorganic pyrophosphatase. Contains FT PS00387 Inorganic pyrophosphatase signature." FT /product="putative inorganic pyrophosphatase" FT /tb_orthologue="ppa" FT misc_feature complement(281555..282022) FT /colour=0 FT /note="Pfam match to entry PF00719 Pyrophosphatase, FT Inorganic pyrophosphatase, score 172.10, E-value 9.3e-48" FT misc_feature complement(281858..281878) FT /colour=8 FT /note="PS00387 Inorganic pyrophosphatase signature" FT RBS complement(282040..282045) FT /note="possible RBS" FT RBS 282147..282152 FT /note="possible RBS" FT CDS 282157..283542 FT /class="II.C.3" FT /colour=3 FT /gene="ML0211" FT /note="Similar to M. tuberculosis Rv3627c, possible FT penicillin-binding protein, TR:O06380 (EMBL:AL123456) (461 FT aa); Fasta score E(): 0, 76.0% identity in 462 aa overlap. FT Shows weak similarity to penicillin-binding proteins e.g. FT Neisseria gonorrhoeae pbp3, penicillin binding protein 3, FT TR:O85665 (EMBL:AF071224) (469 aa); Fasta score E(): FT 4.5e-08, 33.1% identity in 163 aa overlap. Similar to FT putative carboxypeptidases from Streptomyces coelicolor FT e.g. SCE9.15C, possible penicillin-binding protein, FT TR:Q9X8I8 (EMBL:AL049841) (459 aa); Fasta score E(): FT 3.8e-32, 36.3% identity in 435 aa overlap. Previously FT sequenced as TR:O69539 (EMBL:AL023093) (461 aa); Fasta FT score E(): 0, 99.8% identity in 461 aa overlap. Contains a FT possible N-terminal signal sequence. Contains Pfam match FT to entry PF02113 Peptidase_S13, D-Ala-D-Ala FT carboxypeptidase 3 (S13) family." FT /product="putative carboxypeptidase" FT /tb_orthologue="Rv3627c" FT misc_feature 282439..283467 FT /colour=0 FT /note="Pfam match to entry PF02113 Peptidase_S13, FT D-Ala-D-Ala carboxypeptidase 3 (S13) family, score 519.60, FT E-value 2.3e-152" FT CDS 283539..284579 FT /class="V" FT /colour=0 FT /gene="ML0212" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3626c (Best blastx score 1003)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT CDS 284580..285551 FT /class="V" FT /colour=10 FT /gene="mesJ" FT /gene="ML0213" FT /note="Similar to M. tuberculosis mesJ, Rv3625c, conserved FT hypothetical protein, SW:Y0C5_MYCTU (O06382) (323 aa); FT Fasta score E(): 0, 78.0% identity in 327 aa overlap. FT Similar to many e.g. Escherichia coli mesJ, putative cell FT cycle protein, SW:MESJ_ECOLI (P52097) (432 aa); Fasta FT score E(): 3.9e-12, 33.0% identity in 279 aa overlap. FT Previously sequenced as SW:Y0C5_MYCLE (O69538) (323 aa); FT Fasta score E(): 0, 100.0% identity in 323 aa overlap." FT /product="conserved hypothetical protein" FT /tb_orthologue="mesJ" FT CDS 285584..286225 FT /EC_number="2.4.2.8" FT /class="I.F.4" FT /colour=7 FT /gene="hpt" FT /gene="ML0214" FT /note="Similar to M. tuberculosis hpt, Rv3624c, probable FT hypoxanthine-guanine phosphoribosyltransferase, FT SW:HPRT_MYCTU (O06383) (216 aa); Fasta score E(): 0, 83.1% FT identity in 207 aa overlap. Similar to many e.g. FT Salmonella typhimurium hprt, hypoxanthine FT phosphoribosyltransferase, TR:O33799 (EMBL:AF008931) (178 FT aa); Fasta score E(): 9.6e-32, 50.9% identity in 169 aa FT overlap. Previously sequenced as TR:O69537 (EMBL:AL023093) FT (213 aa); Fasta score E(): 0, 99.5% identity in 213 aa FT overlap. Contains Pfam match to entry PF00156 FT Pribosyltran, Phosphoribosyl transferase domain. Contains FT PS00103 Purine/pyrimidine phosphoribosyl transferases FT signature." FT /product="putative hypoxanthine phosphoribosyltransferase" FT /tb_orthologue="hpt" FT misc_feature 285665..286147 FT /colour=0 FT /note="Pfam match to entry PF00156 Pribosyltran, FT Phosphoribosyl transferase domain, score 84.60, E-value FT 2e-21" FT misc_feature 285965..286003 FT /colour=8 FT /note="PS00103 Purine/pyrimidine phosphoribosyl FT transferases signature" FT CDS complement(286276..286674) FT /class="II.C.1" FT /colour=0 FT /gene="ML0215" FT /note="Possible pseudogene of M. tuberculosis orthologue FT lpqG (Best blastx score 222)" FT /product="putative lipoprotein (pseudogene)" FT /pseudo FT CDS complement(286829..287302) FT /class="V" FT /colour=0 FT /gene="ML0216" FT /note="Possible pseudogene similar to M. tuberculosis FT paralogue Rv0393 (Best blastx score 102)" FT /product="conserved hypothetical protein (pseudogene)" FT /pseudo FT repeat_unit 287703..287723 FT /note="21 bp direct repeat, TGTTGTCTTAGAGCATTGATT" FT /colour=5 FT repeat_unit 287724..287744 FT /note="21 bp direct repeat, TGTTGTCTTAGAGCATTGATT" FT /colour=5 FT CDS 288678..288923 FT /class="VI" FT /colour=8 FT /gene="ML0217" FT /note="Unknown function. Possibly the remains of a FT disrupted gene." FT /product="hypothetical protein" FT CDS complement(289829..290215) FT /class="VI" FT /colour=8 FT /gene="ML0218" FT /note="Improbable CDS suggested by GC frameplot. Possibly FT the remains of a disrupted gene. Previously sequenced as FT TR:O69534 (EMBL:AL023093) (128 aa); Fasta score E(): 0, FT 99.2% identity in 128 aa overlap." FT /product="hypothetical protein" FT CDS complement(290378..290991) FT /class="I.B.7" FT /colour=0 FT /gene="ML0219" FT /note="Possible pseudogene similar to M. tuberculosis FT paralogue Rv3726 (Best blastx score 114)" FT /product="putative alcohol dehydrogenase, zinc-type FT (pseudogene)" FT /pseudo FT CDS complement(291435..292461) FT /class="I.B.7" FT /colour=0 FT /gene="ML0220" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3618 (Best blastx score 208)" FT /product="similar bacterial luciferase alpha chains FT (pseudogene)" FT /pseudo FT CDS complement(292471..293353) FT /class="IV.I" FT /colour=0 FT /gene="ML0221" FT /note="Possible pseudogene of M. tuberculosis orthologue FT ephA (Best blastx score 177)" FT /product="putative hydrolase (pseudogene)" FT /pseudo FT CDS 293693..296065 FT /class="III.C" FT /colour=3 FT /gene="ftsH" FT /gene="ML0222" FT /note="Similar to M. tuberculosis ftsH, Rv3610c, possible FT cell division protein, SW:FTSH_MYCTU (P96942) (760 aa); FT Fasta score E(): 0, 87.2% identity in 790 aa overlap. FT Similar to many e.g. Escherichia coli ftsH, cell division FT protein, SW:FTSH_ECOLI (P28691) (644 aa); Fasta score E(): FT 0, 49.3% identity in 611 aa overlap. Previously sequenced FT as TR:O69532 (EMBL:AL023093) (787 aa); Fasta score E(): 0, FT 100.0% identity in 787 aa overlap. Contains hydrophobic, FT possible membrane-spanning regions. Contains Pfam match to FT entry PF01434 Peptidase_M41, Peptidase family M41. FT Contains Pfam match to entry PF00004 AAA, ATPases FT associated with various cellular activities (AAA). FT Contains PS00017 ATP/GTP-binding site motif A (P-loop). FT Contains PS00674 AAA-protein family signature." FT /product="putative integral membrane peptidase" FT /tb_orthologue="ftsH" FT misc_feature 294293..294856 FT /colour=0 FT /note="Pfam match to entry PF00004 AAA, ATPases associated FT with various cellular activities (AAA), score 339.00, FT E-value 5.2e-98" FT misc_feature 294308..294331 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature 294605..294661 FT /colour=8 FT /note="PS00674 AAA-protein family signature" FT misc_feature 294872..295504 FT /colour=0 FT /note="Pfam match to entry PF01434 Peptidase_M41, FT Peptidase family M41, score 413.20, E-value 2.4e-120" FT RBS 296069..296075 FT /note="possible RBS" FT CDS 296082..296699 FT /EC_number="3.5.4.16" FT /class="I.G.2" FT /colour=7 FT /gene="folE" FT /gene="ML0223" FT /note="Similar to M. tuberculosis folE, Rv3609c, GTP FT cyclohydrolase I, SW:GCH1_MYCTU (O06273) (202 aa); Fasta FT score E(): 0, 82.0% identity in 205 aa overlap. Similar to FT many e.g. Bacillus subtilis mtrA, GTP cyclohydrolase I, FT SW:GCH1_BACSU (P19465) (190 aa); Fasta score E(): 0, 59.5% FT identity in 190 aa overlap. Previously sequenced as FT SW:GCH1_MYCLE (O69531) (205 aa); Fasta score E(): 0, FT 100.0% identity in 205 aa overlap. Contains Pfam match to FT entry PF01227 GTP_cyclohydroI, GTP cyclohydrolase I. FT Contains PS00859 GTP cyclohydrolase I signature 1. FT Contains PS00860 GTP cyclohydrolase I signature 2." FT /product="putative GTP cyclohydrolase I" FT /tb_orthologue="folE" FT misc_feature 296145..296693 FT /colour=0 FT /note="Pfam match to entry PF01227 GTP_cyclohydroI, GTP FT cyclohydrolase I, score 343.60, E-value 2.2e-99" FT misc_feature 296319..296369 FT /colour=8 FT /note="PS00859 GTP cyclohydrolase I signature 1" FT misc_feature 296469..296501 FT /colour=8 FT /note="PS00860 GTP cyclohydrolase I signature 2" FT CDS 296696..297550 FT /EC_number="2.5.1.15" FT /class="I.G.2" FT /colour=7 FT /gene="folP" FT /gene="ML0224" FT /note="Similar to M. tuberculosis folP, Rv3608c, FT dihydropteroate synthase, SW:DHP1_MYCTU (O06274) (280 aa); FT Fasta score E(): 0, 76.8% identity in 284 aa overlap. FT Previously sequenced as TR:O69530 (EMBL:AL023093) (284 FT aa); Fasta score E(): 0, 99.6% identity in 284 aa overlap. FT Mutations in this gene result in diaminodiphenylsulfone FT resistance. Contains Pfam match to entry PF00809 DHPS, FT Dihydropteroate synthase. Contains PS00793 Dihydropteroate FT synthase signature 2." FT /note="Similar to ML1063" FT /product="dihydropteroate synthase" FT /tb_orthologue="folP" FT misc_feature 296720..297502 FT /colour=0 FT /note="Pfam match to entry PF00809 DHPS, Dihydropteroate FT synthase, score 428.10, E-value 7.9e-125" FT misc_feature 296819..296860 FT /colour=8 FT /note="PS00793 Dihydropteroate synthase signature 2" FT CDS 297543..297941 FT /EC_number="4.1.2.25" FT /class="I.G.2" FT /colour=7 FT /gene="folB" FT /gene="ML0225" FT /note="Similar to M. tuberculosis folX, Rv3607c, probable FT dihydroneopterin aldolase, SW:FOLB_MYCTU (O06275) (133 FT aa); Fasta score E(): 0, 74.8% identity in 131 aa overlap. FT Similar to many e.g. Staphylococcus aureus folB, FT dihydroneopterin aldolase, SW:FOLB_STAAU (P56740) (121 FT aa); Fasta score E(): 1.9e-09, 33.9% identity in 121 aa FT overlap. Previously sequenced as SW:FOLB_MYCLE (O69529) FT (132 aa); Fasta score E(): 0, 100.0% identity in 132 aa FT overlap. Contains Pfam match to entry PF02152 FolB, FT Dihydroneopterin aldolase." FT /product="putative dihydroneopterin aldolase" FT /tb_orthologue="folX" FT misc_feature 297555..297893 FT /colour=0 FT /note="Pfam match to entry PF02152 FolB, Dihydroneopterin FT aldolase, score 130.10, E-value 1.8e-36" FT CDS 297941..298516 FT /EC_number="2.7.6.3" FT /class="I.G.2" FT /colour=7 FT /gene="folK" FT /gene="ML0226" FT /note="Similar to M. tuberculosis folK, Rv3607c, probable FT 2-amino-4-hydroxy-6-hydroxymethyldihydropterine FT pyrophosphokinase, SW:HPPK_MYCTU (O06276) (188 aa); Fasta FT score E(): 0, 63.2% identity in 190 aa overlap. Similar to FT others e.g. to the C-terminal half of Streptococcus FT pneumoniae sulD, bifunctional folate synthesis protein FT (includes: dihydroneopterin aldolase and FT 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine FT pyrophosphokinase), SW:SULD_STRPN (P22291) (270 aa); Fasta FT score E(): 1.8e-07, 37.8% identity in 135 aa overlap. FT Previously sequenced as SW:HPPK_MYCLE (O69528) (191 aa); FT Fasta score E(): 0, 100.0% identity in 191 aa overlap. FT Contains Pfam match to entry PF01288 HPPK, FT 7,8-dihydro-6-hydroxymethylpterin-pyrophosphokinase FT (HPPK). Contains PS00794 FT 7,8-dihydro-6-hydroxymethylpterin-pyrophosphokinase FT signature." FT /product="putative FT 2-amino-4-hydroxy-6-hydroxymethyldihydropterine FT pyrophosphokinase" FT /tb_orthologue="folK" FT misc_feature 297947..298357 FT /colour=0 FT /note="Pfam match to entry PF01288 HPPK, FT 7,8-dihydro-6-hydroxymethylpterin-pyrophosphokinase FT (HPPK), score 246.10, E-value 1.5e-70" FT misc_feature 298193..298228 FT /colour=8 FT /note="PS00794 FT 7,8-dihydro-6-hydroxymethylpterin-pyrophosphokinase FT signature" FT CDS 298516..298992 FT /class="II.C.4" FT /colour=3 FT /gene="ML0227" FT /note="Similar to M. tuberculosis Rv3605c, hypothetical FT protein, TR:O06277 (EMBL:AL123456) (158 aa); Fasta score FT E(): 0, 85.4% identity in 158 aa overlap. Previously FT sequenced as TR:O69527 (EMBL:AL023093) (158 aa); Fasta FT score E(): 0, 100.0% identity in 158 aa overlap. Contains FT hydrophobic, possible membrane-spanning regions." FT /product="putative membrane protein" FT /tb_orthologue="Rv3605c" FT CDS 299138..300436 FT /class="II.C.4" FT /colour=3 FT /gene="ML0228" FT /note="Similar to M. tuberculosis Rv3604c, putative FT membrane protein, TR:O06278 (EMBL:AL123456) (462 aa); FT Fasta score E(): 0, 59.7% identity in 432 aa overlap. FT Previously sequenced as TR:O69526 (EMBL:AL023093) (432 FT aa); Fasta score E(): 0, 100.0% identity in 432 aa FT overlap. Contains hydrophobic, possible membrane-spanning FT regions." FT /product="putative membrane protein" FT /tb_orthologue="Rv3604c" FT RBS 300524..300527 FT /note="possible RBS" FT CDS 300537..301466 FT /class="V" FT /colour=10 FT /gene="ML0229" FT /note="Similar to M. tuberculosis Rv3603c, hypothetical FT protein, TR:O06279 (EMBL:AL123456) (303 aa); Fasta score FT E(): 0, 67.8% identity in 311 aa overlap. Similar to the FT N-terminal half of Streptomyces coelicolor SCE126.02C, FT hypothetical protein, TR:Q9X845 (EMBL:AL049630) (420 aa); FT Fasta score E(): 4.1e-24, 36.7% identity in 294 aa FT overlap. Previously sequenced as TR:O69525 (EMBL:AL023093) FT (309 aa); Fasta score E(): 0, 100.0% identity in 309 aa FT overlap." FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv3603c" FT CDS 301463..302404 FT /EC_number="6.3.2.1" FT /class="I.G.5" FT /colour=7 FT /gene="panC" FT /gene="ML0230" FT /note="Similar to M. tuberculosis panC, putative FT pantoate-[beta]-alanine ligase, SW:PANC_MYCTU (O06280) FT (309 aa); Fasta score E(): 0, 82.2% identity in 297 aa FT overlap. Similar to many e.g. Escherichia coli FT pantoate--beta-alanine ligase, SW:PANC_ECOL (P31663) (283 FT aa); Fasta score E(): 0, 46.1% identity in 269 aa overlap. FT Previously sequenced as SW:PANC_MYCLE (O69524) (191 aa); FT Fasta score E(): 0, 100.0% identity in 191 aa overlap." FT /product="putative pantoate-[beta]-alanine ligase" FT /tb_orthologue="panC" FT CDS 302404..302832 FT /EC_number="4.1.1.11" FT /class="I.G.5" FT /colour=7 FT /gene="panD" FT /gene="ML0231" FT /note="Similar to M. tuberculosis panD, putative FT aspartate-1-decarboxylase, SW:PAND_MYCTU (Z95557) (139 FT aa); Fasta score E(): 0, 82.9% identity in 140 aa overlap. FT Similar to Corynebacterium glutamicum panD, FT L-aspartate-alpha-decarboxylase precursor, TR:Q9X4N0 FT (EMBL:AF116184) (136 aa); Fasta score E(): 9.3e-29, 68.8% FT identity in 128 aa overlap." FT /product="putative aspartate-1-decarboxylase" FT /tb_orthologue="panD" FT CDS 302835..303659 FT /class="V" FT /colour=10 FT /gene="ML0232" FT /note="Similar to M. tuberculosis Rv3600c, conserved FT hypothetical protein, TR:O06282 (EMBL:AL123456) (272 aa); FT Fasta score E(): 0, 90.5% identity in 274 aa overlap. FT Similar to otehr bacterial hypothetical proteins e.g. FT Streptomyces coelicolor SCE94.31C, hypothetical protein, FT TR:Q9X8N6 (EMBL:AL049628) (265 aa); Fasta score E(): 0, FT 52.0% identity in 269 aa overlap." FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv3600c" FT RBS 303717..303720 FT /note="possible RBS" FT CDS 303740..305263 FT /EC_number="6.1.1.6" FT /class="II.A.3" FT /colour=2 FT /gene="lysS" FT /gene="ML0233" FT /note="Similar to M. tuberculosis lysS, Rv3598c, putative FT lysyl-tRNA synthase, SW:SYK_MYCTU (O06284) (505 aa); Fasta FT score E(): 0, 85.4% identity in 501 aa overlap. Similar to FT Escherichia coli lysU, lysyl-tRNA synthase, SW:SYK2_ECOLI FT (P14825) (504 aa); Fasta score E(): 0, 38.8% identity in FT 497 aa overlap. Contains Pfam match to entry PF00152 FT tRNA-synt_2, tRNA synthetases class II (D, K and N). FT Contains PS00179 Aminoacyl-transfer RNA synthetases FT class-II signature 1." FT /note="Similar to the C-terminal half of ML1393" FT /product="putative lysyl-tRNA synthase" FT /tb_orthologue="lysS" FT misc_feature 304211..305251 FT /colour=0 FT /note="Pfam match to entry PF00152 tRNA-synt_2, tRNA FT synthetases class II (D, K and N), score 375.40, E-value FT 5.6e-109" FT misc_feature 304511..304564 FT /colour=8 FT /note="PS00179 Aminoacyl-transfer RNA synthetases class-II FT signature 1" FT RBS 305356..305359 FT /note="possible RBS" FT CDS 305368..305706 FT /class="II.C.2" FT /colour=3 FT /gene="lsr2" FT /gene="ML0234" FT /note="Similar to M. tuberculosis lsr2, putative lsr FT protein, SW:LSR2_MYCTU (O06285) (112 aa); Fasta score E(): FT 0, 92.9% identity in 112 aa overlap. Homologues also occur FT in Streptomyces coelicolor e.g. Streptomyces coelicolor FT SCE94.26C, putative lsr2-like protein, TR:Q9X8N1 FT (EMBL:AL049628) (111 aa); Fasta score E(): 7.3e-18, 56.3% FT identity in 112 aa overlap. Previously sequenced as SW:." FT /product="lsr2 protein (15 kDa antigen)" FT /tb_orthologue="lsr2" FT RBS 305988..305994 FT /note="possible RBS" FT CDS 306003..308549 FT /class="II.B.3" FT /colour=7 FT /gene="clpC" FT /gene="ML0235" FT /note="Similar to M. tuberculosis clpC, ATP-dependent Clp FT protease, SW:CLPC_MYCTU (O06286) (848 aa); Fasta score FT E(): 0, 97.2% identity in 845 aa overlap. Similar to many FT e.g. Bacillus subtilis clpC, negative regulator of genetic FT competence (clpC-family) and Treponema hyodysenteriae FT tlyB, hemolysin B, SW:HLYB_TREHY (Q54316) (828 aa); Fasta FT score E(): 0, 51.4% identity in 812 aa overlap. Contains FT Pfam match to entry PF00495 clpA_B, Chaperonin clpA/B. FT Contains Pfam match to entry PF02151 UVR, UvrB/uvrC motif. FT Contains 2 x PS00017 ATP/GTP-binding site motif A FT (P-loop)." FT /note="Similar to ML2490" FT /product="putative ATP-dependent Clp protease" FT /tb_orthologue="clpC" FT misc_feature 306648..306671 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature 307275..307382 FT /colour=0 FT /note="Pfam match to entry PF02151 UVR, UvrB/uvrC motif, FT score 39.60, E-value 7e-08" FT misc_feature 307434..308408 FT /colour=0 FT /note="Pfam match to entry PF00495 clpA_B, Chaperonin FT clpA/B, score 647.10, E-value 9.5e-191" FT misc_feature 307659..307682 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT repeat_region 308814..308841 FT /note="14 copies of dinucleotide repeat, AT " FT /colour=5 FT CDS complement(309643..310899) FT /EC_number="4.1.3.-" FT /class="I.G.2" FT /colour=7 FT /gene="pabB" FT /gene="ML0236" FT /note="Similar to M. tuberculosis pabB, Rv1005c, putative FT para-aminobenzoate synthase component I, TR:O05591 FT (EMBL:Z94752) (458 aa); Fasta score E(): 0, 79.1% identity FT in 412 aa overlap. Similar to many e.g. Escherichia coli FT para-aminobenzoate synthase component I, SW:PABB_ECOLI FT (P05041) (453 aa); Fasta score E(): 5.5e-31, 35.2% FT identity in 378 aa overlap. When compared to the predicted FT M. tuberculosis translation, this CDS is missing the FT N-terminal 30 aa, thus it may be a pseudogene. Contains FT Pfam match to entry PF00425 chorismate_bind, chorismate FT binding enzyme." FT /note="Similar to the C-terminal halves of ML0808 and FT ML1269" FT /product="putative para-aminobenzoate synthase component" FT /tb_orthologue="pabB" FT misc_feature complement(309676..310242) FT /colour=0 FT /note="Pfam match to entry PF00425 chorismate_bind, FT chorismate binding enzyme, score 192.30, E-value 6.7e-55" FT CDS 310900..311580 FT /class="V" FT /colour=0 FT /gene="ML0237" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv1006 (Best blastx score 389)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT CDS complement(312208..313821) FT /EC_number="6.1.1.10" FT /class="II.A.3" FT /colour=2 FT /gene="metS" FT /gene="ML0238" FT /note="Similar to M. tuberculosis metS, Rv1007c, FT methionyl-tRNA synthetase, SW:SYM_MYCTU (O05593) (519 aa); FT Fasta score E(): 0, 85.7% identity in 516 aa overlap. FT Similar to many e.g. Bacillus stearothermophilus metG FT (metS), methionyl-tRNA synthetase, SW:SYM_BACST (P23920) FT (649 aa); Fasta score E(): 0, 40.9% identity in 550 aa FT overlap. Contains Pfam match to entry PF00133 tRNA-synt_1, FT tRNA synthetases class I (I, L, M and V). Contains PS00178 FT Aminoacyl-transfer RNA synthetases class-I signature." FT /product="putative methionyl-tRNA synthase" FT /tb_orthologue="metS" FT misc_feature complement(312619..313821) FT /colour=0 FT /note="Pfam match to entry PF00133 tRNA-synt_1, tRNA FT synthetases class I (I, L, M and V), score -186.40, FT E-value 1.5e-07" FT misc_feature complement(313756..313785) FT /colour=8 FT /note="PS00178 Aminoacyl-transfer RNA synthetases class-I FT signature" FT misc_feature 313910..313936 FT /colour=8 FT /note="PS01137 Uncharacterized protein family UPF0006 FT signature 1" FT CDS 313910..314698 FT /class="V" FT /colour=10 FT /gene="ML0239" FT /note="Similar to M. tuberculosis ycfH, Rv1008, conserved FT hypothetical protein, TR:O08343 (EMBL:AL123456) (264 aa); FT Fasta score E(): 0, 82.3% identity in 260 aa overlap. FT Similar to many e.g. Bacillus subtilis yabD, conserved FT hypothetical protein, SW:YABD_BACSU (P37545) (255 aa); FT Fasta score E(): 0, 41.0% identity in 261 aa overlap. FT Contains Pfam match to entry PF01026 UPF0006, FT Metalloenzyme of unknown function. Contains PS01137 FT Uncharacterized protein family UPF0006 signature 1. FT Contains PS01091 Uncharacterized protein family UPF0006 FT signature 3." FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv1008" FT misc_feature 313925..314683 FT /colour=0 FT /note="Pfam match to entry PF01026 UPF0006, Metalloenzyme FT of unknown function, score 348.40, E-value 7.8e-101" FT misc_feature 314489..314539 FT /colour=8 FT /note="PS01091 Uncharacterized protein family UPF0006 FT signature 3" FT RBS 314928..314932 FT /note="possible RBS" FT CDS 314948..316075 FT /class="V" FT /colour=10 FT /gene="ML0240" FT /note="Similar to M. tuberculosis Rv1009, conserved FT hypothetical protein, TR:O05594 (EMBL:AL123456) (362 aa); FT Fasta score E(): 0, 82.3% identity in 361 aa overlap. The FT C-terminus is similar to a region conserved in many FT bacterial hypothetical proteins e.g. Streptomyces FT coelicolor SCE87.01C, hypothetical protein, TR:Q9RKD7 FT (EMBL:AL132674) (330 aa); Fasta score E(): 3.2e-14, 33.8% FT identity in 225 aa overlap." FT /note="C-terminus is similar to region of ML2030 and FT ML2151" FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv1009" FT RBS 316026..316030 FT /note="possible RBS" FT CDS 316048..316968 FT /EC_number="2.1.1.-" FT /class="II.A.2" FT /colour=2 FT /gene="ksgA" FT /gene="ML0241" FT /note="Similar to M. tuberculosis ksgA, dimethyladenosine FT transferase, TR:O05595 (EMBL:AL123456) (317 aa); Fasta FT score E(): 0, 85.0% identity in 294 aa overlap. Similar to FT many e.g. Escherichia coli ksgA, dimethyladenosine FT transferase, SW:KSGA_ECOLI (M68521) (273 aa); Fasta score FT E(): 8.3e-23, 33.7% identity in 261 aa overlap. Contains FT Pfam match to entry PF00398 RrnaAD, Ribosomal RNA adenine FT dimethylases. Contains PS01131 Ribosomal RNA adenine FT dimethylases signature." FT /product="putative dimethyladenosine transferase" FT /tb_orthologue="ksgA" FT misc_feature 316153..316917 FT /colour=0 FT /note="Pfam match to entry PF00398 RrnaAD, Ribosomal RNA FT adenine dimethylases, score 151.60, E-value 2e-46" FT misc_feature 316225..316308 FT /colour=8 FT /note="PS01131 Ribosomal RNA adenine dimethylases FT signature" FT CDS 317042..317977 FT /EC_number="2.7.1.-" FT /class="I.C.1" FT /colour=7 FT /gene="ML0242" FT /note="Similar to M. tuberculosis ipk, Rv1011, putative FT isopentenyl monophosphate kinase, SW:IPK_MYCTU (O05596) FT (306 aa); Fasta score E(): 0, 87.5% identity in 303 aa FT overlap. Similar to many e.g. Escherichia coli isopentenyl FT monophosphate kinase, SW:IPK_ECOLI (P24209) (283 aa); FT Fasta score E(): 1.3e-13, 35.6% identity in 202 aa FT overlap." FT /product="putative isopentenyl monophosphate kinase" FT /tb_orthologue="Rv1011" FT RBS 318210..318215 FT /note="possible RBS" FT CDS 318220..319854 FT /class="I.I" FT /colour=1 FT /gene="ML0243" FT /note="Similar to several putative acyl-CoA synthases from FT M.tuberculosis e.g. pks16, Rv1013, possible polyketide FT synthase, TR:O05598 (EMBL:AL123456) (544 aa); Fasta score FT E(): 0, 82.2% identity in 544 aa overlap. Similar to FT domains of polyketide synthases e.g. Bacillus subtilis FT mycA, mycosubtilin synthetase, TR:Q9R9J1 (EMBL:AF184956) FT (3971 aa); Fasta score E(): 0, 33.7% identity in 404 aa FT overlap. Contains Pfam match to entry PF00501 AMP-binding, FT AMP-binding enzyme. Contains PS00455 Putative AMP-binding FT domain signature." FT /note="Similar to ML0887, ML0100, ML0132, ML0138, ML1051, FT ML1234, ML1994, ML2358 and ML2546" FT /product="putative acyl-CoA synthetase" FT /tb_orthologue="pks16" FT misc_feature 318310..319623 FT /colour=0 FT /note="Pfam match to entry PF00501 AMP-binding, FT AMP-binding enzyme, score -49.80, E-value 1.2e-12" FT misc_feature 318688..318723 FT /colour=8 FT /note="PS00455 Putative AMP-binding domain signature" FT CDS complement(319965..320564) FT /EC_number="3.1.1.29" FT /class="II.B.1" FT /colour=7 FT /gene="pth" FT /gene="ML0244" FT /note="Similar to M. tuberculosis pth, Rv1014c, FT peptidyl-tRNA hydrolase, SW:PTH_MYCTU (P96386) (191 aa); FT Fasta score E(): 0, 77.7% identity in 188 aa overlap. FT Similar to many e.g. Escherichia coli pth, peptidyl-tRNA FT hydrolase, SW:PTH_ECOLI (P23932) (194 aa); Fasta score FT E(): 3.7e-22, 37.2% identity in 188 aa overlap. Contains FT Pfam match to entry PF01195 Pept_tRNA_hydro, Peptidyl-tRNA FT hydrolase. Contains PS01196 Peptidyl-tRNA hydrolase FT signature 2." FT /product="putative peptidyl-tRNA hydrolase" FT /tb_orthologue="pth" FT misc_feature complement(319974..320534) FT /colour=0 FT /note="Pfam match to entry PF01195 Pept_tRNA_hydro, FT Peptidyl-tRNA hydrolase, score 297.90, E-value 1.2e-85" FT misc_feature complement(320178..320210) FT /colour=8 FT /note="PS01196 Peptidyl-tRNA hydrolase signature 2" FT CDS complement(320577..321224) FT /class="II.A.1" FT /colour=2 FT /gene="rplY" FT /gene="ML0245" FT /note="Similar to M. tuberculosis rplY, 50S ribosomal FT protein L25, SW:RL25_MYCTU (P96385) (215 aa); Fasta score FT E(): 0, 73.9% identity in 218 aa overlap. Similar to many FT e.g. Escherichia coli rplY, 50S ribosomal protein L25, FT SW:RL25_ECOLI (P02426) (94 aa); Fasta score E(): 0.00054, FT 33.7% identity in 89 aa overlap. Contains Pfam match to FT entry PF01386 Ribosomal_L25p, Ribosomal L25p family." FT /product="putative 50S ribosomal protein L25" FT /tb_orthologue="rplY" FT misc_feature complement(320940..321200) FT /colour=0 FT /note="Pfam match to entry PF01386 Ribosomal_L25p, FT Ribosomal L25p family, score 149.60, E-value 5.4e-41" FT RBS complement(321232..321237) FT /note="possible RBS" FT CDS complement(322399..323055) FT /class="II.C.1" FT /colour=3 FT /gene="lpqT" FT /gene="ML0246" FT /note="Similar to M. tuberculosis lpqT, putative FT lipoprotein, SW:LPQT_MYCTU (P96384) (226 aa); Fasta score FT E(): 0, 67.1% identity in 213 aa overlap. Also similar to FT M. tuberculosis MTC28, Rv0040c, proline rich 28 kDa FT antigen precursor, SW:PR28_MYCTU (P71697) (311 aa); Fasta FT score E(): 1.3e-10, 33.3% identity in 159 aa overlap. FT Contains a probable N-terminal signal sequence. Contains FT PS00013 Prokaryotic membrane lipoprotein lipid attachment FT site." FT /note="Similar to ML0031, except at N-terminus" FT /product="putative lipoprotein" FT /tb_orthologue="lpqT" FT misc_feature complement(322984..323016) FT /colour=8 FT /note="PS00013 Prokaryotic membrane lipoprotein lipid FT attachment site" FT CDS complement(323092..323406) FT /class="III.F" FT /colour=0 FT /gene="arsC" FT /gene="ML0247" FT /note="Similar to many e.g. Escherichia coli arsC, FT arsenate reductase, SW:ARC1_ECOLI (P08692) (141 aa); Fasta FT score E(): 1.7e-07, 38.8% identity in 103 aa overlap. FT Similar to proteins which expand the substrate specificity FT of arsAB pump." FT /product="putative arsenate reductase" FT CDS complement(323462..324445) FT /class="I.F.1" FT /colour=7 FT /gene="prsA" FT /gene="ML0248" FT /note="Similar to M. tuberculosis prsA, ribose-phosphate FT pyrophosphokinase, TR:P96383 (EMBL:AL123456) (326 aa); FT Fasta score E(): 0, 92.0% identity in 326 aa overlap. FT Similar to many e.g. Bacillus subtilis prs, FT ribose-phosphate pyrophosphokinase, SW:KPRS_BACSU (P14193) FT (317 aa); Fasta score E(): 0, 45.8% identity in 323 aa FT overlap. Contains Pfam match to entry PF00156 FT Pribosyltran, Phosphoribosyl transferase domain. Contains FT PS00103 Purine/pyrimidine phosphoribosyl transferases FT signature." FT /product="putative ribose-phosphate pyrophosphokinase" FT /tb_orthologue="prsA" FT misc_feature complement(323594..324016) FT /colour=0 FT /note="Pfam match to entry PF00156 Pribosyltran, FT Phosphoribosyl transferase domain, score 95.00, E-value FT 1.5e-24" FT misc_feature complement(323729..323767) FT /colour=8 FT /note="PS00103 Purine/pyrimidine phosphoribosyl FT transferases signature" FT RBS complement(324451..324454) FT /note="possible RBS" FT CDS complement(324556..326034) FT /EC_number="2.7.7.23" FT /class="II.C.3" FT /colour=3 FT /gene="glmU" FT /gene="ML0249" FT /note="Similar to M. tuberculosis glmU, putative FT UDP-N-acetylglucosamine pyrophosphorylase, TR:P96382 FT (EMBL:AL123456) (495 aa); Fasta score E(): 0, 82.1% FT identity in 492 aa overlap. Similar to many e.g. Neisseria FT gonorrhoeae glmU, UDP-N-acetylglucosamine FT pyrophosphorylase, SW:GLMU_NEIGO (Q50986) (456 aa); Fasta FT score E(): 0, 37.4% identity in 462 aa overlap. Contains FT Pfam match to entry PF00483 NTP_transferase, Nucleotidyl FT transferase. Contains 5 Pfam matches to entry PF00132 FT hexapep, Bacterial transferase hexapeptide (four FT repeats)." FT /product="putative UDP-N-acetylglucosamine FT pyrophosphorylase" FT /tb_orthologue="glmU" FT misc_feature complement(324715..324768) FT /colour=0 FT /note="Pfam match to entry PF00132 hexapep, Bacterial FT transferase hexapeptide (four repeats), score 9.10, FT E-value 44" FT misc_feature complement(324895..324948) FT /colour=0 FT /note="Pfam match to entry PF00132 hexapep, Bacterial FT transferase hexapeptide (four repeats), score 8.60, FT E-value 53" FT misc_feature complement(325000..325053) FT /colour=0 FT /note="Pfam match to entry PF00132 hexapep, Bacterial FT transferase hexapeptide (four repeats), score 11.30, FT E-value 23" FT misc_feature complement(325099..325152) FT /colour=0 FT /note="Pfam match to entry PF00132 hexapep, Bacterial FT transferase hexapeptide (four repeats), score 13.10, FT E-value 6.6" FT misc_feature complement(325153..325206) FT /colour=0 FT /note="Pfam match to entry PF00132 hexapep, Bacterial FT transferase hexapeptide (four repeats), score 17.00, FT E-value 0.44" FT misc_feature complement(325303..326013) FT /colour=0 FT /note="Pfam match to entry PF00483 NTP_transferase, FT Nucleotidyl transferase, score -0.80, E-value 1.3e-07" FT RBS complement(326040..326044) FT /note="possible RBS" FT tRNA complement(326132..326203) FT /colour=4 FT /note="tRNA Gln anticodon TTG, Cove score 52.56" FT /gene="glnT" FT CDS 326387..326995 FT /class="I.J.1" FT /colour=0 FT /gene="ML0250" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv1019 (Best blastx score 404)" FT /product="transcriptional regulator (TetR/AcrR family) FT (pseudogene)" FT /pseudo FT CDS complement(327120..327945) FT /class="I.D.2" FT /colour=0 FT /gene="ML0251" FT /note="Possible pseudogene similar to M. tuberculosis FT paralogue lysA (Best blastx score 114)" FT /product="putative diaminopimelate decarboxylase FT (pseudogene)" FT /pseudo FT CDS 328067..331741 FT /class="II.A.5" FT /colour=2 FT /gene="mfd" FT /gene="ML0252" FT /note="Similar to M. tuberculosis mfd, FT transcription-repair coupling factor, SW:MFD_MYCTU FT (P96380) (1234 aa); Fasta score E(): 0, 84.3% identity in FT 1229 aa overlap. Similar to many e.g. Escherichia coli FT mfd, transcription-repair coupling factor, SW:MFD_ECOLI FT (P30958) (1148 aa); Fasta score E(): 0, 38.1% identity in FT 1111 aa overlap. Contains Pfam match to entry PF00271 FT helicase_C, Helicases conserved C-terminal domain. FT Contains Pfam match to entry PF00270 DEAD, DEAD/DEAH box FT helicase." FT /product="putative transcription-repair coupling factor" FT /tb_orthologue="mfd" FT misc_feature 329996..330583 FT /colour=0 FT /note="Pfam match to entry PF00270 DEAD, DEAD/DEAH box FT helicase, score 73.60, E-value 2.2e-22" FT misc_feature 330692..330943 FT /colour=0 FT /note="Pfam match to entry PF00271 helicase_C, Helicases FT conserved C-terminal domain, score 63.10, E-value 6.1e-15" FT CDS 331780..332529 FT /class="V" FT /colour=0 FT /gene="ML0253" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv1021 (Best blastx score 252)" FT /product="conserved hypothetical protein (pseudogene)" FT /pseudo FT CDS 332923..333664 FT /class="II.C.1" FT /colour=0 FT /gene="lpqU" FT /gene="ML0254" FT /note="Possible pseudogene of M. tuberculosis orthologue FT lpqU (Best blastx score 224)" FT /product="lipoprotein (pseudogene)" FT /pseudo FT RBS 333730..333734 FT /note="possible RBS" FT CDS 333751..335094 FT /EC_number="4.2.1.11" FT /class="I.B.1" FT /colour=7 FT /gene="eno" FT /gene="ML0255" FT /note="Similar to M. tuberculosis eno, putative enolase, FT SW:ENO_MYCTU (P96377) (429 aa); Fasta score E(): 0, 88.8% FT identity in 429 aa overlap. Similar to many e.g. Bacillus FT subtilis eno, enolase (2-phosphoglycerate dehydratase), FT SW:ENO_BACSU (P37869) (430 aa); Fasta score E(): 0, 58.8% FT identity in 425 aa overlap. Contains Pfam match to entry FT PF00113 enolase, Enol-ase. Contains PS00164 Enolase FT signature." FT /product="putative enolase" FT /tb_orthologue="eno" FT misc_feature 333808..335076 FT /colour=0 FT /note="Pfam match to entry PF00113 enolase, Enol-ase, FT score 773.50, E-value 8.3e-229" FT misc_feature 334798..334839 FT /colour=8 FT /note="PS00164 Enolase signature" FT RBS 335108..335111 FT /note="possible RBS" FT CDS 335129..335812 FT /class="II.C.4" FT /colour=3 FT /gene="ML0256" FT /note="Similar to M. tuberculosis Rv1024, hypothetical FT protein, TR:P96376 (EMBL:AL123456) (228 aa); Fasta score FT E(): 0, 70.5% identity in 220 aa overlap. Contains FT hydrophobic, possible membrane-spanning region." FT /product="putative membrane protein" FT /tb_orthologue="Rv1024" FT CDS 335805..336308 FT /class="V" FT /colour=10 FT /gene="ML0257" FT /note="Similar to M. tuberculosis Rv1025, hypothetical FT protein, TR:P96375 (EMBL:AL123456) (155 aa); Fasta score FT E(): 0, 85.1% identity in 154 aa overlap. Also similar to FT hypothetical proteins from Thermotoga maritima e.g. FT TM1078, hypothetical protein, TR:Q9X0G7 (EMBL:AE001768) FT (170 aa); Fasta score E(): 2.4e-09, 32.6% identity in 172 FT aa overlap." FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv1025" FT RBS 336291..336295 FT /note="possible RBS" FT CDS 336305..337258 FT /class="V" FT /colour=10 FT /gene="ML0258" FT /note="Similar to M. tuberculosis Rv1026, hypothetical FT protein, TR:P96374 (EMBL:AL123456) (319 aa); Fasta score FT E(): 0, 77.6% identity in 321 aa overlap. Similar to many FT bacterial hypothetical proteins and shows weak similarity FT to N-terminal half of Escherichia coli ppx, FT exopolyphosphatase, SW:PPX_ECOLI (P29014) (512 aa); Fasta FT score E(): 6.8e-07, 25.3% identity in 297 aa overlap." FT /note="Shows weak similarity to ML2434" FT /product="hypothetical protein" FT /tb_orthologue="Rv1026" FT CDS 337531..339287 FT /class="II.C.4" FT /colour=0 FT /gene="ML0259" FT /note="Possible pseudogene similar to M. tuberculosis FT paralogue mmpL4 (Best blastx score 308)" FT /product="conserved large membrane protein (pseudogene)" FT /pseudo FT CDS complement(339324..340503) FT /class="I.J.2" FT /colour=0 FT /gene="ML0260" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv1032c (Best blastx score 284)" FT /product="sensor histidine kinase (pseudogene)" FT /pseudo FT CDS complement(340549..341173) FT /class="I.J.2" FT /colour=0 FT /gene="ML0261" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv1033c (Best blastx score 192)" FT /product="two-component response regulator (pseudogene)" FT /pseudo FT CDS complement(341956..342250) FT /class="V" FT /colour=0 FT /gene="ML0262" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv1038c (Best blastx score 310)" FT /product="conserved hypothetical protein (pseudogene)" FT /pseudo FT CDS complement(343372..343984) FT /class="IV.C.1.a" FT /colour=0 FT /gene="PE" FT /gene="ML0263" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv1040c, PE (Best blastx score 122)" FT /product="PE-family protein (pseudogene)" FT /pseudo FT tRNA 344340..344413 FT /colour=4 FT /note="tRNA Leu anticodon TAA, Cove score 63.13" FT /gene="leuX" FT CDS complement(344904..345275) FT /class="V" FT /colour=0 FT /gene="ML0264" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv2775 (Best blastx score 95)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT CDS 345708..345920 FT /class="VI" FT /colour=8 FT /gene="ML0265" FT /note="Improbable CDS suggested by GC frameplot. Possibly FT the remains of a disrupted gene." FT /product="hypothetical protein" FT CDS 346709..347435 FT /class="V" FT /colour=0 FT /gene="ML0266" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv1056 (Best blastx score 289)" FT /product="conserved hypothetical protein (pseudogene)" FT /pseudo FT repeat_region 348453..349480 FT /note="REPLEP region 2, 5'-end most similar to REPLEP 5 FT and 6; 3'-end most similar to REPLEP 11" FT repeat_region 348535..349414 FT /note="Dispersed repeat, REPLEP, copy 2" FT /label=REPLEP FT /colour=5 FT repeat_region 349415..349442 FT /note="28 bp subsequence of 45 bp REPLEP-associated FT sequence" FT CDS complement(350965..351892) FT /class="I.B.6.c" FT /colour=0 FT /gene="ackA" FT /gene="ML0267" FT /note="Possible pseudogene of M. tuberculosis orthologue FT ackA (Best blastx score 257)" FT /product="acetate kinase (pseudogene)" FT /pseudo FT CDS complement(351893..352999) FT /class="I.A.1" FT /colour=0 FT /gene="pta" FT /gene="ML0268" FT /note="Possible pseudogene of M. tuberculosis orthologue FT pta (Best blastx score 310)" FT /product="phosphate acetyltransferase (pseudogene)" FT /pseudo FT CDS complement(353007..354017) FT /class="IV.G" FT /colour=7 FT /gene="ML0269" FT /note="Similar to M. tuberculosis Rv0407, probable FT coenzyme F420-dependent enzyme, TR:P96253 (EMBL:AL123456) FT (336 aa); Fasta score E(): 0, 89.3% identity in 336 aa FT overlap. Similar to mycobacterial G6PDHs e.g. FT Mycobacterium avium fgd, F420-dependent FT glucose-6-phosphate dehydrogenase, TR:Q9XC15 FT (EMBL:AF152394) (336 aa); Fasta score E(): 0, 88.4% FT identity in 336 aa overlap. previously sequenced as FT TR:O69589 (EMBL:AL023514) (336 aa); Fasta score E(): 0, FT 100.0% identity in 336 aa overlap." FT /note="Shows weak similarity to ML0131" FT /product="putative F420-dependent glucose-6-phosphate FT dehydrogenase" FT /tb_orthologue="Rv0407" FT RBS complement(354030..354034) FT /note="possible RBS" FT CDS 354105..354860 FT /class="V" FT /colour=10 FT /gene="ML0270" FT /note="Similar to M. tuberculosis Rv0406c, hypothetical FT protein, TR:O86336 (EMBL:AL123456) (272 aa); Fasta score FT E(): 0, 74.9% identity in 243 aa overlap. Shows similarity FT to members of the metallo-beta-lactamase superfamily. FT Conserved in mycobacteria e.g. Mycobacterium avium bllP, FT beta-lactamase-like protein, TR:Q9XC16 (EMBL:AF152394) FT (247 aa); Fasta score E(): 0, 73.7% identity in 243 aa FT overlap. Previously sequenced as TR:O69590 (EMBL:AL023514) FT (251 aa); Fasta score E(): 0, 100.0% identity in 251 aa FT overlap. Contains Pfam match to entry PF00753 lactamase_B, FT Metallo-beta-lactamase superfamily." FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv0406c" FT misc_feature 354150..354785 FT /colour=0 FT /note="Pfam match to entry PF00753 lactamase_B, FT Metallo-beta-lactamase superfamily, score 145.40, E-value FT 9.7e-40" FT CDS complement(354849..355220) FT /class="II.C.4" FT /colour=3 FT /gene="ML0271" FT /note="Similar to M. tuberculosis Rv0401, putative FT membrane protein, TR:P95210 (EMBL:AL123456) (123 aa); FT Fasta score E(): 1.9e-32, 66.9% identity in 121 aa FT overlap. Similar to region of Arabidopsis thaliana FT F27F5.3, hypothetical protein, TR:AAF69175 (EMBL:AC007915) FT (261 aa); Fasta score E(): 1.5e-06, 30.8% identity in 120 FT aa overlap. Previously sequenced as TR:O69591 FT (EMBL:AL023514) (122 aa); Fasta score E(): 0, 100.0% FT identity in 122 aa overlap. Contains hydrophobic, possible FT membrane-spanning regions." FT /product="putative membrane protein" FT /tb_orthologue="Rv0401" FT CDS 355303..355922 FT /class="V" FT /colour=0 FT /gene="ML0272" FT /note="Possible oxidoreductase pseudogene. Similar to FT several M. tuberculosis genes e.g. Rv1941, Rv2214c, FT Rv2857c (Best blastx score 134)" FT /product="putative oxidoreductase (pseudogene)" FT /pseudo FT CDS 355941..356489 FT /class="I.A.3" FT /colour=0 FT /gene="fadE7" FT /gene="ML0273" FT /note="Possible pseudogene of M. tuberculosis orthologue FT fadE7 (Best blastx score 140)" FT /product="acyl-CoA dehydrogenase (pseudogene)" FT /pseudo FT CDS 356520..356618 FT /class="V" FT /colour=0 FT /gene="ML0274" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv0398c (Best blastx score 86)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT CDS complement(357557..358777) FT /EC_number="4.2.99.-" FT /class="I.D.2" FT /colour=7 FT /gene="metZ" FT /gene="ML0275" FT /note="Similar to M. tuberculosis metZ, Rv0391, FT o-succinylhomoserine sulfhydrylase, TR:P95199 FT (EMBL:AL123456) (406 aa); Fasta score E(): 0, 87.9% FT identity in 406 aa overlap. Similar to many e.g. FT Pseudomonas aeruginosa metZ, o-succinylhomoserine FT sulfhydrylase, SW:METZ_PSEAE (P55218) (403 aa); Fasta FT score E(): 0, 44.3% identity in 406 aa overlap. Previously FT sequenced as TR:O69592 (EMBL:AL023514) (426 aa); Fasta FT score E(): 0, 100.0% identity in 406 aa overlap. Contains FT Pfam match to entry PF01053 Cys_Met_Meta_PP, Cys/Met FT metabolism PLP-dependent enzyme." FT /note="Similar to ML2394" FT /product="putative o-succinylhomoserine sulfhydrylase" FT /tb_orthologue="metZ" FT misc_feature complement(357560..358720) FT /colour=0 FT /note="Pfam match to entry PF01053 Cys_Met_Meta_PP, FT Cys/Met metabolism PLP-dependent enzyme, score 638.40, FT E-value 3.8e-188" FT RBS complement(358789..358792) FT /note="possible RBS" FT CDS complement(358834..359277) FT /class="V" FT /colour=10 FT /gene="ML0276" FT /note="Similar to M. tuberculosis Rv0390, hypothetical FT protein, TR:P95198 (AL123456) (140 aa); Fasta score E(): FT 0, 79.0% identity in 138 aa overlap. Also similar to FT Rickettsia prowazekii RP600, hypothetical protein, FT TR:Q9ZCV8 (EMBL:AJ235272) (123 aa); Fasta score E(): FT 8.6e-05, 35.1% identity in 134 aa overlap. Previously FT sequenced as TR:O69593 (EMBL:AL023514) (147 aa); Fasta FT score E(): 0, 100.0% identity in 147 aa overlap." FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv0390" FT CDS 360202..360638 FT /class="IV.C.2" FT /colour=0 FT /gene="ML0277" FT /note="Possible pseudogene similar to M. tuberculosis FT PPE-family proteins (Best blastx score 74)" FT /product="PPE-family protein (pseudogene)" FT /pseudo FT CDS 360751..361125 FT /class="V" FT /colour=0 FT /gene="ML0278" FT /note="Possible pseudogene similar to M. tuberculosis FT paralogue Rv0387c (Best blastx score 97)" FT /product="conserved hypothetical protein (pseudogene)" FT /pseudo FT CDS complement(361297..361953) FT /class="V" FT /colour=10 FT /gene="ML0279" FT /note="Similar to M. tuberculosis Rv0356c, hypothetical FT protein, TR:O06307 (EMBL:AL123456) (214 aa); Fasta score FT E(): 0, 73.4% identity in 214 aa overlap. Previously FT sequenced as TR:O69594 (EMBL:AL023514) (218 aa); Fasta FT score E(): 0, 99.5% identity in 218 aa overlap." FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv0356c" FT CDS complement(361950..363248) FT /EC_number="6.3.4.4" FT /class="I.F.1" FT /colour=7 FT /gene="purA" FT /gene="ML0280" FT /note="Similar to M. tuberculosis purA, Rv0357c, FT adenylosuccinate synthase, SW:PURA_MYCTU (O08381) (432 FT aa); Fasta score E(): 0, 87.9% identity in 431 aa overlap. FT Similar to many e.g. Escherichia coli purA, FT adenylosuccinate synthase, SW:PURA_ECOLI (P12283) (431 FT aa); Fasta score E(): 0, 51.1% identity in 425 aa overlap. FT Previously sequenced as SW:PURA_MYCLE (O69595) (432 aa); FT Fasta score E(): 0, 100.0% identity in 432 aa overlap. FT Contains Pfam match to entry PF00709 Adenylsucc_synt, FT Adenylosuccinate synthetase. Contains PS00513 FT Adenylosuccinate synthetase active site. Contains PS01266 FT Adenylosuccinate synthetase GTP-binding site." FT /product="putative adenylosuccinate synthase" FT /tb_orthologue="purA" FT RBS complement(361960..361964) FT /note="possible RBS" FT misc_feature complement(362070..363236) FT /colour=0 FT /note="Pfam match to entry PF00709 Adenylsucc_synt, FT Adenylosuccinate synthetase, score 729.00, E-value FT 2.1e-215" FT misc_feature complement(362820..362855) FT /colour=8 FT /note="PS00513 Adenylosuccinate synthetase active site" FT misc_feature complement(363198..363221) FT /colour=8 FT /note="PS01266 Adenylosuccinate synthetase GTP-binding FT site" FT RBS 363423..363427 FT /note="possible RBS" FT CDS 363432..364121 FT /class="V" FT /colour=10 FT /gene="ML0281" FT /note="Similar to M. tuberculosis Rv0358, hypothetical FT protein, TR:O06308 (EMBL:AL123456) (215 aa); Fasta score FT E(): 0, 62.4% identity in 229 aa overlap. Previously FT sequenced as TR:O69596 (EMBL:AL023514) (229 aa); Fasta FT score E(): 0, 99.6% identity in 229 aa overlap." FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv0358" FT CDS 364131..364909 FT /class="V" FT /colour=0 FT /gene="ML0282" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv0359 (Best blastx score 161)" FT /product="conserved hypothetical protein (pseudogene)" FT /pseudo FT CDS 364916..365722 FT /class="III.A.2" FT /colour=3 FT /gene="ML0283" FT /note="Similar to many cation-efflux transporter FT components e.g. Alcaligenes eutrophus czcD, FT cobalt-zinc-cadmium resistance protein, SW:CZCD_ALCEU FT (P13512) (316 aa); Fasta score E(): 3.8e-22, 36.4% FT identity in 209 aa overlap. Previously sequenced as FT TR:O69597 (EMBL:AL023514) (256 aa); Fasta score E(): 0, FT 100.0% identity in 256 aa overlap. Contains hydrophobic, FT possible membrane-spanning regions. Beyond codon 220 FT (approx.) GC frameplot and codon useage plots indicate a FT possible frame change. Similarity to characterised FT transporter components ends at this point. This suggests FT that the ORF may have suffered a disruption and therefore FT not encode a functional product. Contains Pfam match to FT entry PF01545 Cation_efflux, Cation efflux family." FT /product="putative cation-efflux transporter component" FT misc_feature 365174..365719 FT /colour=0 FT /note="Pfam match to entry PF01545 Cation_efflux, Cation FT efflux family, score 17.10, E-value 0.0001" FT CDS complement(365860..366273) FT /class="V" FT /colour=10 FT /gene="ML0284" FT /note="Similar to M. tuberculosis Rv0360c, hypothetical FT protein, TR:O06310 (EMBL:AL123456) (145 aa); Fasta score FT E(): 0, 85.4% identity in 137 aa overlap and Streptomyces FT coelicolor SCH10.25C, hypothetical protein, TR:Q9X8R4 FT (EMBL:AL049754) (143 aa); Fasta score E(): 8.2e-27, 56.2% FT identity in 130 aa overlap. Previously sequenced as FT TR:O69598 (EMBL:AL023514) (137 aa); Fasta score E(): 0, FT 100.0% identity in 137 aa overlap." FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv0360c" FT RBS complement(366277..366283) FT /note="possible RBS" FT RBS 366374..366378 FT /note="possible RBS" FT CDS 366385..367263 FT /class="II.C.4" FT /colour=3 FT /gene="ML0285" FT /note="Similar to M. tuberculosis Rv0361, possible FT membrane protein, TR:O06311 (EMBL:AL123456) (275 aa); FT Fasta score E(): 0, 58.6% identity in 292 aa overlap. FT Previously sequenced as TR:O69599 (EMBL:AL023514) (292 FT aa); Fasta score E(): 0, 100.0% identity in 292 aa FT overlap. Contains hydrophobic, possible membrane-spanning FT region." FT /product="putative membrane protein" FT CDS complement(367279..368316) FT /EC_number="4.1.2.13" FT /class="I.B.1" FT /colour=7 FT /gene="fba" FT /gene="ML0286" FT /note="Similar to M. tuberculosis fba, Rv0363c, fructose FT bisphosphate aldolase, SW:ALF_MYCTU (O06313) (344 aa); FT Fasta score E(): 0, 87.7% identity in 342 aa overlap. FT Similar to many e.g. Corynebacterium glutamicum, fructose FT bisphosphate aldolase, SW:ALF_CORGL (P19537) (343 aa); FT Fasta score E(): 0, 72.8% identity in 342 aa overlap. FT Previously sequenced as SW:ALF_MYCLE (O69600) (345 aa); FT Fasta score E(): 0, 100.0% identity in 345 aa overlap. FT Contains Pfam match to entry PF01116 F_bP_aldolase, FT Fructose-bisphosphate aldolase class-II. Contains PS00806 FT Fructose-bisphosphate aldolase class-II signature 2. FT Contains PS00602 Fructose-bisphosphate aldolase class-II FT signature 1." FT /product="putative fructose bisphosphate aldolase" FT /tb_orthologue="fba" FT misc_feature complement(367294..368304) FT /colour=0 FT /note="Pfam match to entry PF01116 F_bP_aldolase, FT Fructose-bisphosphate aldolase class-II, score 484.30, FT E-value 9.4e-142" FT misc_feature complement(367810..367845) FT /colour=8 FT /note="PS00806 Fructose-bisphosphate aldolase class-II FT signature 2" FT misc_feature complement(368026..368061) FT /colour=8 FT /note="PS00602 Fructose-bisphosphate aldolase class-II FT signature 1" FT RBS complement(368324..368330) FT /note="possible RBS" FT CDS 368449..369117 FT /class="II.C.4" FT /colour=3 FT /gene="ML0287" FT /note="Similar to M. tuberculosis Rv0364, hypothetical FT protein, SW:Y364_MYCTU (O06314) (227 aa); Fasta score E(): FT 0, 66.1% identity in 227 aa overlap. Similar to many FT dedA-family proteins e.g. Streptomyces coelicolor FT SCE9.18C, possible membrane protein, TR:Q9X8J1 FT (EMBL:AL049841) (303 aa); Fasta score E(): 0, 42.8% FT identity in 201 aa overlap. Previously sequenced as FT TR:O69601 (EMBL:AL023514) (222 aa); Fasta score E(): 0, FT 100.0% identity in 222 aa overlap. Contains hydrophobic, FT possible membrane-spanning regions. Contains Pfam match to FT entry PF00597 DedA, DedA family." FT /product="putative membrane protein" FT /tb_orthologue="Rv0364" FT misc_feature 368536..369018 FT /colour=0 FT /note="Pfam match to entry PF00597 DedA, DedA family, FT score 99.60, E-value 6e-26" FT repeat_region 369095..369127 FT /note="33 bp sequence found at 5'-end of copies 2 and 7 of FT LEPREP " FT repeat_region 369128..371510 FT /note="Dispersed repeat, LEPREP, copy 2 " FT /label=LEPREP FT /colour=5 FT CDS 369473..369612 FT /class="IV.B" FT /colour=0 FT /gene="ML0288" FT /note="Similar to Pseudomonas putida transposase tnpa1 FT TR:Q9R9U9 (EMBL:AJ245436) (355 aa) fasta scores: E(): FT 3.4e-05, 47.8% id in 46 aa, and to Agrobacterium FT tumefaciens transposase TR:Q44454 (EMBL:Z18270) (366 aa) FT fasta scores: E(): 0.00026, 41.3% id in 46 aa" FT /pseudo FT CDS 369817..370960 FT /class="IV.B" FT /colour=0 FT /gene="ML0289" FT /note="Similar to many e.g. Cryphonectria parasitica FT (Chesnut blight fungus) putative maturase TR:AAF27656 FT (EMBL:AF218567) (778 aa) fasta scores: E(): 7.8e-11, 29.2% FT id in 216 aa" FT /product="putative group II intron maturase-related FT protein" FT /pseudo FT stem_loop 370444..370497 FT CDS 371225..371323 FT /class="IV.B" FT /colour=0 FT /gene="ML0290" FT /note="Similar to Agrobacterium tumefaciens transposase FT TR:Q44454 (EMBL:Z18270) (366 aa) fasta scores: E(): FT 0.0002, 51.5% id in 33 aa, and to Pseudomonas putida FT transposase tnpa1 TR:Q9R9U9 (EMBL:AJ245436) (355 aa) fasta FT scores: E(): 0.00088, 48.5% id in 33 aa" FT /pseudo FT repeat_region 371511..371531 FT /note="21 bp sequence found at 3'-ends of copies 2, 3, 4 FT and 6 of LEPREP" FT CDS complement(372034..372426) FT /class="VI" FT /colour=8 FT /gene="ML0291" FT /note="Unknown function. Previously sequenced as TR:O69603 FT (EMBL:AL023514) (130 aa); Fasta score E(): 0, 99.2% FT identity in 130 aa overlap." FT /product="hypothetical protein" FT CDS complement(373605..373844) FT /class="VI" FT /colour=8 FT /gene="ML0292" FT /note="Unknown function. Possibly the remains of a FT disrupted gene." FT /product="hypothetical protein" FT RBS complement(373854..373857) FT /note="possible RBS" FT CDS complement(375453..375662) FT /class="VI" FT /colour=8 FT /gene="ML0293" FT /note="Unknown function. Possibly the remains of a FT disrupted gene." FT /product="hypothetical protein" FT RBS 377474..377479 FT /note="possible RBS" FT CDS 377487..379130 FT /class="I.G.7" FT /colour=7 FT /gene="thiC" FT /gene="ML0294" FT /note="Similar to M. tuberculosis thiC, Rv0423c, thiamine FT biosynthesis protein, SW:THIC_MYCTU (P96269) (547 aa); FT Fasta score E(): 0, 90.1% identity in 547 aa overlap. FT Similar to many e.g. Escherichia coli thiC, thiamine FT biosynthesis protein, SW:THIC_ECOLI (P30136) (631 aa); FT Fasta score E(): 0, 59.2% identity in 593 aa overlap. FT Previously sequenced as SW:THIC_MYCLE (Q9ZBL0) (547 aa); FT Fasta score E(): 0, 100.0% identity in 547 aa overlap. FT Contains Pfam match to entry PF01964 ThiC, ThiC family." FT /product="putative thiamine biosynthesis protein" FT /tb_orthologue="thiC" FT misc_feature 377742..379013 FT /colour=0 FT /note="Pfam match to entry PF01964 ThiC, ThiC family, FT score 1105.40, E-value 0" FT CDS 379127..379966 FT /EC_number="2.7.4.7" FT /class="I.G.8" FT /colour=7 FT /gene="thiD" FT /gene="ML0295" FT /note="Similar to M. tuberculosis thiD, Rv0422c, FT phosphomethylpyrimidine kinase, SW:THID_MYCTU (P96268) FT (265 aa); Fasta score E(): 0, 77.8% identity in 266 aa FT overlap. Similar to many e.g. Escherichia coli thiD, FT phosphomethylpyrimidine kinase, SW:THID_ECOLI (P76422) FT (266 aa); Fasta score E(): 3.2e-29, 38.4% identity in 263 FT aa overlap. Previously sequenced as SW:THID_MYCLE (Q9ZBL1) FT (279 aa); Fasta score E(): 0, 99.6% identity in 279 aa FT overlap." FT /product="putative phosphomethylpyrimidine kinase" FT /tb_orthologue="thiD" FT CDS 380011..380147 FT /class="V" FT /colour=0 FT /gene="ML0296" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv0421c (Best blastx score 85)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT CDS complement(380645..381430) FT /class="I.G.8" FT /colour=7 FT /gene="thiG" FT /gene="ML0297" FT /note="Similar to M. tuberculosis Rv0417, hypothetical FT protein, TR:P96263 (EMBL:AL123456) (252 aa); Fasta score FT E(): 0, 86.8% identity in 250 aa overlap. Similar to many FT proteins involved in the biosynthesis of the thiazole FT moiety of thiamine e.g. Escherichia coli thiG, thiamine FT biosynthetic protein (thiazole moiety), SW:THIG_ECOLI FT (P30139) (281 aa); Fasta score E(): 0, 51.2% identity in FT 244 aa overlap. Previously sequenced as TR:Q9ZBL2 FT (EMBL:AL035159) (261 aa); Fasta score E(): 0, 99.6% FT identity in 261 aa overlap." FT /product="putative thiamine biosynthesis protein" FT CDS complement(381423..381647) FT /class="V" FT /colour=10 FT /gene="ML0298" FT /note="Similar to M. tuberculosis Rv0416, conserved FT hypothetical protein, TR:P96262 (EMBL:AL123456) (68 aa); FT Fasta score E(): 5.9e-17, 71.6% identity in 74 aa overlap. FT Similar to bacterial hypothetical protein e.g. Escherichia FT coli thiS, hypothetical protein, SW:THIS_ECOLI (O32583) FT (66 aa); Fasta score E(): 0.41, 32.0% identity in 50 aa FT overlap. Previously sequenced as TR:Q9ZBL3 (EMBL:AL035159) FT (74 aa); Fasta score E(): 1.2e-28, 100.0% identity in 74 FT aa overlap." FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv0416" FT CDS complement(381655..382677) FT /class="I.B.7" FT /colour=7 FT /gene="ML0299" FT /note="Similar to M. tuberculosis Rv0415, conserved FT hypothetical protein, TR:P96261 (EMBL:AL123456) (340 aa); FT Fasta score E(): 0, 82.0% identity in 338 aa overlap. FT Shows weak similarity to Bacillus subtilis goxB, glycine FT oxidase, SW:GLOX_BACSU (O31616) (369 aa); Fasta score E(): FT 6.6e-10, 28.7% identity in 352 aa overlap. Previously FT sequenced as TR:Q9ZBL4 (EMBL:AL035159) (340 aa); Fasta FT score E(): 0, 100.0% identity in 340 aa overlap. Contains FT Pfam match to entry PF01266 DAO, D-amino acid oxidase." FT /note="Shows weak similarity to ML2011" FT /product="putative oxidoreductase" FT /tb_orthologue="Rv0415" FT misc_feature complement(381664..382656) FT /colour=0 FT /note="Pfam match to entry PF01266 DAO, D-amino acid FT oxidase, score 35.40, E-value 3.5e-09" FT RBS complement(382683..382688) FT /note="possible RBS" FT CDS 382835..383542 FT /EC_number="2.5.1.3" FT /class="I.G.8" FT /colour=7 FT /gene="thiE" FT /gene="ML0300" FT /note="Similar to M. tuberculosis thiE, Rv0414c, putative FT thiamine-phosphate pyrophosphorylase, SW:THIE_MYCTU FT (P96260) (222 aa); Fasta score E(): 0, 78.9% identity in FT 223 aa overlap. Similar to many e.g. Escherichia coli FT thiE, thiamine-phosphate pyrophosphorylase, SW:THIE_ECOLI FT (P30137) (211 aa); Fasta score E(): 5e-10, 38.7% identity FT in 199 aa overlap. Previously sequenced as SW:THIE_MYCLE FT (Q9ZBL5) (235 aa); Fasta score E(): 0, 99.6% identity in FT 235 aa overlap." FT /product="putative thiamine-phosphate pyrophosphorylase" FT /tb_orthologue="thiE" FT CDS complement(383529..384154) FT /class="II.A.5" FT /colour=0 FT /gene="mutT3" FT /gene="ML0301" FT /note="Possible pseudogene of M. tuberculosis orthologue FT mutT3 (Best blastx score 180)" FT /product="MutT homologue (pseudogene)" FT /pseudo FT CDS 384334..385649 FT /class="II.C.4" FT /colour=0 FT /gene="ML0302" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv0412c (Best blastx score 1672)" FT /product="putative membrane protein (pseudogene)" FT /pseudo FT RBS 385638..385642 FT /note="possible RBS" FT CDS 385649..386629 FT /class="III.A.1" FT /colour=3 FT /gene="glnH" FT /gene="ML0303" FT /note="Similar to M. tuberculosis glnH, Rv0411c, putative FT glutamine-binding protein, TR:P96257 (EMBL:AL123456) (328 FT aa); Fasta score E(): 0, 79.3% identity in 328 aa overlap. FT Similar to many bacterial solute-binding proteins e.g. FT Bacillus stearothermophilus glnH, glutamine-binding FT protein, SW:GLNH_BACST (P27676) (262 aa); Fasta score E(): FT 3.7e-23, 38.1% identity in 194 aa overlap. Previously FT sequenced as TR:Q9ZBL7 (EMBL:AL035159) (325 aa); Fasta FT score E(): 0, 100.0% identity in 325 aa overlap. Contains FT a probable N-terminal signal sequence. Contains Pfam match FT to entry PF00497 SBP_bac_3, Bacterial extracellular FT solute-binding proteins, family 3. Contains PS01039 FT Bacterial extracellular solute-binding proteins, family 3 FT signature. Contains PS00013 Prokaryotic membrane FT lipoprotein lipid attachment site." FT /product="putative glutamine-binding protein" FT /tb_orthologue="glnH" FT misc_feature 385670..386578 FT /colour=0 FT /note="Pfam match to entry PF00497 SBP_bac_3, Bacterial FT extracellular solute-binding proteins, family 3, score FT 98.70, E-value 1.2e-25" FT misc_feature 385688..385720 FT /colour=8 FT /note="PS00013 Prokaryotic membrane lipoprotein lipid FT attachment site" FT misc_feature 385991..386032 FT /colour=8 FT /note="PS01039 Bacterial extracellular solute-binding FT proteins, family 3 signature" FT CDS 386629..388932 FT /class="I.J.3" FT /colour=9 FT /gene="pknG" FT /gene="ML0304" FT /note="Similar to M. tuberculosis pknG, Rv0410c, putative FT serine/threonine protein kinase, TR:P96256 (EMBL:AL123456) FT (750 aa); Fasta score E(): 0, 83.1% identity in 756 aa FT overlap. Similar to many bacterial putative FT serine/threonine protein kinases e.g. Streptomyces FT coelicolor SC6D10.09, possible protein kinase, TR:CAB71204 FT (EMBL:AL138538) (903 aa); Fasta score E(): 0, 42.0% FT identity in 793 aa overlap. Similar in part, to protein FT kinases from Myxococcus xanthus e.g. pkn12, FT serine/threonine protein kinase, TR:Q9XBP5 (EMBL:AF159692) FT (465 aa); Fasta score E(): 2.9e-10, 28.4% identity in 292 FT aa overlap. Previously sequenced as TR:Q9ZBL8 FT (EMBL:AL035159) (763 aa); Fasta score E(): 0, 100.0% FT identity in 763 aa overlap. Contains Pfam match to entry FT PF00069 pkinase, Eukaryotic protein kinase domain. FT Contains PS00108 Serine/Threonine protein kinases FT active-site signature." FT /note="Similar to regions of ML0016 and ML0017" FT /product="putative serine-threonine protein kinase" FT /tb_orthologue="pknG" FT misc_feature 387118..387693 FT /colour=0 FT /note="Pfam match to entry PF00069 pkinase, Eukaryotic FT protein kinase domain, score 91.00, E-value 3.9e-24" FT misc_feature 387493..387531 FT /colour=8 FT /note="PS00108 Serine/Threonine protein kinases FT active-site signature" FT repeat_region 389364..390409 FT /note="REPLEP region 3, 5'-end most similar to REPLEP 15; FT 3'-end most similar to REPLEP 14" FT repeat_region 389417..390296 FT /note="Dispersed repeat, REPLEP, copy 3" FT /label=REPLEP FT /colour=5 FT repeat_region 390297..390324 FT /note="28 bp subsequence of 45 bp REPLEP-associated FT sequence" FT CDS complement(390457..391901) FT /class="II.C.4" FT /colour=0 FT /gene="ML0305" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv0537c (Best blastx score 503)" FT /product="unknown, possible membrane protein, FT (pseudogene)" FT /pseudo FT CDS 392396..393159 FT /class="II.C.5" FT /colour=0 FT /gene="ML0306" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv0538 (Best blastx score 184)" FT /product="possible transmembrane protein (pseudogene)" FT /pseudo FT CDS 393500..393920 FT /class="V" FT /colour=0 FT /gene="ML0307" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv0434 (Best blastx score 130)" FT /product="conserved hypothetical protein (pseudogene)" FT /pseudo FT CDS 394457..395161 FT /class="V" FT /colour=10 FT /gene="ML0308" FT /note="Similar to hypothetical proteins from FT methanobacteria e.g. Methanobacterium thermoautotrophicum FT MTH1801, hypothetical protein, TR:O27829 (EMBL:AE000934) FT (224 aa); Fasta score E(): 3.6e-24, 39.3% identity in 219 FT aa overlap and Methanococcus jannaschii MJ0045, FT hypothetical protein, SW:Y045_METJA (Q60353) (221 aa); FT Fasta score E(): 4e-17, 30.5% identity in 220 aa overlap. FT Previously sequenced as TR:Q9ZBM1 (EMBL:AL035159) (234 FT aa); Fasta score E(): 0, 100.0% identity in 234 aa FT overlap." FT /product="conserved hypothetical protein" FT CDS complement(395181..397022) FT /class="III.C" FT /colour=0 FT /gene="ML0309" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv0435c (Best blastx score 329)" FT /product="ATPase of AAA-family (pseudogene)" FT /pseudo FT CDS complement(397046..397948) FT /EC_number="2.7.8.8" FT /class="I.H.3" FT /colour=1 FT /gene="pssA" FT /gene="ML0310" FT /note="Similar to M. tuberculosis pssA, Rv0436c, FT CDP-diacylglycerol-serine o-phosphatidyltransferase, FT SW:PSS_MYCTU (P96282) (286 aa); Fasta score E(): 0, 77.9% FT identity in 285 aa overlap. Similar to many e.g. FT Helicobacter pylori pssA, CDP-diacylglycerol-serine FT o-phosphatidyltransferase, SW:PSS_HELPY (Q48269) (237 aa); FT Fasta score E(): 2.3e-14, 34.6% identity in 234 aa FT overlap. Previously sequenced as TR:Q9ZBM2 (EMBL:AL035159) FT (300 aa); Fasta score E(): 0, 100.0% identity in 300 aa FT overlap. Contains Pfam match to entry PF01066 FT CDP-OH_P_transf, CDP-alcohol phosphatidyltransferase. FT Contains PS00379 CDP-alcohol phosphatidyltransferases FT signature." FT /product="putative CDP-diacylglycerol-serine FT o-phosphatidyltransferase" FT /tb_orthologue="pssA" FT misc_feature complement(397271..397819) FT /colour=0 FT /note="Pfam match to entry PF01066 CDP-OH_P_transf, FT CDP-alcohol phosphatidyltransferase, score -1.50, E-value FT 0.0012" FT misc_feature complement(397712..397780) FT /colour=8 FT /note="PS00379 CDP-alcohol phosphatidyltransferases FT signature" FT CDS complement(397945..398676) FT /class="V" FT /colour=10 FT /gene="ML0311" FT /note="Similar to M. tuberculosis psd, Rv0437c, putative FT phosphatidylserine decarboxylase, TR:O86324 FT (EMBL:AL123456) (231 aa); Fasta score E(): 0, 72.6% FT identity in 241 aa overlap. Similar to many bacterial FT hypothetical proteins e.g. Rickettsia prowazekii RP241, FT hypothetical protein, TR:Q9ZDT4 (EMBL:AJ235271) (231 aa); FT Fasta score E(): 5.2e-31, 43.3% identity in 215 aa overlap FT and Neisseria meningitidis MC58 NMB0963, FT phosphatidylserine decarboxylase precursor-related FT protein, TR:AAF41369 (EMBL:AE002447) (265 aa); Fasta score FT E(): 2.5e-23, 39.2% identity in 217 aa overlap. Previously FT sequenced as TR:Q9ZBM3 (EMBL:AL035159) (202 aa); Fasta FT score E(): 0, 99.5% identity in 202 aa overlap. The start FT codon is uncertain. Codon usage suggests an alternative FT start at codon 63 (approx)." FT /product="conserved hypothetical protein" FT /tb_orthologue="psd" FT CDS complement(398720..399953) FT /class="I.G.4" FT /colour=0 FT /gene="moaA3" FT /gene="ML0312" FT /note="Possible pseudogene of M. tuberculosis orthologue FT moaA3 (Best blastx score 245)" FT /product="molybdenum cofactor biosynthesis, protein A FT (pseudogene)" FT /pseudo FT CDS complement(400042..400675) FT /class="I.B.7" FT /colour=0 FT /gene="ML0313" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv0439c (Best blastx score 248)" FT /product="probable oxidoreductase (pseudogene)" FT /pseudo FT CDS complement(400771..401778) FT /class="II.B.5" FT /colour=7 FT /gene="ML0314" FT /note="Similar to M. tuberculosis lipU, Rv1076, probable FT esterase, TR:O53424 (EMBL:AL123456) (297 aa); Fasta score FT E(): 0, 79.7% identity in 296 aa overlap. Also similar to FT other putative esterases from M. tuberculosis. Similar to FT esterases e.g. Streptomyces hygroscopicus bah, FT acetyl-hydrolase, SW:BAH_STRHY (Q01109) (299 aa); Fasta FT score E(): 6.6e-19, 36.2% identity in 246 aa overlap. FT Previuosly sequenced as TR:Q9ZBM4 (EMBL:AL035159) (335 FT aa); Fasta score E(): 0, 99.7% identity in 335 aa overlap. FT Contains PS01174 Lipolytic enzymes 'G-D-X-G' family, FT putative serine active site." FT /product="putative esterase" FT /tb_orthologue="lipU" FT misc_feature complement(401257..401295) FT /colour=8 FT /note="PS01174 Lipolytic enzymes 'G-D-X-G' family, FT putative serine active site" FT CDS complement(403698..404612) FT /class="I.B.7" FT /colour=7 FT /gene="ML0315" FT /note="Similar to M. tuberculosis Rv0068, putative FT oxidoreductase, TR:O53613 (EMBL:AL123456) (303 aa); Fasta FT score E(): 0, 73.9% identity in 306 aa overlap and to FT other M. tuberculosis putative oxidoreductases (e.g. FT Rv0439c). Similar to many bacterial putative FT oxidoreductases e.g. Streptomyces coelicolor SC7A8.30C, FT putative oxidoreductase, TR:CAB69779 (EMBL:AL137187) (310 FT aa); Fasta score E(): 0, 47.9% identity in 311 aa overlap. FT Previously sequenced as TR:Q9ZBM5 (EMBL:AL035159) (304 FT aa); Fasta score E(): 0, 100.0% identity in 304 aa FT overlap. Contains Pfam match to entry PF00106 adh_short, FT short chain dehydrogenase." FT /product="putative oxidoreductase" FT /tb_orthologue="Rv0068" FT misc_feature complement(403974..404570) FT /colour=0 FT /note="Pfam match to entry PF00106 adh_short, short chain FT dehydrogenase, score 95.90, E-value 7.9e-25" FT RBS complement(404619..404623) FT /note="possible RBS" FT CDS 404707..405309 FT /class="I.J.1" FT /colour=9 FT /gene="ML0316" FT /note="Similar to M. tuberculosis Rv0067c, putative FT transcriptional regulator, TR:O53612 (EMBL:AL123456) (189 FT aa); Fasta score E(): 0, 68.8% identity in 189 aa overlap. FT Similar to many putative transcriptional regulators e.g. FT Streptomyces coelicolor SCF6.16, putative tetR family FT transcriptional regulator, TR:Q9RJL5 (EMBL:AL121849) (194 FT aa); Fasta score E(): 2.5e-18, 39.5% identity in 185 aa FT overlap. Previously sequenced as TR:Q9ZBM6 (EMBL:AL035159) FT (189 aa); Fasta score E(): 0, 100.0% identity in 189 aa FT overlap. Contains a probable helix-turn-helix motif at aa FT 45-66 (Score 1800, SD +5.32) Contains Pfam match to entry FT PF00440 tetR, Bacterial regulatory proteins, tetR family." FT /product="putative TetR/AcrR-family transcriptional FT regulator" FT /tb_orthologue="Rv0067c" FT misc_feature 404794..404931 FT /colour=0 FT /note="Pfam match to entry PF00440 tetR, Bacterial FT regulatory proteins, tetR family, score 62.00, E-value FT 1.3e-14" FT RBS 405501..405505 FT /note="possible RBS" FT CDS 405518..407143 FT /class="III.B" FT /colour=0 FT /gene="groEL2" FT /gene="ML0317" FT /note="Similar to M. tuberculosis groEL2, Rv0440, 60 kDa FT chaperonin 2, SW:CH62_MYCTU (P06806) (539 aa); Fasta score FT E(): 0, 94.8% identity in 541 aa overlap. A major FT immunoreactive protein (65 kDa antigen). Previously FT sequenced as SW:CH62_MYCLE (P09239) (540 aa); Fasta score FT E(): 0, 100.0% identity in 540 aa overlap. Contains Pfam FT match to entry PF00118 cpn60_TCP1, TCP-1/cpn60 chaperonin FT family. Contains PS00296 Chaperonins cpn60 signature." FT /note="Similar to ML0381" FT /product="60 kDa chaperonin 2" FT /tb_orthologue="groEL2" FT misc_feature 405581..407083 FT /colour=0 FT /note="Pfam match to entry PF00118 cpn60_TCP1, TCP-1/cpn60 FT chaperonin family, score 777.80, E-value 4.3e-230" FT misc_feature 406724..406759 FT /colour=8 FT /note="PS00296 Chaperonins cpn60 signature" FT repeat_region 407378..408126 FT /note="Dispersed repeat, RLEP, copy 6" FT /label=RLEP FT /colour=5 FT CDS complement(408187..409345) FT /class="II.A.5" FT /colour=0 FT /gene="radA" FT /gene="ML0318" FT /note="Possible pseudogene of M. tuberculosis orthologue FT radA (Best blastx score 221)" FT /product="probable DNA repair RadA homologue (pseudogene)" FT /pseudo FT CDS complement(409442..409993) FT /class="II.C.1" FT /colour=3 FT /gene="lpqE" FT /gene="ML0319" FT /note="Similar to M. tuberculosis lpqE, Rv3584, putative FT lipoprotein, TR:O53569 (EMBL:AL123456) (182 aa); Fasta FT score E(): 0, 63.4% identity in 175 aa overlap. Previously FT sequenced as TR:Q9ZBM7 (EMBL:AL035159) (183 aa); Fasta FT score E(): 0, 99.5% identity in 183 aa overlap. Contains a FT probable N-terminal signal sequnce. Contains PS00013 FT Prokaryotic membrane lipoprotein lipid attachment site." FT /product="putative lipoprotein" FT /tb_orthologue="lpqE" FT misc_feature complement(409901..409933) FT /colour=8 FT /note="PS00013 Prokaryotic membrane lipoprotein lipid FT attachment site" FT RBS complement(410000..410005) FT /note="possible RBS" FT CDS 410354..410851 FT /class="I.J.1" FT /colour=9 FT /gene="ML0320" FT /note="Similar to M. tuberculosis Rv3583c, putative FT transcription factor, TR:O53568 (EMBL:AL123456) (162 aa); FT Fasta score E(): 0, 97.5% identity in 162 aa overlap. FT Shows weak similarity to Myxococcus xanthus carD, FT transcription factor, TR:Q50887 (EMBL:Z56280) (316 aa); FT Fasta score E(): 9.1e-13, 31.2% identity in 154 aa overlap FT and to many hypothetical transcription factors." FT /product="putative transcription factor" FT /tb_orthologue="Rv3583c" FT RBS 410859..410862 FT /note="possible RBS" FT CDS 410870..411595 FT /class="I.C.1" FT /colour=7 FT /gene="ML0321" FT /note="Similar to M. tuberculosis Rv3582c, conserved FT hypothetical protein, SW:YZ82_MYCTU (P96864) (231 aa); FT Fasta score E(): 0, 66.0% identity in 241 aa overlap. FT Similar to many bacterial hypothetical proteins e.g. FT Streptomyces coelicolor SCD8A.06, hypothetical protein, FT TR:CAB77327 (EMBL:AL160331) (270 aa); Fasta score E(): FT 4.3e-25, 45.0% identity in 240 aa overlap. Shows weak FT similarity to non-mevalonate pathway enzyme FT 4-diphosphocytidyl-2C-methyl-D-erythritol synthases e.g. FT Escherichia coli ispD, FT 4-diphosphocytidyl-2C-methyl-D-erythritol synthase, FT TR:AAF43207 (EMBL:AF230736) (236 aa); Fasta score E(): FT 0.0016, 36.1% identity in 244 aa overlap. Contains Pfam FT match to entry PF01128 UPF0007, Uncharacterized protein FT family UPF0007." FT /product="putative FT 4-diphosphocytidyl-2C-methyl-D-erythritol synthase" FT /tb_orthologue="Rv3582c" FT misc_feature 410891..411592 FT /colour=0 FT /note="Pfam match to entry PF01128 UPF0007, FT Uncharacterized protein family UPF0007, score 293.70, FT E-value 2.3e-84" FT CDS 411592..412068 FT /class="I.C.1" FT /colour=7 FT /gene="ML0322" FT /note="Similar to M. tuberculosis Rv3581c, hypothetical FT protein, SW:YZ81_MYCTU (P96863) (159 aa); Fasta score E(): FT 0, 79.1% identity in 158 aa overlap. Similar to FT 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthases, FT e.g. Escherichia coli 2-C-methyl-D-erythritol FT 2,4-cyclodiphosphate synthase, TR:BAA95145 (EMBL:AB038256) FT (159 aa); Fasta score E(): 1e-17, 41.3% identity in 155 aa FT overlap. Contains Pfam match to entry PF01128 UPF0007, FT Uncharacterized protein family UPF0007." FT /product="putative 2-C-methyl-D-erythritol FT 2,4-cyclodiphosphate synthase" FT /tb_orthologue="Rv3581c" FT CDS 412123..413544 FT /EC_number="6.1.1.16" FT /class="II.A.3" FT /colour=2 FT /gene="cysS" FT /gene="ML0323" FT /note="Similar to M. tuberculosis cysS, Rv3580c, FT cysteinyl-tRNA synthetase, SW:SYC1_MYCTU (P96862) (469 FT aa); Fasta score E(): 0, 86.5% identity in 467 aa overlap. FT Similar to many e.g. Escherichia coli cysS, cysteinyl-tRNA FT synthetase, SW:SYC_ECOLI (P21888) (461 aa); Fasta score FT E(): 0, 42.0% identity in 460 aa overlap. Contains Pfam FT match to entry PF01406 tRNA-synt_1e, tRNA synthetases FT class I (C)." FT /note="Similar to ML1302" FT /product="putative cysteinyl-tRNA synthase" FT /tb_orthologue="cysS" FT misc_feature 412177..413472 FT /colour=0 FT /note="Pfam match to entry PF01406 tRNA-synt_1e, tRNA FT synthetases class I (C), score 815.60, E-value 1.8e-241" FT CDS 413627..414463 FT /class="IV.H" FT /colour=7 FT /gene="ML0324" FT /note="Similar to M. tuberculosis Rv3579c, putative FT methyltransferase, TR:P96861 (EMBL:AL123456) (322 aa); FT Fasta score E(): 0, 84.1% identity in 277 aa overlap. FT Similar Streptomyces actuosus nhs, 23S rRNA FT methyltransferase and to many hypothetical rRNA FT methyltransferases. Contains Pfam match to entry PF00588 FT SpoU_methylase, SpoU rRNA Methylase family." FT /product="putative methyltransferase" FT /tb_orthologue="Rv3579c" FT misc_feature 414011..414436 FT /colour=0 FT /note="Pfam match to entry PF00588 SpoU_methylase, SpoU FT rRNA Methylase family, score 159.60, E-value 5.2e-44" FT RBS 414843..414848 FT /note="possible RBS" FT CDS 414865..415128 FT /class="VI" FT /colour=8 FT /gene="ML0325" FT /note="Unknown function. Possibly the remains of a FT disrupted gene." FT /product="hypothetical protein" FT stem_loop complement(415215..415269) FT /note="55 bp palindrome" FT CDS complement(416569..416845) FT /class="V" FT /colour=0 FT /gene="ML0326" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv0288 (Best blastx score 118)" FT /product="conserved hypothetical protein (pseudogene)" FT /pseudo FT CDS complement(416866..417152) FT /class="V" FT /colour=0 FT /gene="ML0327" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv0287 (Best blastx score 124)" FT /product="conserved hypothetical protein (pseudogene)" FT /pseudo FT CDS complement(417242..418418) FT /class="IV.C.2" FT /colour=0 FT /gene="PPE" FT /gene="ML0328" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv0286, PPE (Best blastx score 169)" FT /product="PPE-family protein (pseudogene)" FT /pseudo FT CDS complement(420549..420876) FT /class="V" FT /colour=0 FT /gene="ML0329" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv1942c (Best blastx score 168)" FT /product="conserved hypothetical protein (pseudogene)" FT /pseudo FT CDS complement(420876..420989) FT /class="V" FT /colour=0 FT /gene="ML0330" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv1943c (Best blastx score 154)" FT /product="conserved hypothetical protein (pseudogene)" FT /pseudo FT CDS complement(421105..422310) FT /class="III.A.4" FT /colour=0 FT /gene="arsB2" FT /gene="ML0331" FT /note="Possible pseudogene of M. tuberculosis orthologue FT arsB2 (Best blastx score 423)" FT /product="probable arsenical pump (pseudogene)" FT /pseudo FT repeat_region complement(421979..422252) FT /note="274 bp repeat, 99% identity to 2828540..2828813" FT CDS complement(422317..423055) FT /class="V" FT /colour=0 FT /gene="ML0332" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3577 (Best blastx score 257)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT CDS complement(423178..423936) FT /class="V" FT /colour=10 FT /gene="ML0333" FT /note="N-terminal half is similar to that of Emericella FT nidulans lamB, lactam utilization protein, SW:LAMB_EMENI FT (P38096) (262 aa); Fasta score E(): 2.6e-15, 38.3% FT identity in 128 aa overlap. Similar to many bacterial FT hypothetical proteins e.g. TR:Q9RL45 (EMBL:AL121596) (250 FT aa); Fasta score E(): 0, 58.1% identity in 248 aa FT overlap." FT /product="conserved hypothetical protein" FT CDS complement(424106..424678) FT /class="V" FT /colour=0 FT /gene="pknM" FT /gene="ML0334" FT /note="Possible pseudogene of M. tuberculosis orthologue FT pknM (Best blastx score 208)" FT /product="similar to ser-thr-protein kinases (pseudogene)" FT /pseudo FT CDS complement(424867..425727) FT /class="III.A" FT /colour=3 FT /gene="ML0335" FT /note="Similar in part to M. tuberculosis Rv2060, FT conserved hypothetical protein, TR:O86339 (EMBL:AL123456) FT (133 aa); Fasta score E(): 0, 80.3% identity in 132 aa FT overlap. Similar, except N-terminal approx. 100 aa to many FT bacterial ABC transporters e.g. Streptococcus pneumoniae FT adcB, putative ABC metal permease, TR:O33704 (EMBL:Z71552) FT (268 aa); Fasta score E(): 2.5e-15, 26.6% identity in 263 FT aa overlap. Contains hydrophobic, possible FT membrane-spanning regions. Contains Pfam match to entry FT PF00950 ABC-3, ABC 3 transport family." FT /product="putative ABC-transporter transmembrane protein" FT /tb_orthologue="Rv2060" FT misc_feature complement(424891..425661) FT /colour=0 FT /note="Pfam match to entry PF00950 ABC-3, ABC 3 transport FT family, score 95.40, E-value 1.1e-24" FT CDS complement(425727..426554) FT /class="III.A" FT /colour=3 FT /gene="ML0336" FT /note="Similar to many putative ABC-tranporter ATP-binding FT proteins e.g. Chlamydia trachomatis troB, ABC transporter FT ATPase, TR:O87477 (EMBL:AF077010) (286 aa); Fasta score FT E(): 4.7e-16, 31.4% identity in 223 aa overlap. Contains FT Pfam match to entry PF00005 ABC_tran, ABC transporter. FT Contains PS00017 ATP/GTP-binding site motif A (P-loop). FT Contains PS00211 ABC transporters family signature." FT /product="putative ABC-tranporter ATP-binding protein" FT misc_feature complement(425847..426413) FT /colour=0 FT /note="Pfam match to entry PF00005 ABC_tran, ABC FT transporter, score 148.40, E-value 1.2e-40" FT misc_feature complement(426033..426077) FT /colour=8 FT /note="PS00211 ABC transporters family signature" FT misc_feature complement(426369..426392) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT CDS complement(426563..427471) FT /class="III.A" FT /colour=3 FT /gene="ML0337" FT /note="Shows weak similarity to periplasmic solute-binding FT proteins e.g. Synechocystis sp. (strain PCC 6803) mntC, FT periplasmic-binding protein, TR:Q55280 (EMBL:L34630) (330 FT aa); Fasta score E(): 0.0001, 26.4% identity in 178 aa FT overlap. Contains a possible N-terminal signal sequence. FT Contains Pfam match to entry PF01297 Lipoprotein_4, FT Adhesion lipoprotein. Contains PS00013 Prokaryotic FT membrane lipoprotein lipid attachment site." FT /product="putative periplasmic solute-binding proteins" FT misc_feature complement(426584..427450) FT /colour=0 FT /note="Pfam match to entry PF01297 Lipoprotein_4, Adhesion FT lipoprotein, score 2.70, E-value 4.5e-10" FT misc_feature complement(427412..427444) FT /colour=8 FT /note="PS00013 Prokaryotic membrane lipoprotein lipid FT attachment site" FT CDS 427651..428675 FT /class="I.J.1" FT /colour=0 FT /gene="ML0338" FT /note="Possible pseudogene similar to M. tuberculosis FT orthologue Rv3575c (Best blastx score 220)" FT /product="transcriptional regulator (LacI family) FT (pseudogene)" FT /pseudo FT CDS complement(428887..429249) FT /class="I.J.1" FT /colour=0 FT /gene="ML0339" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3574 (Best blastx score 269)" FT /product="transcriptional regulator (TetR/AcrR family) FT (pseudogene)" FT /pseudo FT CDS 429653..431495 FT /class="I.A.3" FT /colour=0 FT /gene="fadE34" FT /gene="ML0340" FT /note="Possible pseudogene of M. tuberculosis orthologue FT fadE34 (Best blastx score 539)" FT /product="acyl-CoA dehydrogenase (pseudogene)" FT /pseudo FT CDS complement(431727..432218) FT /class="V" FT /colour=0 FT /gene="ML0341" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3572 (Best blastx score 324)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT CDS complement(432323..433323) FT /class="I.B.7" FT /colour=0 FT /gene="ML0342" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3571 (Best blastx score 484)" FT /product="electron transfer component of (pseudogene)" FT /pseudo FT CDS 433560..434728 FT /class="I.B.7" FT /colour=0 FT /gene="ML0343" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3570c (Best blastx score 413)" FT /product="putative oxidoreductase (pseudogene)" FT /pseudo FT CDS 434746..435270 FT /class="IV.I" FT /colour=0 FT /gene="ML0344" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3569c (Best blastx score 339)" FT /product="probable hydrolase (pseudogene)" FT /pseudo FT CDS complement(435602..436741) FT /class="I.H.3" FT /colour=0 FT /gene="ML0345" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3523 (Best blastx score 319)" FT /product="lipid carrier protein (pseudogene)" FT /pseudo FT CDS complement(436783..437194) FT /class="I.J.1" FT /colour=0 FT /gene="ML0346" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3522 (Best blastx score 167)" FT /product="putative transcriptional regulator (pseudogene)" FT /pseudo FT CDS complement(437391..437981) FT /class="V" FT /colour=0 FT /gene="ML0347" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3521 (Best blastx score 236)" FT /product="conserved hypothetical protein (pseudogene)" FT /pseudo FT CDS 438262..439314 FT /class="IV.G" FT /colour=7 FT /gene="ML0348" FT /note="Similar to M. tuberculosis Rv3520c, possible FT coenzyme F420-dependent enzyme, TR:O53565 (EMBL:AL123456) FT (347 aa); Fasta score E(): 0, 86.8% identity in 342 aa FT overlap. Shows weak similarity to Methanobacterium FT thermoautotrophicum mer, methylenetetrahydromethanopterin FT reductase, TR:Q50744 (EMBL:X86477) (321 aa); Fasta score FT E(): 2.8e-05, 27.1% identity in 332 aa overlap." FT /product="possible coenzyme F420-dependent oxidoreductase" FT /tb_orthologue="Rv3520c" FT CDS complement(439393..439704) FT /class="V" FT /colour=0 FT /gene="ML0349" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3519 (Best blastx score 156)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT CDS complement(442415..443185) FT /class="IV.H" FT /colour=0 FT /gene="ML0350" FT /note="Possible pseudogene similar to M. tuberculosis FT paralogue Rv3729 (Best blastx score 294)" FT /product="probable transferase (pseudogene)" FT /pseudo FT CDS complement(444087..444737) FT /class="I.A.3" FT /colour=0 FT /gene="echA19" FT /gene="ML0351" FT /note="Possible pseudogene of M. tuberculosis orthologue FT echA19 (Best blastx score 238)" FT /product="enoyl-CoA hydratase/isomerase superfamily FT (pseudogene)" FT /pseudo FT CDS 444860..445795 FT /class="I.A.3" FT /colour=0 FT /gene="fadD19" FT /gene="ML0352" FT /note="Possible pseudogene of M. tuberculosis orthologue FT fadD19 (Best blastx score 221)" FT /product="acyl-CoA synthase (pseudogene)" FT /pseudo FT CDS 446609..447405 FT /class="V" FT /colour=0 FT /gene="ML0353" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3510c (Best blastx score 461)" FT /product="conserved hypothetical protein (pseudogene)" FT /pseudo FT RBS 447402..447406 FT /note="possible RBS" FT CDS 447414..448961 FT /class="I.D.7" FT /colour=7 FT /gene="ilvX" FT /gene="ML0354" FT /note="Similar to M. tuberculosis ilvX, putative FT acetohydroxyacid synthase I large subunit, TR:O53554 FT (EMBL:AL123456) (515 aa); Fasta score E(): 0, 82.9% FT identity in 515 aa overlap. Similar to Escherichia coli FT ilvI, acetolactate synthase isozyme III large subunit, FT SW:ILVI_ECOLI (P00893) (574 aa); Fasta score E(): 1.8e-07, FT 23.7% identity in 540 aa overlap. Also similar to FT Pseudomonas putida mdlC, benzoylformate decarboxylase, FT SW:MDLC_PSEPU (P20906) (528 aa); Fasta score E(): 6.6e-13, FT 29.3% identity in 529 aa overlap. Previously sequenced as FT TR:Q49865 (EMBL:U00020) (515 aa); Fasta score E(): 0, FT 99.8% identity in 515 aa overlap. Contains 2 Pfam matches FT to entry PF00205 TPP_enzymes, Thiamine pyrophosphate FT enzymes." FT /product="putative acetohydroxyacid synthase I large FT subunit" FT /tb_orthologue="ilvX" FT misc_feature 447444..447710 FT /colour=0 FT /note="Pfam match to entry PF00205 TPP_enzymes, Thiamine FT pyrophosphate enzymes, score 47.60, E-value 3.5e-14" FT misc_feature 448551..448937 FT /colour=0 FT /note="Pfam match to entry PF00205 TPP_enzymes, Thiamine FT pyrophosphate enzymes, score 94.50, E-value 9.3e-29" FT CDS complement(449015..450183) FT /class="I.A.3" FT /colour=0 FT /gene="fadD17" FT /gene="ML0355" FT /note="Possible pseudogene of M. tuberculosis orthologue FT fadD17 (Best blastx score 515)" FT /product="acyl-CoA synthase (pseudogene)" FT /pseudo FT CDS complement(450363..451273) FT /class="I.A.3" FT /colour=0 FT /gene="fadE27" FT /gene="ML0356" FT /note="Possible pseudogene of M. tuberculosis orthologue FT fadE27 (Best blastx score 223)" FT /product="acyl-CoA dehydrogenase (pseudogene)" FT /pseudo FT CDS complement(451302..452424) FT /class="I.A.3" FT /colour=0 FT /gene="fadE26" FT /gene="ML0357" FT /note="Possible pseudogene of M. tuberculosis orthologue FT fadE26 (Best blastx score 551)" FT /product="acyl-CoA dehydrogenase (pseudogene)" FT /pseudo FT CDS 452646..452816 FT /class="I.B.6.c" FT /colour=0 FT /gene="ML0358" FT /note="Possible pseudogene of M. tuberculosis orthologue FT fdxD (Best blastx score 212)" FT /product="putative ferredoxin (pseudogene)" FT /pseudo FT CDS 452939..453841 FT /class="I.B.7" FT /colour=0 FT /gene="ML0359" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3502c (Best blastx score 300)" FT /product="putative dehydrogenase (pseudogene)" FT /pseudo FT CDS 454075..454785 FT /class="IV.A" FT /colour=0 FT /gene="ML0360" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3501c (Best blastx score 493)" FT /product="part of mce4 operon (pseudogene)" FT /pseudo FT CDS 454840..455649 FT /class="IV.A" FT /colour=0 FT /gene="ML0361" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3500c (Best blastx score 393)" FT /product="part of mce4 operon (pseudogene)" FT /pseudo FT CDS 455770..456328 FT /class="IV.A" FT /colour=0 FT /gene="mce4" FT /gene="ML0362" FT /note="Possible pseudogene of M. tuberculosis orthologue FT mce4 (Best blastx score 195)" FT /product="cell invasion protein (pseudogene)" FT /pseudo FT CDS 456418..456732 FT /class="II.C.2" FT /colour=3 FT /gene="ML0363" FT /note="Similar to M. tuberculosis Rv3444c, esat6-family FT protein, TR:O06261 (EMBL:Al123456) (100 aa); Fasta score FT E(): 3.3e-20, 71.2% identity in 73 aa overlap and others FT of the esat6 family e.g. esat6 itself, 6 kDa early FT secretory antigenic target, SW:ESA6_MYCTU (Q57165) (94 FT aa); Fasta score E(): 1.5, 28.4% identity in 67 aa FT overlap." FT /product="possible secreted protein" FT RBS 456971..456976 FT /note="possible RBS" FT CDS 456984..457427 FT /class="II.A.1" FT /colour=2 FT /gene="rplM" FT /gene="ML0364" FT /note="Similar to M. tuberculosis rplM, 50S ribosomal FT protein L13, SW:RL13_MYCTU (O06260) (147 aa); Fasta score FT E(): 0, 91.2% identity in 147 aa overlap. Previuosly FT sequenced as SW:RL13_MYCLE (P38014) (147 aa); Fasta score FT E(): 0, 99.3% identity in 147 aa overlap. Contains Pfam FT match to entry PF00572 Ribosomal_L13, Ribosomal protein FT L13. Contains PS00783 Ribosomal protein L13 signature." FT /product="50S ribosomal protein L13" FT /tb_orthologue="rplM" FT misc_feature 457026..457409 FT /colour=0 FT /note="Pfam match to entry PF00572 Ribosomal_L13, FT Ribosomal protein L13, score 289.30, E-value 4.7e-83" FT misc_feature 457296..457364 FT /colour=8 FT /note="PS00783 Ribosomal protein L13 signature" FT CDS 457424..457885 FT /class="II.A.1" FT /colour=2 FT /gene="rpsI" FT /gene="ML0365" FT /note="Similar to M. tuberculosis rpsI, 30S ribosomal FT protein S9, SW:RS9_MYCTU (O06259) (151 aa); Fasta score FT E(): 0, 83.2% identity in 155 aa overlap. Previously FT sequenced as SW:RS9_MYCLE (P40828) (153 aa); Fasta score FT E(): 0, 99.3% identity in 153 aa overlap. Contains Pfam FT match to entry PF00380 Ribosomal_S9, Ribosomal protein FT S9/S16. Contains PS00360 Ribosomal protein S9 signature." FT /product="30S ribosomal protein S9" FT /tb_orthologue="rpsI" FT misc_feature 457520..457882 FT /colour=0 FT /note="Pfam match to entry PF00380 Ribosomal_S9, Ribosomal FT protein S9/S16, score 250.20, E-value 3.2e-77" FT misc_feature 457697..457753 FT /colour=8 FT /note="PS00360 Ribosomal protein S9 signature" FT RBS 457979..457983 FT /note="possible RBS" FT misc_feature 457992..459284 FT /colour=0 FT /note="Pfam match to entry PF00408 PGM_PMM, FT Phosphoglucomutase/phosphomannomutase, score 339.10, FT E-value 4.8e-98" FT CDS 457992..459383 FT /class="I.A.1" FT /colour=7 FT /gene="mrsA" FT /gene="ML0366" FT /note="Similar to M. tuberculosis mrsA, Rv3441c, FT phosphoglucomutase or phosphomannomutase, TR:O06258 FT (EMBL:AL123456) (448 aa); Fasta score E(): 0, 87.6% FT identity in 445 aa overlap. Similar to many e.g. FT Salmonella typhimurium manB, phosphomannomutase, FT SW:MANB_SALTY (P26341) (264 aa); BlastP Expect 9.5. FT Previously sequenced as TR:Q49869 (EMBL:U00020) (463 aa); FT Fasta score E(): 0, 100.0% identity in 463 aa overlap. FT Contains Pfam match to entry PF00408 PGM_PMM, FT Phosphoglucomutase/phosphomannomutase. Contains PS00710 FT Phosphoglucomutase and phosphomannomutase phosphoserine FT signature." FT /note="Similar to ML0706 and ML0763" FT /product="putative phosphoglucomutase/phosphomannomutase" FT /tb_orthologue="mrsA" FT misc_feature 458277..458321 FT /colour=8 FT /note="PS00710 Phosphoglucomutase and phosphomannomutase FT phosphoserine signature" FT CDS 459447..459648 FT /class="V" FT /colour=0 FT /gene="ML0367" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3440c (Best blastx score 104)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT CDS 459675..460544 FT /class="V" FT /colour=0 FT /gene="ML0368" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3439c (Best blastx score 221)" FT /product="conserved hypothetical protein (pseudogene)" FT /pseudo FT CDS complement(461185..461541) FT /class="VI" FT /colour=8 FT /gene="ML0369" FT /note="Unknown function. Previously sequenced as TR:Q49877 FT (EMBL:U00020) (118 aa); Fasta score E(): 0, 100.0% FT identity in 118 aa overlap." FT /product="hypothetical protein" FT CDS complement(461945..462814) FT /class="V" FT /colour=10 FT /gene="ML0370" FT /note="Similar to M. tuberculosis Rv3438, conserved FT hypothetical protein, TR:O06255 (EMBL:AL123456) (280 aa); FT Fasta score E(): 0, 80.6% identity in 279 aa overlap. FT Previously sequenced as TR:Q49872 (EMBL:U00020) (324 aa); FT Fasta score E(): 0, 100.0% identity in 289 aa overlap. FT Contains PS00107 Protein kinases ATP-binding region FT signature." FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv3438" FT misc_feature complement(462365..462442) FT /colour=8 FT /note="PS00107 Protein kinases ATP-binding region FT signature" FT CDS 462979..464856 FT /EC_number="2.6.1.16" FT /class="I.C.4" FT /colour=7 FT /gene="glmS" FT /gene="ML0371" FT /note="Similar to M. tuberculosis glmS, Rv3436c, putative FT glucosamine-fructose-6-phosphate aminotransferase, FT SW:GLMS_MYCTU (O06253) (623 aa); Fasta score E(): 0, 89.3% FT identity in 627 aa overlap. Similar to many e.g. Rhizobium FT leguminosarum nodM, glucosamine--fructose-6-phosphate FT aminotransferase, SW:NODM_RHILV (P08633) (607 aa); Fasta FT score E(): 0, 44.0% identity in 629 aa overlap. Previously FT sequenced as SW:GLMS_MYCLE (P40831) (624 aa); Fasta score FT E(): 0, 99.7% identity in 624 aa overlap. Contains Pfam FT match to entry PF00310 GATase_2, Glutamine FT amidotransferases class-II. Contains 2 Pfam matches to FT entry PF01380 SIS, SIS domain." FT /product="putative glucosamine-fructose-6-phosphate FT aminotransferase" FT /tb_orthologue="glmS" FT misc_feature 462982..463557 FT /colour=0 FT /note="Pfam match to entry PF00310 GATase_2, Glutamine FT amidotransferases class-II, score 213.60, E-value 3e-72" FT misc_feature 463873..464277 FT /colour=0 FT /note="Pfam match to entry PF01380 SIS, SIS domain, score FT 183.00, E-value 4.8e-51" FT misc_feature 464389..464811 FT /colour=0 FT /note="Pfam match to entry PF01380 SIS, SIS domain, score FT 148.10, E-value 1.5e-40" FT CDS complement(464951..465073) FT /class="V" FT /colour=0 FT /gene="ML0372" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv0893c (Best blastx score 92)" FT /product="conserved hypothetical protein (pseudogene)" FT /pseudo FT CDS 465202..466623 FT /class="V" FT /colour=10 FT /gene="ML0373" FT /note="Similar to M. tuberculosis Rv3433c, conserved FT hypothetical protein, SW:YY33_MYCTU (O06250) (473 aa); FT Fasta score E(): 0, 84.6% identity in 473 aa overlap. FT Similar to many bacterial hypothetical proteins. FT Previuosly sequenced as SW:YY33_MYCLE (P37391) (392 aa); FT Fasta score E(): 0, 94.5% identity in 381 aa overlap. FT Contains Pfam match to entry PF01256 UPF0031, FT Uncharacterized protein family UPF0031. Contains PS01049 FT Uncharacterized protein family UPF0031 signature 1. FT Contains PS01050 Uncharacterized protein family UPF0031 FT signature 2." FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv3433c" FT misc_feature 465898..466596 FT /colour=0 FT /note="Pfam match to entry PF01256 UPF0031, FT Uncharacterized protein family UPF0031, score 319.30, FT E-value 4.6e-92" FT misc_feature 466075..466107 FT /colour=8 FT /note="PS01049 Uncharacterized protein family UPF0031 FT signature 1" FT misc_feature 466423..466455 FT /colour=8 FT /note="PS01050 Uncharacterized protein family UPF0031 FT signature 2" FT CDS 466653..468022 FT /class="I.C.1" FT /colour=0 FT /gene="gadB" FT /gene="ML0374" FT /note="Possible pseudogene of M. tuberculosis orthologue FT gadB (Best blastx score 527)" FT /product="glutamate decarboxylase (pseudogene)" FT /pseudo FT RBS 468117..468121 FT /note="possible RBS" FT CDS 468132..469298 FT /EC_number="5.1.1.1" FT /class="I.D.6" FT /colour=7 FT /gene="alr" FT /gene="ML0375" FT /note="Similar to M. tuberculosis alr, Rv3423c, putative FT alanine racemase, SW:ALR_MYCTU (Q50705) (384 aa); Fasta FT score E(): 0, 84.6% identity in 382 aa overlap. Similar to FT many e.g. Mycobacterium smegmatis alr, alanine racemase, FT SW:ALR_MYCSM (P94967) (389 aa); Fasta score E(): 0, 67.2% FT identity in 378 aa overlap. Previously sequenced as FT SW:ALR_MYCLE (P38056) (388 aa); Fasta score E(): 0, 99.7% FT identity in 388 aa overlap. Contains 2 Pfam matches to FT entry PF00842 Ala_racemase, Alanine racemase." FT /product="putative alanine racemase" FT /tb_orthologue="alr" FT misc_feature 468243..468395 FT /colour=0 FT /note="Pfam match to entry PF00842 Ala_racemase, Alanine FT racemase, score 72.80, E-value 5.6e-19" FT misc_feature 468534..469274 FT /colour=0 FT /note="Pfam match to entry PF00842 Ala_racemase, Alanine FT racemase, score 245.40, E-value 8.1e-70" FT CDS 469288..470289 FT /class="II.C.5" FT /colour=3 FT /gene="ML0376" FT /note="Unknown function. Contains hydrophobic, possible FT membrane-spanning region near the N-terminus." FT /product="putative membrane protein" FT RBS 470263..470267 FT /note="possible RBS" FT CDS 470282..470767 FT /class="V" FT /colour=10 FT /product="conserved hypothetical protein" FT /gene="ML0377" FT /note="Similar to M. tuberculosis Rv3422c, conserved FT hypothetical protein, SW:YY22_MYCTU (Q50706) (168 aa); FT Fasta score E(): 0, 77.4% identity in 146 aa overlap. FT Similar to many other bacterial hypothetical proteins. FT Previously sequenced as SW:YY22_MYCLE (Q49864) (161 aa); FT Fasta score E(): 0, 100.0% identity in 161 aa overlap. FT Contains PS00017 ATP/GTP-binding site motif A (P-loop)." FT misc_feature 470399..470422 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT CDS 470764..471843 FT /class="IV.H" FT /colour=7 FT /gene="ML0378" FT /note="Similar to M. tuberculosis rimI, Rv3420c, putative FT ribosomal protein S18 acetyltransferase, TR:Q50708 FT (EMBL:Z77165) (158 aa); Fasta score E(): 0, 72.1% identity FT in 154 aa overlap in the C-terminus and to M. tuberculosis FT Rv3421c hypothetical protein, SW:YY21_MYCTU (Q50707) (211 FT aa); Fasta score E(): 0, 75.6% identity in 205 aa overlap FT in the N-terminus. Appears to be a fusion of two M. FT tuberculosis homologues. Similar to many hypothetical FT acetyltransferases. Previously sequenced as SW:YY21_MYCLE FT (Q49857) (359 aa); Fasta score E(): 0, 100.0% identity in FT 359 aa overlap. Contains Pfam match to entry PF00583 FT Acetyltransf, Acetyltransferase (GNAT) family." FT /product="putative acetyltransferase" FT /tb_orthologue="rimI" FT misc_feature 471403..471768 FT /colour=0 FT /note="Pfam match to entry PF00583 Acetyltransf, FT Acetyltransferase (GNAT) family, score 69.60, E-value FT 6.8e-17" FT RBS 471831..471835 FT /note="possible RBS" FT CDS 471840..472895 FT /EC_number="3.4.24.57" FT /class="II.B.3" FT /colour=7 FT /gene="gcp" FT /gene="ML0379" FT /note="Similar to M. tuberculosis gcp, putative FT O-sialoglycoprotein endopeptidase, SW:GCP_MYCTU (Q50709) FT (344 aa); Fasta score E(): 0, 86.1% identity in 345 aa FT overlap. Similar to many e.g. Pasteurella haemolytica gcp, FT O-sialoglycoprotein endopeptidase, SW:GCP_PASHA (P36175) FT (325 aa); Fasta score E(): 0, 45.8% identity in 319 aa FT overlap. previously sequenced as SW:GCP_MYCLE (P37969) FT (351 aa); Fasta score E(): 0, 100.0% identity in 351 aa FT overlap. Contains Pfam match to entry PF00814 FT Peptidase_M22, Glycoprotease family. Contains PS01016 FT Glycoprotease family signature." FT /product="putative O-sialoglycoprotein endopeptidase" FT /tb_orthologue="gcp" FT misc_feature 471864..472820 FT /colour=0 FT /note="Pfam match to entry PF00814 Peptidase_M22, FT Glycoprotease family, score 601.80, E-value 4e-177" FT misc_feature 472164..472226 FT /colour=8 FT /note="PS01016 Glycoprotease family signature" FT RBS 473163..473167 FT /note="possible RBS" FT CDS 473177..473479 FT /class="III.B" FT /colour=0 FT /gene="groES" FT /gene="ML0380" FT /note="Similar to M. tuberculosis groES, 10 kD chaperonin, FT SW:CH10_MYCTU (P09621) (99 aa); Fasta score E(): 3.6e-32, FT 89.9% identity in 99 aa overlap. Previously sequenced as FT SW:CH10_MYCLE (P24301) (99 aa); Fasta score E(): 0, 100.0% FT identity in 99 aa overlap. Contains Pfam match to entry FT PF00166 cpn10, Chaperonins 10 Kd subunit. Contains PS00681 FT Chaperonins cpn10 signature." FT /product="10 kD chaperonin" FT /tb_orthologue="groES" FT misc_feature 473186..473473 FT /colour=0 FT /note="Pfam match to entry PF00166 cpn10, Chaperonins 10 FT Kd subunit, score 180.70, E-value 2.4e-50" FT misc_feature 473192..473266 FT /colour=8 FT /note="PS00681 Chaperonins cpn10 signature" FT RBS 473547..473553 FT /note="possible RBS" FT CDS 473558..475171 FT /class="III.B" FT /colour=0 FT /gene="groEL1" FT /gene="ML0381" FT /note="Similar to M. tuberculosis groEL1, 60 kDa FT chaperonin 1, SW:CH61_MYCTU (Q59573) (539 aa); Fasta score FT E(): 0, 82.9% identity in 539 aa overlap. Previously FT sequenced as SW:CH61_MYCLE (P37578) (537 aa); Fasta score FT E(): 0, 100.0% identity in 537 aa overlap. Contains Pfam FT match to entry PF00118 cpn60_TCP1, TCP-1/cpn60 chaperonin FT family. Contains PS00296 Chaperonins cpn60 signature." FT /product="60 kDa chaperonin 1" FT /tb_orthologue="groEL1" FT misc_feature 473621..475129 FT /colour=0 FT /note="Pfam match to entry PF00118 cpn60_TCP1, TCP-1/cpn60 FT chaperonin family, score 825.30, E-value 2.2e-244" FT misc_feature 474764..474799 FT /colour=8 FT /note="PS00296 Chaperonins cpn60 signature" FT CDS complement(475771..476079) FT /class="I.J.1" FT /colour=9 FT /gene="whiB3" FT /gene="ML0382" FT /note="Similar to M. tuberculosis whiB3, Rv3416, putative FT regulatory protein, TR:Q50710 (EMBL:AL123456) (102 aa); FT Fasta score E(): 0, 86.3% identity in 102 aa overlap. FT Similar to many e.g. Streptomyces coelicolor whiD, FT developmental regulatory gene, TR:O88103 (EMBL:AJ010601) FT (112 aa); Fasta score E(): 1.1e-24, 61.8% identity in 102 FT aa overlap. Previously sequenced as TR:Q49871 FT (EMBL:U00015) (102 aa); Fasta score E(): 0, 100.0% FT identity in 102 aa overlap." FT /note="Similar to ML0760, ML0804 and ML2307" FT /product="putative transcriptional regulator" FT /tb_orthologue="whiB3" FT RBS complement(476089..476093) FT /note="possible RBS" FT CDS 476440..477285 FT /class="V" FT /colour=10 FT /gene="ML0383" FT /note="Similar to M. tuberculosis Rv3415c, conserved FT hypothetical protein, TR:Q50711 (EMBL:AL123456) (275 aa); FT Fasta score E(): 0, 73.6% identity in 277 aa overlap. FT Previously sequenced as TR:Q49858 (EMBL:U00020) (264 aa); FT Fasta score E(): 0, 99.6% identity in 263 aa overlap." FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv3415c" FT CDS 477371..477955 FT /class="II.A.7" FT /colour=0 FT /gene="sigD" FT /gene="ML0384" FT /note="Possible pseudogene of M. tuberculosis orthologue FT sigD (Best blastx score 312)" FT /product="ECF subfamily sigma subunit (pseudogene)" FT /pseudo FT CDS 477951..478698 FT /class="V" FT /colour=0 FT /gene="ML0385" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3413c (Best blastx score 318)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT CDS complement(480093..480506) FT /class="V" FT /colour=10 FT /gene="ML0386" FT /note="Similar to M. tuberculosis Rv3412, conserved FT hypothetical protein, SW:YY12_MYCTU (Q50714) (136 aa); FT Fasta score E(): 0, 93.4% identity in 136 aa overlap. FT Previously sequenced as SW:YY12_MYCLE (Q49742) (137 aa); FT Fasta score E(): 0, 99.3% identity in 137 aa overlap." FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv3412" FT RBS 480647..480651 FT /note="possible RBS" FT CDS 480661..482250 FT /EC_number="1.1.1.205" FT /class="I.F.1" FT /colour=7 FT /gene="guaB2" FT /gene="ML0387" FT /note="Similar to M. tuberculosis guaB2, Rv3411c, putative FT inosine-5'-monophosphate dehydrogenase, SW:IMDH_MYCTU FT (Q50715) (529 aa); Fasta score E(): 0, 92.4% identity in FT 529 aa overlap. Similar to many e.g. Escherichia coli FT guaB, inosine-5'-monophosphate dehydrogenase, FT SW:IMDH_ECOLI (P06981) (488 aa); Fasta score E(): 0, 54.3% FT identity in 490 aa overlap. Previously sequenced as FT SW:IMDH_MYCLE (Q49729) (529 aa); Fasta score E(): 0, FT 100.0% identity in 529 aa overlap. Contains 2 Pfam matches FT to entry PF00571 CBS, CBS domain. Contains Pfam match to FT entry PF00478 IMPDH_C, IMP dehydrogenase / GMP reductase C FT terminus. Contains Pfam match to entry PF01574 IMPDH_N, FT IMP dehydrogenase / GMP reductase N terminus." FT /note="Similar to ML2066 and shows weaker similarity to FT ML0388" FT /product="putative inosine-5'-monophosphate dehydrogenase" FT /tb_orthologue="guaB2" FT misc_feature 480772..481035 FT /colour=0 FT /note="Pfam match to entry PF01574 IMPDH_N, IMP FT dehydrogenase / GMP reductase N terminus, score 193.40, FT E-value 3.5e-54" FT misc_feature 481039..481200 FT /colour=0 FT /note="Pfam match to entry PF00571 CBS, CBS domain, score FT 43.40, E-value 5.1e-09" FT misc_feature 481222..481383 FT /colour=0 FT /note="Pfam match to entry PF00571 CBS, CBS domain, score FT 40.90, E-value 2.9e-08" FT misc_feature 481471..482160 FT /colour=0 FT /note="Pfam match to entry PF00478 IMPDH_C, IMP FT dehydrogenase / GMP reductase C terminus, score 348.80, FT E-value 5.9e-101" FT CDS 482274..483386 FT /class="I.F.1" FT /colour=7 FT /gene="guaB3" FT /gene="ML0388" FT /note="Similar to M. tuberculosis guaB3, Rv3410c, putative FT inosine-5'-monophosphate dehydrogenase, SW:YY10_MYCTU FT (Q50716) (375 aa); Fasta score E(): 0, 90.5% identity in FT 368 aa overlap. This ORF is similar in part to ML0387 and FT ML2066, which more closely resemble the experimentally FT characterised IMP-DH's (e.g. from Escherichia coli). This FT shorter homologue is conserved in several bacterial FT genera. Previously sequenced as SW:YY10_MYCLE (U00015) FT (375 aa); Fasta score E(): 0, 100.0% identity in 370 aa FT overlap. Contains Pfam match to entry PF00478 IMPDH_C, IMP FT dehydrogenase / GMP reductase C terminus." FT /note="Shows weak similarity to ML0387 and ML2066" FT /product="putative inosine-5'-monophosphate dehydrogenase" FT /tb_orthologue="guaB3" FT misc_feature 482712..483368 FT /colour=0 FT /note="Pfam match to entry PF00478 IMPDH_C, IMP FT dehydrogenase / GMP reductase C terminus, score -16.40, FT E-value 3.7e-06" FT CDS 483451..485160 FT /class="I.A.3" FT /colour=1 FT /gene="choD" FT /gene="ML0389" FT /note="Similar to M. tuberculosis choD, Rv3409c, putative FT cholesterol oxidase, TR:Q57307 (EMBL:Al123456) (578 aa); FT Fasta score E(): 0, 88.6% identity in 569 aa overlap. FT Similar to Streptomyces sp. (strain SA-COO) choA, FT cholesterol oxidase precursor, SW:CHOD_STRSQ (P12676) (546 FT aa); Fasta score E(): 0.013, 26.6% identity in 561 aa FT overlap. Previously sequenced as TR:Q59530 (EMBL:U00015) FT (585 aa); Fasta score E(): 0, 100.0% identity in 569 aa FT overlap." FT /product="putative cholesterol oxidase" FT /tb_orthologue="choD" FT CDS complement(485208..485600) FT /class="I.B.7" FT /colour=0 FT /gene="ML0390" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3406 (Best blastx score 382)" FT /product="possibe dioxygenase (pseudogene)" FT /pseudo FT CDS 485789..486124 FT /class="I.J.1" FT /colour=0 FT /gene="ML0391" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3405c (Best blastx score 162)" FT /product="putative transcriptional regulator (pseudogene)" FT /pseudo FT CDS complement(486263..488641) FT /class="IV.H" FT /colour=7 FT /gene="ML0392" FT /note="Similar to M. tuberculosis Rv3401, conserved FT hypothetical protein, SW:YY01_MYCTU (Q50724) (786 aa); FT Fasta score E(): 0, 91.4% identity in 782 aa overlap. FT Shows weak similarity to Lactobacillus sanfranciscensis FT mapA, maltose phosphorylase, TR:O87772 (EMBL:AJ224340) FT (753 aa); Fasta score E(): 1.4e-13, 29.0% identity in 769 FT aa overlap. Similar to many bacterial hypothetical FT proteins e.g. Streptomyces coelicolor SCF42.31C, putative FT glycosyl transferase, TR:CAB69693 (EMBL:AL137165) (792 FT aa); Fasta score E(): 0, 58.9% identity in 790 aa overlap. FT Previously sequenced as SW:YY01_MYCLE (Q49736) (792 aa); FT Fasta score E(): 0, 100.0% identity in 792 aa overlap. FT Contains a probable helix-turn-helix motif at aa 515-536 FT (Score 1032, SD +2.70)" FT /product="putative sugar phosphorylase" FT /tb_orthologue="Rv3401" FT CDS complement(488655..489440) FT /class="I.C.3" FT /colour=7 FT /gene="ML0393" FT /note="Similar to M. tuberculosis Rv3400, hypothetical FT protein, SW:YY00_MYCTU (Q50725) (262 aa); Fasta score E(): FT 0, 74.4% identity in 262 aa overlap. Previously sequenced FT as SW:YY00_MYCLE (Q49741) (261 aa); Fasta score E(): 0, FT 100.0% identity in 261 aa overlap. Contains Pfam match to FT entry PF00702 Hydrolase, haloacid dehalogenase-like FT hydrolase." FT /product="putative hydrolase" FT /tb_orthologue="Rv3400" FT misc_feature complement(488733..489377) FT /colour=0 FT /note="Pfam match to entry PF00702 Hydrolase, haloacid FT dehalogenase-like hydrolase, score 145.80, E-value FT 7.9e-40" FT CDS complement(489915..490427) FT /class="VI" FT /colour=8 FT /gene="ML0394" FT /note="Unknown function. Possible CDS suggested by GC FT frameplot and codon usage plots." FT /product="hypothetical protein" FT RBS complement(490440..490445) FT /note="possible RBS" FT CDS 491043..492632 FT /EC_number="6.3.5.2" FT /class="I.F.1" FT /colour=7 FT /gene="guaA" FT /gene="ML0395" FT /note="Similar to M. tuberculosis guaA, Rv3396c, putative FT GMP synthase, SW:GUAA_MYCTU (Q50729) (525 aa); Fasta score FT E(): 0, 86.9% identity in 525 aa overlap. Similar to many FT e.g. Bacillus subtilis guaA, GMP synthase FT [glutamine-hydrolyzing], SW:GUAA_BACSU (P29727) (513 aa); FT Fasta score E(): 0, 50.7% identity in 515 aa overlap. FT Previously sequenced as SW:GUAA_MYCLE (P46810) (590 aa); FT Fasta score E(): 0, 100.0% identity in 529 aa overlap. FT Contains Pfam match to entry PF00958 GMP_synt_C, GMP FT synthase C terminal domain. Contains Pfam match to entry FT PF00117 GATase, Glutamine amidotransferase class-I. FT Contains PS00442 Glutamine amidotransferases class-I FT active site." FT /product="putative GMP synthase" FT /tb_orthologue="guaA" FT misc_feature 491094..491639 FT /colour=0 FT /note="Pfam match to entry PF00117 GATase, Glutamine FT amidotransferase class-I, score 195.90, E-value 6.5e-55" FT misc_feature 491304..491339 FT /colour=8 FT /note="PS00442 Glutamine amidotransferases class-I active FT site" FT misc_feature 492318..492629 FT /colour=0 FT /note="Pfam match to entry PF00958 GMP_synt_C, GMP FT synthase C terminal domain, score 209.80, E-value 4.1e-59" FT repeat_region complement(492656..493841) FT /note="1186 bp repeat, 100% identical to region FT 3241403..3242588" FT CDS complement(492714..493823) FT /class="V" FT /colour=10 FT /gene="ML0396" FT /note="Similar to M. tuberculosis Rv0046c, conserved FT hypothetical protein, TR:P71703 (EMBL:AL123456) (367 aa); FT Fasta score E(): 0, 91.8% identity in 366 aa overlap. FT Similar to other bacterial hypothetical proteins. FT C-terminal half show weak similarity to eukaryotic FT myo-inositol-1-phosphate synthases e.g. Candida albicans FT ino1, myo-inositol-1-phosphate synthase, SW:INO1_CANAL FT (P42800) (520 aa); Fasta score E(): 0.22, 24.4% identity FT in 242 aa overlap. Previously sequenced as TR:Q57240 FT (EMBL:U00015) (369 aa); Fasta score E(): 0, 100.0% FT identity in 369 aa overlap. Contains Pfam match to entry FT PF01658 Inos-1-P_synth, Myo-inositol-1-phosphate FT synthase." FT /note="Identical in sequence to ML2692" FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv0046c" FT misc_feature complement(492723..493781) FT /colour=0 FT /note="Pfam match to entry PF01658 Inos-1-P_synth, FT Myo-inositol-1-phosphate synthase, score 558.20, E-value FT 5.3e-164" FT CDS complement(493939..495747) FT /class="III.A" FT /colour=3 FT /gene="ML0397" FT /note="C-terminal half is similar to sugar permeases e.g. FT Escherichia coli AraH, L-arabinose transport system FT permease protein, SW:ARAH_ECOLI (P08532) (329 aa); Fasta FT score E(): 1.1e-26, 36.0% identity in 297 aa overlap. The FT N-terminal half shows weak similarity to other proteins FT containing PAS and DUF9 domains. There is a possiblity FT that this is a signal transduction protein. Previously FT sequenced as TR:Q49739 (EMBL:U00015) (577 aa); Fasta score FT E(): 0, 99.8% identity in 577 aa overlap. Contains FT hydrophobic, possible membrane-spanning regions in the FT C-terminal half. Contains Pfam match to entry PF00989 PAS, FT PAS domain. Contains Pfam match to entry PF00990 DUF9, FT Domain of unknown function. Contains PS01039 Bacterial FT extracellular solute-binding proteins, family 3 FT signature." FT /note="The C-terminal half is similar to ML1419. The FT N-terminal half shows some similarity to ML1750" FT /product="putative transporter protein" FT misc_feature complement(494128..494169) FT /colour=8 FT /note="PS01039 Bacterial extracellular solute-binding FT proteins, family 3 signature" FT misc_feature complement(494854..495348) FT /colour=0 FT /note="Pfam match to entry PF00990 DUF9, Domain of unknown FT function, score 238.20, E-value 1.1e-67" FT misc_feature complement(495592..495717) FT /colour=0 FT /note="Pfam match to entry PF00989 PAS, PAS domain, score FT 32.10, E-value 2.8e-07" FT CDS complement(496060..497097) FT /class="III.A" FT /colour=3 FT /gene="ML0398" FT /note="Similar to many D-ribose-binding proteins e.g. FT Bacillus subtilis rbsB, D-ribose-binding protein FT precursor, SW:RBSB_BACSU (P36949) (305 aa); Fasta score FT E(): 2e-16, 32.6% identity in 273 aa overlap. Previously FT sequenced as TR:Q49738 (EMBL:U00015) (345 aa); Fasta score FT E(): 0, 100.0% identity in 345 aa overlap. Contains FT probable N-terminal signal sequence. Contains Pfam match FT to entry PF00532 Peripla_BP_like, Periplasmic binding FT proteins and sugar binding domain of the LacI family.." FT /product="putative D-ribose-binding protein" FT misc_feature complement(496240..496995) FT /colour=0 FT /note="Pfam match to entry PF00532 Peripla_BP_like, FT Periplasmic binding proteins and sugar binding domain of FT the LacI family., score 23.60, E-value 3.4e-07" FT RBS complement(497104..497109) FT /note="possible RBS" FT CDS 497357..498001 FT /class="V" FT /colour=0 FT /gene="ML0399" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3395c (Best blastx score 208)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT CDS 498082..499157 FT /class="V" FT /colour=0 FT /gene="ML0400" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3394c (Best blastx score 268)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT CDS complement(499303..499755) FT /class="III.A.4" FT /colour=0 FT /gene="ML0401" FT /note="Possible pseudogene similar to M. tuberculosis FT paralogue phoY2 (Best blastx score 152)" FT /product="phosphate transport system regulator FT (pseudogene)" FT /pseudo FT CDS complement(499941..500372) FT /class="II.C.2" FT /colour=0 FT /gene="ML0402" FT /note="Possible pseudogene similar to M. tuberculosis FT paralogue Rv1758 (Best blastx score 151)" FT /product="putative cutinase (pseudogene)" FT /pseudo FT CDS complement(500826..501747) FT /class="I.F.4" FT /colour=0 FT /gene="iunH" FT /gene="ML0403" FT /note="Possible pseudogene of M. tuberculosis orthologue FT iunH (Best blastx score 213)" FT /product="probable inosine-uridine preferring nucleoside FT (pseudogene)" FT /pseudo FT CDS 501850..502403 FT /class="I.H.2" FT /colour=0 FT /gene="cmaA1" FT /gene="ML0404" FT /note="Possible pseudogene of M. tuberculosis orthologue FT cmaA1 (Best blastx score 278)" FT /product="cyclopropanemycolic acid synthase (pseudogene)" FT /pseudo FT RBS 503199..503204 FT /note="possible RBS" FT CDS 503217..504401 FT /class="V" FT /colour=10 FT /gene="ML0405" FT /note="Similar to M. tuberculosis Rv3616c, conserved FT hypothetical protein, TR:O06267 (EMBL:AL123456) (392 aa); FT Fasta score E(): 0, 62.7% identity in 394 aa overlap and FT to Rv3864, hypothetical protein, TR:P96213 (EMBL:AL123456) FT (402 aa); Fasta score E(): 2.1e-15, 31.0% identity in 410 FT aa overlap. Previously sequenced as TR:Q49722 FT (EMBL:U00015) (394 aa); Fasta score E(): 0, 100.0% FT identity in 394 aa overlap." FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv3616c" FT CDS 504459..504779 FT /class="V" FT /colour=10 FT /gene="ML0406" FT /note="Similar to M. tuberculosis Rv3615c, conserved FT hypothetical protein, TR:O06268 (EMBL:AL123456) (103 aa); FT Fasta score E(): 4.1e-19, 60.9% identity in 92 aa overlap FT and to Rv3865, hypothetical protein, TR:P96212 FT (EMBL:AL123456) (103 aa); Fasta score E(): 0.00022, 31.1% FT identity in 103 aa overlap. Previously sequenced as FT TR:Q49723 (EMBL:U00015) (106 aa); Fasta score E(): 0, FT 100.0% identity in 106 aa overlap." FT /product="conserved hypothetical protein" FT CDS 504793..505443 FT /class="V" FT /colour=10 FT /gene="ML0407" FT /note="Similar to M. tuberculosis Rv3614c, conserved FT hypothetical protein, TR:O06269 (EMBL:AL123456) (184 aa); FT Fasta score E(): 0, 71.5% identity in 186 aa overlap and FT to Rv3867, hypothetical protein, TR:O69732 (EMBL:AL123456) FT (183 aa); Fasta score E(): 2.1e-28, 51.4% identity in 175 FT aa overlap. Previously sequenced as TR:Q49730 FT (EMBL:U00015) (216 aa); Fasta score E(): 0, 100.0% FT identity in 216 aa overlap." FT /note="Similar to ML0056" FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv3614c" FT CDS 505777..506544 FT /class="IV.B.1.b" FT /colour=0 FT /gene="ML0408" FT /note="Possible pseudogene similar to M. tuberculosis FT IS1081 transposase (Best blastx score 140)" FT /product="possible IS1081 transposase (pseudogene)" FT /pseudo FT CDS complement(506861..507532) FT /class="IV.B.1.a" FT /colour=0 FT /gene="ML0409" FT /note="Possible pseudogene similar to M. tuberculosis FT IS6110 transposase (Best blastx score 164)" FT /product="possible IS6110 transposase (pseudogene)" FT /pseudo FT RBS 508310..508315 FT /note="possible RBS" FT misc_feature 508327..508599 FT /colour=0 FT /note="Pfam match to entry PF00934 PE, PE family, score FT 37.90, E-value 4.3e-08" FT CDS 508327..508629 FT /class="IV.C.1.a" FT /colour=6 FT /gene="ML0410" FT /note="Similar to M. tuberculosis PE-family proteins e.g. FT Rv2107, PE-family protein, TR:O33243 (EMBL:AL123456) (98 FT aa); Fasta score E(): 4.7e-08, 44.7% identity in 85 aa FT overlap. Contains Pfam match to entry PF00934 PE, PE FT family." FT /note="Similar to ML0538, ML1183 and ML1414" FT /product="putative PE-family protein" FT RBS 508740..508745 FT /note="possible RBS" FT CDS 508755..509981 FT /class="IV.C.2" FT /colour=6 FT /gene="ML0411" FT /note="Similar to M. tuberculosis PPE-family proteins FT e.g. Rv2108, PPE-family protein, TR:P95315 (EMBL:AL123456) FT (243 aa); Fasta score E(): 5.8e-17, 34.4% identity in 212 FT aa overlap. M. leprae serine-rich antigen (25L) (45 kDa FT protein). Previously sequenced as SW:SRA_MYCLE (Q07297) FT (408 aa); Fasta score E(): 0, 100.0% identity in 408 aa FT overlap. Contains Pfam match to entry PF00823 PPE, PPE FT family." FT /note="Similar to ML0539, ML1182 and ML1991" FT /product="serine-rich antigen" FT misc_feature 508770..509246 FT /colour=0 FT /note="Pfam match to entry PF00823 PPE, PPE family, score FT 281.00, E-value 1.5e-80" FT CDS complement(510369..510981) FT /class="II.C.1" FT /colour=0 FT /gene="lpqD" FT /gene="ML0412" FT /note="Possible pseudogene of M. tuberculosis orthologue FT lpqD (Best blastx score 254)" FT /product="putative lipoprotein (pseudogene)" FT /pseudo FT CDS 511130..511983 FT /class="I.B.7" FT /colour=0 FT /gene="ML0413" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3389c (Best blastx score 301)" FT /product="putative dehydrogenase (pseudogene)" FT /pseudo FT CDS complement(511984..513273) FT /class="III.E" FT /colour=0 FT /gene="otsB2" FT /gene="ML0414" FT /note="Similar to M. tuberculosis otsB2, FT trehalose-6-phosphate phosphatase, TR:O50401 FT (EMBL:AL123456) (391 aa); Fasta score E(): 0, 67.1% FT identity in 425 aa overlap. Similar, except at N-terminus, FT to Arabidopsis thaliana tppB, trehalose-6-phosphate FT phosphatase, TR:O64897 (EMBL:AF007779) (374 aa); Fasta FT score E(): 2.2e-17, 31.1% identity in 315 aa overlap. FT Previously sequenced as TR:Q49734 (EMBL:U00015) (429 aa); FT Fasta score E(): 0, 100.0% identity in 429 aa overlap. FT Contains PS00402 Binding-protein-dependent transport FT systems inner membrane comp sign.." FT /product="putative trehalose-6-phosphate phosphatase" FT /tb_orthologue="otsB2" FT misc_feature complement(512485..512571) FT /colour=8 FT /note="PS00402 Binding-protein-dependent transport systems FT inner membrane comp sign." FT CDS complement(513499..514618) FT /class="V" FT /colour=0 FT /gene="ML0415" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3371c (Best blastx score 169)" FT /product="conserved hypothetical protein (pseudogene)" FT /pseudo FT CDS 514919..517123 FT /class="II.A.5" FT /colour=0 FT /gene="dnaE2" FT /gene="ML0416" FT /note="Possible pseudogene of M. tuberculosis orthologue FT dnaE2 (Best blastx score 538)" FT /product="DNA polymerase III [alpha] chain (pseudogene)" FT /pseudo FT CDS complement(517299..517583) FT /class="V" FT /colour=0 FT /gene="ML0417" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3369 (Best blastx score 151)" FT /product="conserved hypothetical protein (pseudogene)" FT /pseudo FT CDS 517644..518276 FT /class="I.B.7" FT /colour=7 FT /gene="ML0418" FT /note="Similar to M. tuberculosis Rv3368c, conserved FT hypothetical protein, TR:O50397 (EMBL:AL123456) (214 aa); FT Fasta score E(): 0, 81.9% identity in 210 aa overlap. FT Shows weak similarity Thermus aquaticus nox, NADH FT dehydrogenase, SW:NOX_THETH (X60110) (205 aa); Fasta score FT E(): 0.00023, 28.8% identity in 212 aa overlap. Previously FT sequenced as TR:O07697 (EMBL:Z97179) (210 aa); Fasta score FT E(): 0, 99.5% identity in 210 aa overlap. Contains Pfam FT match to entry PF00881 Nitroreductase, Nitroreductase FT family. Contains PS00402 Binding-protein-dependent FT transport systems inner membrane comp sign.." FT /product="putative oxidoreductase" FT /tb_orthologue="Rv3368c" FT misc_feature 517680..518150 FT /colour=0 FT /note="Pfam match to entry PF00881 Nitroreductase, FT Nitroreductase family, score 146.20, E-value 5.9e-40" FT misc_feature 518109..518195 FT /colour=8 FT /note="PS00402 Binding-protein-dependent transport systems FT inner membrane comp sign." FT CDS complement(518414..518890) FT /class="II.A.7" FT /colour=2 FT /gene="ML0419" FT /note="Similar to M. tuberculosis spoU, Rv3366, possible FT RNA methyltransferase, TR:O50394 (EMBL:AL123456) (154 aa); FT Fasta score E(): 0, 83.8% identity in 154 aa overlap. FT Shows weak similarity to Escherichia coli spoU, tRNA FT (guanosine-2'-o-)-methyltransferase, SW:TRMH_ECOLI FT (P19396) (229 aa); Fasta score E(): 4e-05, 30.4% identity FT in 148 aa overlap. Similar to many hypothetical RNA FT methyltranferases. Previously sequenced as TR:O07698 FT (EMBL:Z97179) (169 aa); Fasta score E(): 0, 100.0% FT identity in 158 aa overlap. Contains Pfam match to entry FT PF00588 SpoU_methylase, SpoU rRNA Methylase family." FT /product="putative tRNA/rRNA methyltransferase" FT /tb_orthologue="spoU" FT misc_feature complement(518453..518878) FT /colour=0 FT /note="Pfam match to entry PF00588 SpoU_methylase, SpoU FT rRNA Methylase family, score 120.50, E-value 3.1e-32" FT CDS 519275..521679 FT /class="V" FT /colour=0 FT /gene="ML0420" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3365c (Best blastx score 540)" FT /product="conserved hypothetical protein (pseudogene)" FT /pseudo FT CDS 521734..522126 FT /class="V" FT /colour=0 FT /gene="ML0421" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3364c (Best blastx score 181)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT CDS 522247..522813 FT /class="V" FT /colour=0 FT /gene="ML0422" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3362c (Best blastx score 425)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT CDS 522864..523111 FT /class="V" FT /colour=0 FT /gene="ML0423" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv3361c (Best blastx score 162)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT repeat_region 523180..523810 FT /note="Dispersed repeat, RLEP, copy 7" FT /label=RLEP FT /colour=5 FT CDS complement(523803..524288) FT /class="III.F" FT /colour=0 FT /gene="bcp" FT /gene="ML0424" FT /note="Similar to M. tuberculosis bcp, Rv2521, FT bacterioferritin comigratory protein, TR:O5322 FT (EMBL:AL123456) (157 aa); Fasta score E(): 0, 79.6% FT identity in 157 aa overlap. Similar to many members of the FT AhpC/TSA family, suggesting a protective, antioxidant FT role. e.g. shows similarity to Sedum lineare prxQ, FT peroxiredoxin Q, TR:BAA90524 (EMBL:AB037598) (186 aa); FT Fasta score E(): 3e-17, 40.0% identity in 155 aa overlap FT and weak similarity to Mus musculus tdpX1, thioredoxin FT peroxidase 1, SW:TDX1_MOUSE (Q61171) (343 aa); BlastP FT Expect 8.8. Previously sequenced as TR:O07705 FT (EMBL:Z97179) (161 aa); Fasta score E(): 0, 99.4% identity FT in 161 aa overlap. Contains Pfam match to entry PF00578 FT AhpC-TSA, AhpC/TSA family." FT /product="putative antioxidant protein" FT /tb_orthologue="bcp" FT misc_feature complement(523827..524264) FT /colour=0 FT /note="Pfam match to entry PF00578 AhpC-TSA, AhpC/TSA FT family, score 117.20, E-value 3.1e-31" FT RBS complement(524293..524297) FT /note="possible RBS" FT RBS 524403..524407 FT /note="possible RBS" FT CDS 524416..524643 FT /class="II.C.4" FT /colour=3 FT /gene="ML0425" FT /note="Similar to M. tuberculosis Rv2520c, hypothetical FT protein, TR:O53225 (EMBL:AL123456) (75 aa); Fasta score FT E(): 2.2e-15, 57.3% identity in 75 aa overlap. Previously FT sequenced as TR:O07706 (EMBL:Z97179) (91 aa); Fasta score FT E(): 7.9e-29, 100.0% identity in 75 aa overlap. Contains FT hydrophobic, possible membrane-spanning region." FT /product="putative membrane protein" FT tRNA complement(524675..524750) FT /colour=4 FT /note="tRNA Lys anticodon CTT, Cove score 84.12" FT /gene="lysU" FT CDS 524929..526143 FT /class="II.C.2" FT /colour=3 FT /gene="lppS" FT /gene="ML0426" FT /note="Similar to M. tuberculosis lppS, Rv2518c, putative FT lipoprotein, TR:O53223 (EMBL:AL021185) (408 aa); Fasta FT score E(): 0, 82.6% identity in 403 aa overlap. Does not FT contain a predicted membrane lipoprotein lipid attachment FT site (present in lppS), but does contain a possible FT N-terminal signal sequence. Similar to many predicted FT lipoproteins from Streptomyces coelicolor. Previously FT sequenced as TR:O07707 (EMBL:Z97179) (407 aa); Fasta score FT E(): 0, 100.0% identity in 404 aa overlap." FT /note="Similar to ML0569, ML2446 and ML2664" FT /product="putative secreted protein" FT /tb_orthologue="lppS" FT tRNA complement(526168..526243) FT /colour=4 FT /note="tRNA His anticodon GTG, Cove score 82.48" FT /gene="hisT" FT CDS complement(526294..526941) FT /EC_number="3.1.-.-" FT /class="II.B.1" FT /colour=7 FT /gene="ML0427" FT /note="Similar to M. tuberculosis orn, Rv2511, putative FT oligoribonuclease, SW:ORN_MYCTU (O06174) (215 aa); Fasta FT score E(): 0, 84.5% identity in 213 aa overlap. Similar to FT many e..g Escherichia coli orn, oligoribonuclease, FT SW:ORN_ECOLI (P39287) (180 aa); Fasta score E(): 8.2e-25, FT 45.3% identity in 172 aa overlap. Previously sequenced as FT SW:ORN_MYCLE (O07708) (215 aa); Fasta score E(): 0, 99.5% FT identity in 215 aa overlap." FT /product="putative oligoribonuclease" FT /tb_orthologue="Rv2511" FT CDS 527082..528557 FT /class="V" FT /colour=0 FT /gene="ML0428" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv2510c (Best blastx score 399)" FT /product="conserved hypothetical protein (pseudogene)" FT /pseudo FT CDS complement(528621..529427) FT /class="I.B.7" FT /colour=7 FT /gene="ML0429" FT /note="Similar to M. tuberculosis Rv2509, putative FT oxidoreductase, TR:O06172 (EMBL:AL123456) (268 aa); Fasta FT score E(): 0, 88.8% identity in 267 aa overlap. Similar to FT many putative dehydrogenases. Previously sequenced as FT TR:O07709 (EMBL:Z97179) (268 aa); Fasta score E(): 0, FT 100.0% identity in 268 aa overlap. Contains Pfam match to FT entry PF00106 adh_short, short chain dehydrogenase. FT Contains PS00061 Short-chain dehydrogenases/reductases FT family signature." FT /product="putative oxidoreductase" FT /tb_orthologue="Rv2509" FT misc_feature complement(528849..529400) FT /colour=0 FT /note="Pfam match to entry PF00106 adh_short, short chain FT dehydrogenase, score 103.40, E-value 4.3e-27" FT misc_feature complement(528912..528998) FT /colour=8 FT /note="PS00061 Short-chain dehydrogenases/reductases FT family signature" FT CDS 529520..530884 FT /class="II.C.4" FT /colour=3 FT /gene="ML0430" FT /note="Similar to M. tuberculosis Rv2508c, putative FT membrane protein, TR:O06171 (EMBL:AL123456) (445 aa); FT Fasta score E(): 0, 75.7% identity in 441 aa overlap. Also FT similar to Streptomyces coelicolor SC6D7.19C, putative FT integral membrane protein, TR:Q9RKX9 (EMBL:AL133213) (486 FT aa); Fasta score E(): 1.5e-13, 29.7% identity in 445 aa FT overlap. Previously sequenced as TR:O07710 (EMBL:Z97179) FT (464 aa); Fasta score E(): 0, 100.0% identity in 454 aa FT overlap. Contains hydrophobic, possible membrane-spanning FT regions." FT /product="putative membrane protein" FT /tb_orthologue="Rv2508c" FT CDS complement(530916..531695) FT /class="II.C.4" FT /colour=3 FT /gene="ML0431" FT /note="Similar to M. tuberculosis Rv2507, putative FT membrane protein, TR:O06170 (EMBL:AL123456) (273 aa); FT Fasta score E(): 0, 60.4% identity in 275 aa overlap. FT Previously sequenced as TR:O07711 (EMBL:Z97179) (261 aa); FT Fasta score E(): 0, 100.0% identity in 259 aa overlap. FT Contains hydrophobic, possible membrane-spanning regions." FT /product="putative membrane protein" FT /tb_orthologue="Rv2507" FT RBS complement(531699..531704) FT /note="possible RBS" FT CDS complement(531814..532464) FT /class="I.J.1" FT /colour=0 FT /gene="ML0432" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv2506 (Best blastx score 173)" FT /product="transcriptional regulator (TetR/AcrR family) FT (pseudogene)" FT /pseudo FT CDS 532614..533912 FT /class="I.A.3" FT /colour=0 FT /gene="fadD35" FT /gene="ML0433" FT /note="Possible pseudogene of M. tuberculosis orthologue FT fadD35 (Best blastx score 403)" FT /product="acyl-CoA synthase (pseudogene)" FT /pseudo FT CDS 534033..534710 FT /class="I.A.3" FT /colour=0 FT /gene="scoA" FT /gene="ML0434" FT /note="Possible pseudogene of M. tuberculosis orthologue FT scoA (Best blastx score 439)" FT /product="3-oxo acid:CoA transferase, [alpha] subunit FT (pseudogene)" FT /pseudo FT CDS 534769..535414 FT /class="I.A.3" FT /colour=0 FT /gene="scoB" FT /gene="ML0435" FT /note="Possible pseudogene of M. tuberculosis orthologue FT scoB (Best blastx score 465)" FT /product="3-oxo acid:CoA transferase, [beta] subunit FT (pseudogene)" FT /pseudo FT CDS 535414..537000 FT /class="I.A.3" FT /colour=0 FT /gene="accD1" FT /gene="ML0436" FT /note="Possible pseudogene of M. tuberculosis orthologue FT accD1 (Best blastx score 396)" FT /product="acetyl/propionyl-CoA carboxylase, [beta] subunit FT (pseudogene)" FT /pseudo FT CDS 537009..538544 FT /class="I.A.3" FT /colour=0 FT /gene="accA1" FT /gene="ML0437" FT /note="Possible pseudogene of M. tuberculosis orthologue FT accA1 (Best blastx score 865)" FT /product="acetyl/propionyl-CoA carboxylase, [alpha] FT subunit (pseudogene)" FT /pseudo FT CDS 538598..539715 FT /class="I.A.3" FT /colour=0 FT /gene="fadE19" FT /gene="ML0438" FT /note="Possible pseudogene of M. tuberculosis orthologue FT fadE19 (Best blastx score 346)" FT /product="acyl-CoA dehydrogenase (aka mmgC) (pseudogene)" FT /pseudo FT CDS 539670..540204 FT /class="I.B.7" FT /colour=0 FT /gene="ML0439" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv2499c (Best blastx score 164)" FT /product="putative aldehyde dehydrogenase (pseudogene)" FT /pseudo FT CDS 540204..540782 FT /class="I.B.3" FT /colour=0 FT /gene="citE" FT /gene="ML0440" FT /note="Possible pseudogene of M. tuberculosis orthologue FT citE (Best blastx score 389)" FT /product="citrate lyase [beta] chain (pseudogene)" FT /pseudo FT CDS 540802..541460 FT /class="I.B.2" FT /colour=0 FT /gene="pdhA" FT /gene="ML0441" FT /note="Possible pseudogene of M. tuberculosis orthologue FT pdhA (Best blastx score 325)" FT /product="pyruvate dehydrogenase E1 component [alpha] FT subunit (pseudogene)" FT /pseudo FT CDS 541506..542532 FT /class="I.B.2" FT /colour=0 FT /gene="pdhB" FT /gene="ML0442" FT /note="Possible pseudogene of M. tuberculosis orthologue FT pdhB (Best blastx score 387)" FT /product="pyruvate dehydrogenase E1 component [beta] FT subunit (pseudogene)" FT /pseudo FT CDS 542561..543749 FT /class="I.B.2" FT /colour=0 FT /gene="pdhC" FT /gene="ML0443" FT /note="Possible pseudogene of M. tuberculosis orthologue FT pdhC (Best blastx score 324)" FT /product="dihydrolipoamide acetyltransferase (pseudogene)" FT /pseudo FT CDS complement(544151..545199) FT /class="II.A.5" FT /colour=0 FT /gene="ML0444" FT /note="Possible pseudogene similar to M. tuberculosis FT paralogue Rv0071 (Best blastx score 239)" FT /product="group II intron maturase (pseudogene)" FT /pseudo FT repeat_unit complement(544404..545582) FT /note="1179 bp 100% identical to region 2003855..2005033" FT CDS complement(546027..546564) FT /class="IV.B.2" FT /colour=0 FT /gene="ML0445" FT /note="Possible pseudogene of M. tuberculosis REP-family FT protein (Best blastx score 218)" FT /product="REP-family protein (pseudogene)" FT /pseudo FT CDS complement(546688..547132) FT /class="I.A.3" FT /colour=0 FT /gene="ML0446" FT /note="Possible pseudogene similar to M. tuberculosis FT paralogue echA14 (Best blastx score 194)" FT /product="enoyl-CoA hydratase/isomerase superfamily FT (pseudogene)" FT /pseudo FT repeat_unit complement(547228..547967) FT /note="740 bp 100% identical to region 2562936..2563675" FT CDS 547312..547788 FT /class="V" FT /colour=10 FT /gene="ML0447" FT /note="Similar to region of cytochrome P450s e.g. Bacillus FT megaterium CYP102A1, cytochrome P450(BM-3), SW:CPXB_BACME FT (P14779) (1048 aa); Fasta score E(): 0.00033, 31.8% FT identity in 132 aa overlap. previously sequenced as FT TR:O07142 (EMBL:Z96801) (126 aa); Fasta score E(): 0, FT 99.2% identity in 126 aa overlap." FT /product="hypothetical protein" FT CDS 547992..548264 FT /class="VI" FT /colour=8 FT /gene="ML0448" FT /note="Unknown function. Previously sequenced as TR:O07143 FT (EMBL:Z96801) (90 aa); Fasta score E(): 0, 100.0% identity FT in 90 aa overlap." FT /product="hypothetical protein" FT CDS complement(549366..550149) FT /class="I.H.1" FT /colour=0 FT /gene="tesB2" FT /gene="ML0449" FT /note="Possible pseudogene of M. tuberculosis orthologue FT tesB2 (Best blastx score 159)" FT /product="thioesterase II (pseudogene)" FT /pseudo FT CDS complement(550193..551116) FT /class="I.G.6" FT /colour=7 FT /gene="ML0450" FT /note="Similar to M. tuberculosis Rv2606c, hypothetical FT protein, SW:YQ06_MYCTU (O06208) (299 aa); Fasta score E(): FT 0, 89.7% identity in 291 aa overlap. Highly conserved in FT both bacteria and eukaryotes. Similar to Emericella FT nidulans pyroA, pyridoxine biosynthesis protein, TR:Q9UW83 FT (EMBL:AF133101) (304 aa); Fasta score E(): 0, 65.9% FT identity in 299 aa overlap. Previously sequenced as FT SW:YQ06_MYCLE (O07145) (333 aa); Fasta score E(): 0, FT 100.0% identity in 307 aa overlap. Contains Pfam match to FT entry PF01680 UPF0019, Uncharacterized protein family SNZ. FT Contains PS01235 Uncharacterized protein family UPF0019 FT signature." FT /product="putative pyridoxine biosynthesis protein" FT /tb_orthologue="Rv2606c" FT misc_feature complement(550409..550465) FT /colour=8 FT /note="PS01235 Uncharacterized protein family UPF0019 FT signature" FT misc_feature complement(550442..551062) FT /colour=0 FT /note="Pfam match to entry PF01680 UPF0019, FT Uncharacterized protein family SNZ, score 443.10, E-value FT 2.4e-129" FT CDS complement(551191..552240) FT /class="V" FT /colour=10 FT /gene="ML0451" FT /note="Similar to M. tuberculosis Rv2609c, conserved FT hypothetical protein, TR:O06205 (EMBL:AL123456) (351 aa); FT Fasta score E(): 0, 77.7% identity in 336 aa overlap. FT Similar, in part, to hypothetical proteins from FT Streptomyces coelicolor e.g. SC2E1.17, hypothetical FT protein, TR:O69888 (EMBL:AL023797) (172 aa); Fasta score FT E(): 2e-13, 43.3% identity in 150 aa overlap. Previously FT sequenced as TR:O07146 (EMBL:Z96801) (349 aa); Fasta score FT E(): 0, 100.0% identity in 349 aa overlap. Contains FT PS00893 mutT domain signature." FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv2609c" FT misc_feature complement(551545..551604) FT /colour=8 FT /note="PS00893 mutT domain signature" FT CDS complement(552240..553364) FT /class="IV.H" FT /colour=7 FT /gene="ML0452" FT /note="Similar to M. tuberculosis Rv2610c putative FT glycosyltransferase, TR:O06204 (EMBL:AL123456) (378 aa); FT Fasta score E(): 0, 82.3% identity in 378 aa overlap. FT Similar to Synechococcus sp. sqdX, required for FT biosynthesis of the sulfolipid FT sulfoquinovosyldiacylglycerol, TR:Q9R6U1 (EMBL:U45308) FT (377 aa); Fasta score E(): 6.9e-12, 25.9% identity in 390 FT aa overlap and to CDS from the Bordetella parapertussis FT ipopolysaccharide biosynthesis locus e.g. wlbH, putative FT glcNac transferase, TR:O52848 (EMBL:AJ224768) (390 aa); FT Fasta score E(): 6.1e-12, 27.3% identity in 392 aa FT overlap. Previously sequenced as TR:O07147 (EMBL:Z96801) FT (374 aa); Fasta score E(): 0, 100.0% identity in 374 aa FT overlap. Contains Pfam match to entry PF00534 FT Glycos_transf_1, Glycosyl transferases group 1. Contains FT PS00017 ATP/GTP-binding site motif A (P-loop)." FT /note="Show weak similarity to ML0886, ML1715 and ML2443" FT /product="putative glycosyltransferase" FT /tb_orthologue="Rv2610c" FT misc_feature complement(552336..552800) FT /colour=0 FT /note="Pfam match to entry PF00534 Glycos_transf_1, FT Glycosyl transferases group 1, score 113.20, E-value FT 2.7e-30" FT misc_feature complement(552795..552818) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT CDS complement(553374..554336) FT /class="V" FT /colour=10 FT /gene="ML0453" FT /note="Similar to M. tuberculosis Rv2611c, conserved FT hypothetical protein, TR:O06203 (EMBL:AL123456) (316 aa); FT Fasta score E(): 0, 71.5% identity in 312 aa overlap. FT Shows weak similarity to putative acyltransferases e.g. FT Campylobacter jejuni lipid A biosynthesis acyltransferase, FT TR:AAF31766 (EMBL:AF130984) (295 aa); Fasta score E(): FT 0.00017, 20.0% identity in 180 aa overlap. previously FT sequenced as TR:O07148 (EMBL:Z96801) (320 aa); Fasta score FT E(): 0, 99.7% identity in 320 aa overlap." FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv2611c" FT CDS complement(554333..555052) FT /class="I.H.3" FT /colour=1 FT /gene="pgsA" FT /gene="ML0454" FT /note="Similar to M. tuberculosis pgsA, Rv2612c, putative FT CDP-alcohol phosphatidyltransferases, TR:O06202 FT (EMBL:AL123456) (217 aa); Fasta score E(): 0, 79.3% FT identity in 213 aa overlap. Shows weak similarity to FT Escherichia coli pgsA, FT CDP-diacylglycerol--glycerol-3-phosphate FT 3-phosphatidyltransferase, SW:PGSA_ECOLI (P06978) (738 FT aa); BlastP Expect 8.6. Previously sequenced as TR:O07149 FT (EMBL:Z96801) (239 aa); Fasta score E(): 0, 100.0% FT identity in 239 aa overlap. Contains Pfam match to entry FT PF01066 CDP-OH_P_transf, CDP-alcohol FT phosphatidyltransferase. Contains PS00379 CDP-alcohol FT phosphatidyltransferases signature." FT /product="putative phosphatidyltransferase" FT /tb_orthologue="pgsA" FT misc_feature complement(554447..554881) FT /colour=0 FT /note="Pfam match to entry PF01066 CDP-OH_P_transf, FT CDP-alcohol phosphatidyltransferase, score 103.60, E-value FT 3.9e-27" FT misc_feature complement(554774..554842) FT /colour=8 FT /note="PS00379 CDP-alcohol phosphatidyltransferases FT signature" FT CDS complement(555049..555669) FT /class="V" FT /colour=10 FT /gene="ML0455" FT /note="Similar to M. tuberculosis Rv2613c, conserved FT hypothetical protein, TR:O06201 (EMBL:AL123456) (195 aa); FT Fasta score E(): 0, 84.7% identity in 196 aa overlap. FT Similar to many HIT-family hypothetical proteins. FT Previously sequenced as TR:O07150 (EMBL:Z96801) (186 aa); FT Fasta score E(): 0, 100.0% identity in 186 aa overlap. FT Contains Pfam match to entry PF01230 HIT, HIT family." FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv2613c" FT misc_feature complement(555196..555507) FT /colour=0 FT /note="Pfam match to entry PF01230 HIT, HIT family, score FT 45.80, E-value 9.3e-10" FT CDS complement(555662..557770) FT /EC_number="6.1.1.3" FT /class="II.A.3" FT /colour=2 FT /gene="thrS" FT /gene="ML0456" FT /note="Similar to M. tuberculosis thrS, Rv2614c, FT threonyl-tRNA synthetase, SW:SYT_MYCTU (O06200) (692 aa); FT Fasta score E(): 0, 84.0% identity in 702 aa overlap. FT Similar to many e.g. Thermus aquaticus thrS, threonyl-tRNA FT synthetase, SW:SYT_THETH (P56881) (659 aa); Fasta score FT E(): 0, 45.0% identity in 645 aa overlap. Previously FT sequenced as SW:SYT_MYCLE (O07151) (702 aa); Fasta score FT E(): 0, 100.0% identity in 702 aa overlap. Contains Pfam FT match to entry PF00587 tRNA-synt_2b, tRNA synthetase class FT II (G, H, P, S and T). Contains PS00339 Aminoacyl-transfer FT RNA synthetases class-II signature 2. Contains PS00179 FT Aminoacyl-transfer RNA synthetases class-II signature 1." FT /product="threonyl-tRNA synthetase" FT /tb_orthologue="thrS" FT misc_feature complement(555767..556945) FT /colour=0 FT /note="Pfam match to entry PF00587 tRNA-synt_2b, tRNA FT synthetase class II (G, H, P, S and T), score 245.80, FT E-value 5.8e-70" FT misc_feature complement(556046..556075) FT /colour=8 FT /note="PS00339 Aminoacyl-transfer RNA synthetases class-II FT signature 2" FT misc_feature complement(556472..556537) FT /colour=8 FT /note="PS00179 Aminoacyl-transfer RNA synthetases class-II FT signature 1" FT CDS complement(557908..558313) FT /class="V" FT /colour=0 FT /gene="ML0457" FT /note="Possible pseudogene similar to M. tuberculosis FT Rv0356c (Best blastx score 97)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT CDS complement(558363..559268) FT /class="I.B.7" FT /colour=7 FT /gene="ML0458" FT /note="Similar to putative oxidoreductases from both FT bacteria and eukaryotes e.g. Schizosaccharomyces pombe FT SPBC215.11C, putative aldo-keto reductase, TR:O94315 FT (EMBL:AL033534) (306 aa); Fasta score E(): 0, 53.5% FT identity in 288 aa overlap. Previously sequenced as FT TR:O07152 (EMBL:Z96801) (306 aa); Fasta score E(): 0, FT 100.0% identity in 301 aa overlap. Contains 2 Pfam matches FT to entry PF00248 aldo_ket_red, Aldo/keto reductase FT family." FT /product="putative oxidoreductase" FT misc_feature complement(558378..558602) FT /colour=0 FT /note="Pfam match to entry PF00248 aldo_ket_red, Aldo/keto FT reductase family, score 14.70, E-value 0.0036" FT misc_feature complement(558741..558779) FT /colour=0 FT /note="Pfam match to entry PF00248 aldo_ket_red, Aldo/keto FT reductase family, score 1.00, E-value 28" FT CDS 559293..559666 FT /class="V" FT /colour=0 FT /gene="ML0459" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv2616 (Best blastx score 154)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT CDS complement(559771..559989) FT /class="V" FT /colour=0 FT /gene="ML0460" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv2617c (Best blastx score 163)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT CDS 560205..560551 FT /class="V" FT /colour=0 FT /gene="ML0461" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv2618 (Best blastx score 222)" FT /product="conserved hypothetical protein (pseudogene)" FT /pseudo FT CDS complement(561078..561563) FT /class="V" FT /colour=0 FT /gene="ML0462" FT /note="Possible pseudogene similar to M. tuberculosis FT Rv0021c (Best blastx score 169)" FT /product="conserved hypothetical protein (pseudogene)" FT /pseudo FT CDS complement(561579..561828) FT /class="V" FT /colour=0 FT /gene="ML0463" FT /note="Possible pseudogene similar to M. tuberculosis FT Rv2619c (Best blastx score 147)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT CDS 561808..562095 FT /class="VI" FT /colour=8 FT /gene="ML0464" FT /note="Unknown function. Previously sequenced as TR:O07155 FT (EMBL:Z96801) (110 aa); Fasta score E(): 0, 100.0% FT identity in 95 aa overlap." FT /product="hypothetical protein" FT CDS 562650..563430 FT /class="IV.J" FT /colour=0 FT /gene="ML0465" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv1320c (Best blastx score 85)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT CDS 563632..564537 FT /class="II.C.2" FT /colour=3 FT /gene="ML0466" FT /note="Similar to Streptomyces coelicolor SC6A5.23, FT hypothetical protein, TR:Q9X7W9 (EMBL:AL049485) (261 aa); FT Fasta score E(): 9.5e-26, 36.4% identity in 253 aa FT overlap. Previously sequenced as TR:O07156 (EMBL:Z96801) FT (301 aa); Fasta score E(): 0, 99.7% identity in 301 aa FT overlap. Contains a possible N-terminal signal sequence." FT /product="possible secreted protein" FT CDS 564583..565227 FT /class="II.C.4" FT /colour=3 FT /gene="dedA" FT /gene="ML0467" FT /note="Similar to M. tuberculosis dedA, Rv2637, FT dedA-family protein, SW:YQ37_MYCTU (P71936) (218 aa); FT Fasta score E(): 0, 82.8% identity in 209 aa overlap. FT Similar to many dedA-family hypothetical proteins. FT Previously sequenced as SW:YQ37_MYCLE (Q49642) (214 aa); FT Fasta score E(): 0, 100.0% identity in 214 aa overlap. FT Contains hydrophobic, possible membrane-spanning regions. FT Contains Pfam match to entry PF00597 DedA, DedA family." FT /product="putative membrane protein" FT /tb_orthologue="dedA" FT misc_feature 564634..565119 FT /colour=0 FT /note="Pfam match to entry PF00597 DedA, DedA family, FT score 48.10, E-value 2e-10" FT CDS complement(566057..566839) FT /class="II.C.4" FT /colour=3 FT /gene="ML0468" FT /note="Similar to bacterial hypothetical proteins e.g. FT Aeropyrum pernix APE0183, hypothetical protein, TR:Q9YFR6 FT (EMBL:AP000058) (270 aa); Fasta score E(): 7.2e-07, 26.2% FT identity in 256 aa overlap. Contains hydrophobic, possible FT membrane-spanning regions." FT /product="putative membrane protein" FT CDS 567986..569438 FT /class="I.A.3" FT /colour=0 FT /gene="ML0469" FT /note="Possible pseudogene similar to M. tuberculosis FT fadD13 (Best blastx score 97)" FT /product="acyl-CoA synthase (pseudogene)" FT /pseudo FT CDS complement(571603..571893) FT /class="VI" FT /colour=8 FT /gene="ML0470" FT /note="Unknown function. Previously sequenced as TR:O07161 FT (EMBL:Z96801) (96 aa); Fasta score E(): 0, 100.0% identity FT in 96 aa overlap." FT /product="hypothetical protein" FT CDS 573279..573918 FT /class="III.A.2" FT /colour=0 FT /gene="ML0471" FT /note="Possible ferrous iron transport protein pseudogene" FT /product="ferrous iron transport protein (pseudogene)" FT /pseudo FT CDS 574032..574274 FT /class="VI" FT /colour=8 FT /gene="ML0472" FT /note="Improbable CDS suggested by GC frameplot and codon FT usage plots. Possibly the remains of a disrupted gene." FT /product="hypothetical protein" FT CDS 574538..574810 FT /class="VI" FT /colour=8 FT /gene="ML0473" FT /note="Improbable CDS suggested by GC frameplot and codon FT usage plots. Possibly the remains of a disrupted gene." FT /product="hypothetical protein" FT CDS 575469..576140 FT /class="V" FT /colour=10 FT /gene="ML0474" FT /note="Similar to M. tuberculosis Rv2604c, conserved FT hypothetical protein, TR:O06210 (EMBL:AL123456) (198 aa); FT Fasta score E(): 0, 82.8% identity in 198 aa overlap. FT Similar to many bacterial hypothetical proteins. Shows FT weak similarity to amidotransferases e.g. Streptomyces FT coelicolor hisH, amidotransferase from histidine FT biosynthetic pathway, SW:HIS5_STRCO (P16249) (213 aa); FT BlastP Expect 9.8. Previously sequenced as TR:Q49637 FT (EMBL:U00011) (219 aa); Fasta score E(): 0, 100.0% FT identity in 219 aa overlap. Contains Pfam match to entry FT PF01174 UPF0030, Uncharacterized protein family UPF0030." FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv2604c" FT misc_feature 575565..576131 FT /colour=0 FT /note="Pfam match to entry PF01174 UPF0030, FT Uncharacterized protein family UPF0030, score 244.20, FT E-value 1.8e-69" FT CDS 576361..577116 FT /class="V" FT /colour=10 FT /gene="ML0475" FT /note="Similar to M. tuberculosis Rv2603c, conserved FT hypothetical protein, SW:YQ03_MYCTU (O33214) (251 aa); FT Fasta score E(): 0, 92.4% identity in 251 aa overlap . FT Similar to many bacterial hypothetical proteins. FT Previously sequenced as SW:YQ03_MYCLE (Q49645) (251 aa); FT Fasta score E(): 0, 100.0% identity in 251 aa overlap. FT Contains Pfam match to entry PF01709 DUF28, Domain of FT unknown function." FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv2603c" FT misc_feature 576373..577077 FT /colour=0 FT /note="Pfam match to entry PF01709 DUF28, Domain of FT unknown function, score 446.90, E-value 1.7e-130" FT CDS complement(577202..579167) FT /class="I.E" FT /colour=0 FT /gene="speE" FT /gene="ML0476" FT /note="Possible pseudogene of M. tuberculosis orthologue FT speE, interrupted by insertion of an RLEP repeat (Best FT blastx score 229)" FT /product="spermidine synthase (pseudogene)" FT /pseudo FT repeat_region 577796..578589 FT /note="Dispersed repeat, RLEP, copy 8" FT /label=RLEP FT /colour=5 FT CDS complement(579203..579570) FT /class="V" FT /colour=0 FT /gene="ML0477" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv2600 (Best blastx score 202)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT CDS complement(579687..580079) FT /class="V" FT /colour=0 FT /gene="ML0478" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv2599 (Best blastx score 115)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT CDS complement(580137..580325) FT /class="V" FT /colour=0 FT /gene="ML0479" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv2598 (Best blastx score 204)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT CDS complement(580453..581050) FT /class="V" FT /colour=0 FT /gene="ML0480" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv2597 (Best blastx score 175)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT CDS 581224..581790 FT /EC_number="3.1.22.4" FT /class="II.A.5" FT /colour=2 FT /gene="ruvC" FT /gene="ML0481" FT /note="Similar to M. tuberculosis ruvC, Rv2594c, crossover FT junction endodeoxyribonuclease, SW:RUVC_MYCTU (Q50627) FT (188 aa); Fasta score E(): 0, 81.5% identity in 184 aa FT overlap. Similar to many e.g. Pseudomonas aeruginosa ruvC, FT crossover junction endodeoxyribonuclease, SW:RUVC_PSEAE FT (Q51424) (174 aa); Fasta score E(): 3.2e-15, 37.8% FT identity in 172 aa overlap. Previously sequenced as FT SW:RUVC_MYCLE (P40834) (188 aa); Fasta score E(): 0, FT 100.0% identity in 188 aa overlap. Contains Pfam match to FT entry PF02075 RuvC, Crossover junction FT endodeoxyribonuclease RuvC. Contains PS01321 Crossover FT junction endodeoxyribonuclease ruvC signature. Contains FT PS00572 Glycosyl hydrolases family 1 active site." FT /product="crossover junction endodeoxyribonuclease" FT /tb_orthologue="ruvC" FT misc_feature 581230..581679 FT /colour=0 FT /note="Pfam match to entry PF02075 RuvC, Crossover FT junction endodeoxyribonuclease RuvC, score 325.40, E-value FT 6.7e-94" FT misc_feature 581266..581292 FT /colour=8 FT /note="PS00572 Glycosyl hydrolases family 1 active site" FT misc_feature 581563..581670 FT /colour=8 FT /note="PS01321 Crossover junction endodeoxyribonuclease FT ruvC signature" FT CDS 581787..582398 FT /class="II.A.5" FT /colour=2 FT /gene="ruvA" FT /gene="ML0482" FT /note="Similar to M. tuberculosis ruvA, Rv2593c, Holliday FT junction DNA helicase, SW:RUVA_MYCTU (Q50628) (196 aa); FT Fasta score E(): 0, 76.4% identity in 203 aa overlap. FT Similar to many e.g. Escherichia coli ruvA, Holliday FT junction DNA helicase, SW:RUVA_ECOLI (P08576) (203 aa); FT Fasta score E(): 7e-14, 32.7% identity in 205 aa overlap. FT Previously sequenced as SW:RUVA_MYCLE (P40832) (203 aa); FT Fasta score E(): 0, 99.5% identity in 203 aa overlap. FT Contains Pfam match to entry PF01330 RuvA, Bacterial DNA FT recombination protein, RuvA." FT /product="Holliday junction DNA helicase component" FT /tb_orthologue="ruvA" FT misc_feature 581820..582386 FT /colour=0 FT /note="Pfam match to entry PF01330 RuvA, Bacterial DNA FT recombination protein, RuvA, score 319.80, E-value FT 3.2e-92" FT CDS 582395..583444 FT /class="II.A.5" FT /colour=2 FT /gene="ruvB" FT /gene="ML0483" FT /note="Similar to M. tuberculosis ruvB, Rv2592c, Holliday FT junction DNA helicase, SW:RUVB_MYCTU (Q50629) (344 aa); FT Fasta score E(): 0, 94.4% identity in 342 aa overlap. FT Similar to many e.g. Escherichia coli ruvB, Holliday FT junction DNA helicase, SW:RUVB_ECOLI (P08577) (336 aa); FT Fasta score E(): 0, 54.1% identity in 329 aa overlap. FT Previously sequenced as SW:RUVB_MYCLE (P40833) (369 aa); FT Fasta score E(): 0, 100.0% identity in 322 aa overlap. FT Contains Pfam match to entry PF00004 AAA, ATPases FT associated with various cellular activities (AAA). FT Contains PS00017 ATP/GTP-binding site motif A (P-loop)." FT /product="Holliday junction helicase component" FT /tb_orthologue="ruvB" FT misc_feature 582569..583156 FT /colour=0 FT /note="Pfam match to entry PF00004 AAA, ATPases associated FT with various cellular activities (AAA), score -14.30, FT E-value 0.00034" FT misc_feature 582584..582607 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT CDS complement(584381..587947) FT /class="I.A.3" FT /colour=1 FT /gene="fadD9" FT /gene="ML0484" FT /note="Similar to M. tuberculosis fadD9, Rv2590, putative FT acyl-CoA synthetase, TR:Q5063 (EMBL:Al123456) (1168 aa); FT Fasta score E(): 0, 68.0% identity in 1178 aa overlap1. FT Similar to acyl-CoA ligases and to domains of FT polyketide/peptide synthetases e.g. Mycobacterium FT smegmatis mps, peptide synthetase, TR:Q9RLP6 FT (EMBL:AJ238027) (5990 aa); Fasta score E(): 0, 37.2% FT identity in 1168 aa overlap. C-terminal half is similar to FT eukaryotic aminoadipate-semialdehyde dehydrogenase e.g. FT Saccharomyces cerevisiae lys2, aminoadipate-semialdehyde FT dehydrogenase large subunit, SW:LYS2_YEAST (P07702) (1392 FT aa); Fasta score E(): 7.1e-18, 25.1% identity in 734 aa FT overlap. Previously sequenced as TR:O69484 (EMBL:AL023591) FT (1174 aa); Fasta score E(): 0, 100.0% identity in 1174 aa FT overlap. Contains Pfam match to entry PF00550 pp-binding, FT Phosphopantetheine attachment site. Contains Pfam match to FT entry PF00501 AMP-binding, AMP-binding enzyme. Contains FT PS00455 Putative AMP-binding domain signature. Contains FT PS00061 Short-chain dehydrogenases/reductases family FT signature." FT /product="putative acyl-CoA synthetase" FT /tb_orthologue="fadD9" FT misc_feature complement(585002..585088) FT /colour=8 FT /note="PS00061 Short-chain dehydrogenases/reductases FT family signature" FT misc_feature complement(585779..585940) FT /colour=0 FT /note="Pfam match to entry PF00550 pp-binding, FT Phosphopantetheine attachment site, score 33.60, E-value FT 1.2e-07" FT misc_feature complement(586286..587638) FT /colour=0 FT /note="Pfam match to entry PF00501 AMP-binding, FT AMP-binding enzyme, score -100.90, E-value 8.7e-10" FT misc_feature complement(587129..587164) FT /colour=8 FT /note="PS00455 Putative AMP-binding domain signature" FT CDS complement(588043..589383) FT /EC_number="2.6.1.19" FT /class="I.C.1" FT /colour=7 FT /gene="gabT" FT /gene="ML0485" FT /note="Similar to M. tuberculosis gabT, Rv2589, FT 4-aminobutyrate aminotransferase, SW:GABT_MYCTU (Q50632) FT (449 aa); Fasta score E(): 0, 83.7% identity in 449 aa FT overlap. Similar to many e.g. Escherichia coli gabT, FT 4-aminobutyrate aminotransferase, SW:GABT_ECOLI (P22256) FT (426 aa); Fasta score E(): 0, 43.1% identity in 422 aa FT overlap. Previously sequenced as SW:GABT_MYCLE (P40829) FT (446 aa); Fasta score E(): 0, 99.8% identity in 446 aa FT overlap. Contains Pfam match to entry PF00202 aminotran_3, FT Aminotransferases class-III pyridoxal-phosphate. Contains FT PS00600 Aminotransferases class-III pyridoxal-phosphate FT attachment site." FT /note="Similar to ML1216, ML1409 and ML2414" FT /product="putative 4-aminobutyrate aminotransferase" FT /tb_orthologue="gabT" FT misc_feature complement(588109..589245) FT /colour=0 FT /note="Pfam match to entry PF00202 aminotran_3, FT Aminotransferases class-III pyridoxal-phosphate, score FT 639.30, E-value 7.7e-222" FT misc_feature complement(588496..588609) FT /colour=8 FT /note="PS00600 Aminotransferases class-III FT pyridoxal-phosphate attachment site" FT RBS complement(589390..589395) FT /note="possible RBS" FT CDS 589652..589996 FT /class="II.C.2" FT /colour=3 FT /gene="ML0486" FT /note="Similar to M. tuberculosis Rv2588c, hypothetical FT protein, SW:YP88_MYCTU (Q50633) (115 aa); Fasta score E(): FT 7e-29, 77.0% identity in 100 aa overlap. Similar to FT bacterial hypothetical proteins e.g. Streptomyces FT coelicolor SCL2.07C, putative secreted protein, FT TR:CAB70919 (EMBL:AL137778) (169 aa); Fasta score E(): FT 7.3e-08, 35.8% identity in 120 aa overlap. Previously FT sequenced as SW:YP88_MYCLE (Q49647) (114 aa); Fasta score FT E(): 0, 100.0% identity in 114 aa overlap. Contains a FT possible N-terminal signal sequence." FT /product="putative secreted protein" FT CDS 590036..591829 FT /class="III.D" FT /colour=3 FT /gene="secD" FT /gene="ML0487" FT /note="Similar to M. tuberculosis secD, Rv2587c, putative FT protein-export membrane protein, SW:SECD_MYCTU (Q50634) FT (573 aa); Fasta score E(): 0, 80.6% identity in 583 aa FT overlap. C-terminal half is similar to the corresponding FT region of Escherichia coli secD, protein-export membrane FT protein, SW:SECD_ECOLI (P19673) (689 aa); BlastP Expect FT 0.42. Shows full length similarity to M. tuberculosis and FT Streptomyces coelicolor homolgues. Previously sequenced as FT SW:SECD_MYCLE (P38387) (571 aa); Fasta score E(): 0, 99.8% FT identity in 571 aa overlap. Contains hydrophobic, possible FT membrane-spanning regions." FT /product="putative protein-export membrane protein" FT /tb_orthologue="secD" FT RBS 591817..591822 FT /note="possible RBS" FT CDS 591834..593249 FT /class="III.D" FT /colour=3 FT /gene="secF" FT /gene="ML0488" FT /note="Similar to M. tuberculosis secF, Rv2586c, putative FT protein-export membrane protein, SW:SECF_MYCTU (Q50635) FT (442 aa); Fasta score E(): 0, 72.1% identity in 456 aa FT overlap. Similar to Escherichia coli secF, protein-export FT membrane protein, SW:SECF_ECOLI (P19674) (189 aa); BlastP FT Expect 8.5. Previously sequenced as SW:SECF_MYCLE (P38386) FT (394 aa); Fasta score E(): 0, 99.7% identity in 394 aa FT overlap. Contains hydrophobic, possible membrane-spanning FT regions." FT /product="putative protein-export membrane protein" FT /tb_orthologue="secF" FT CDS 593294..594961 FT /class="II.C.1" FT /colour=3 FT /gene="ML0489" FT /note="Similar to M. tuberculosis Rv2585c, hypothetical FT protein, SW:YP85_MYCTU (Q50636) (557 aa); Fasta score E(): FT 0, 78.9% identity in 546 aa overlap. Previously sequenced FT as SW:YP85_MYCLE (Q49646) (426 aa); Fasta score E(): 0, FT 98.8% identity in 332 aa overlap. Contains a probable FT N-terminal signal sequence. Contains PS00013 Prokaryotic FT membrane lipoprotein lipid attachment site." FT /product="putative lipoprotein" FT /tb_orthologue="Rv2585c" FT misc_feature 593348..593380 FT /colour=8 FT /note="PS00013 Prokaryotic membrane lipoprotein lipid FT attachment site" FT CDS 594985..595504 FT /class="I.F.4" FT /colour=0 FT /gene="apt" FT /gene="ML0490" FT /note="Possible pseudogene of M. tuberculosis orthologue FT apt (Best blastx score 222)" FT /product="adenine phosphoribosyltransferases (pseudogene)" FT /pseudo FT RBS 595594..595600 FT /note="possible RBS" FT CDS 595607..597970 FT /EC_number="2.7.6.5" FT /class="I.F.5" FT /colour=7 FT /gene="relA" FT /gene="ML0491" FT /note="Similar to M. tuberculosis relA, Rv2583c, putative FT GTP pyrophosphokinase, SW:RELA_MYCTU (Q50638) (790 aa); FT Fasta score E(): 0, 93.4% identity in 790 aa overlap. FT Similar to many e.g. Corynebacterium glutamicum relA, GTP FT pyrophosphokinase, SW:RELA_CORGL (O87331) (760 aa); Fasta FT score E(): 0, 66.0% identity in 756 aa overlap. Previously FT sequenced as SW:RELA_MYCLE (Q49640) (787 aa); Fasta score FT E(): 0, 99.9% identity in 787 aa overlap. Contains a FT probable helix-turn-helix motif at aa 41-62 (Score 1005, FT SD +2.61) Contains Pfam match to entry PF01842 ACT, ACT FT domain." FT /product="putative GTP pyrophosphokinase" FT /tb_orthologue="relA" FT misc_feature 597734..597952 FT /colour=0 FT /note="Pfam match to entry PF01842 ACT, ACT domain, score FT 49.70, E-value 6.3e-11" FT CDS complement(598029..598916) FT /EC_number="5.2.1.8" FT /class="II.A.6" FT /colour=2 FT /gene="ppiB" FT /gene="ML0492" FT /note="Similar to M. tuberculosis ppiB, Rv2582, putative FT peptidyl-prolyl cis-trans isomerase, SW:CYPB_MYCTU FT (Q50639) (308 aa); Fasta score E(): 0, 72.5% identity in FT 295 aa overlap. Shows weak similarity to part of FT Caenorhabditis elegans cvp-1, peptidyl-prolyl cis-trans FT isomerase 1, SW:CYP1_CAEEL (P52009) (192 aa); Fasta score FT E(): 0.00071, 36.4% identity in 165 aa overlap. Previously FT sequenced as SW:CYPB_MYCLE (P46697) (295 aa); Fasta score FT E(): 0, 99.7% identity in 295 aa overlap. Contains FT hydrophobic, possible membrane-spanning region. FT Alternatively, this may represent an N-terminal signal FT sequence, given teh potential start codon at codon 33. FT Contains Pfam match to entry PF00160 pro_isomerase, FT Cyclophilin type peptidyl-prolyl cis-trans isomerase." FT /product="putative peptidyl-prolyl cis-trans isomerase" FT /tb_orthologue="ppiB" FT misc_feature complement(598197..598538) FT /colour=0 FT /note="Pfam match to entry PF00160 pro_isomerase, FT Cyclophilin type peptidyl-prolyl cis-trans isomerase, FT score 42.80, E-value 2.4e-11" FT RBS complement(598927..598931) FT /note="possible RBS" FT CDS 599080..599736 FT /class="IV.I" FT /colour=7 FT /gene="ML0493" FT /note="Similar to M. tuberculosis Rv2581c, hypothetical FT protein, SW:YP81_MYCTU (Q50640) (224 aa); Fasta score E(): FT 0, 82.0% identity in 222 aa overlap. Similar to many FT bacterial hypothetical proteins. Previously sequenced as FT SW:YP81_MYCLE (Q49649) (218 aa); Fasta score E(): 0, 99.5% FT identity in 218 aa overlap. Contains Pfam match to entry FT PF00753 lactamase_B, Metallo-beta-lactamase superfamily." FT /note="Similar to ML1391 and ML1912" FT /product="putative hydrolase" FT /tb_orthologue="Rv2581c" FT misc_feature 599101..599676 FT /colour=0 FT /note="Pfam match to entry PF00753 lactamase_B, FT Metallo-beta-lactamase superfamily, score 169.30, E-value FT 6.3e-47" FT CDS 599740..601023 FT /EC_number="6.1.1.21" FT /class="II.A.3" FT /colour=2 FT /gene="hisS" FT /gene="ML0494" FT /note="Similar to M. tuberculosis hisS, Rv2580c, FT histidyl-tRNA synthase, SW:SYH_MYCTU (Q50641) (423 aa); FT Fasta score E(): 0, 85.9% identity in 417 aa overlap. FT Similar to many e.g. Escherichia coli hisS, histidyl-tRNA FT synthase, SW:SYH_ECOLI (P04804) (423 aa); Fasta score E(): FT 0, 42.1% identity in 413 aa overlap. Previously sequenced FT as SW:SYH_MYCLE (P46696) (427 aa); Fasta score E(): 0, FT 99.5% identity in 427 aa overlap. Contains Pfam match to FT entry PF00587 tRNA-synt_2b, tRNA synthetase class II (G, FT H, P, S and T). Contains PS00017 ATP/GTP-binding site FT motif A (P-loop). Contains PS00211 ABC transporters family FT signature." FT /product="histidyl-tRNA synthase" FT /tb_orthologue="hisS" FT misc_feature 599917..600966 FT /colour=0 FT /note="Pfam match to entry PF00587 tRNA-synt_2b, tRNA FT synthetase class II (G, H, P, S and T), score 292.60, FT E-value 5e-84" FT misc_feature 600691..600714 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature 600748..600792 FT /colour=8 FT /note="PS00211 ABC transporters family signature" FT CDS 601152..601597 FT /class="IV.C.1.b" FT /colour=0 FT /gene="PE_PGRS" FT /gene="ML0495" FT /note="Possible pseudogene similar to M. tuberculosis FT PE_PGRS genes (Best blastx score 176)" FT /product="PE_PGRS-family protein (pseudogene)" FT /pseudo FT CDS 601750..602325 FT /class="V" FT /colour=0 FT /gene="ML0496" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv2578c (Best blastx score 339)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT CDS complement(602342..603849) FT /class="V" FT /colour=0 FT /gene="ML0497" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv2577 (Best blastx score 414)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT CDS 604110..604425 FT /class="V" FT /colour=0 FT /gene="ML0498" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv2576c (Best blastx score 119)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT CDS complement(605196..606015) FT /class="V" FT /colour=0 FT /gene="ML0499" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv2575 (Best blastx score 329)" FT /product="conserved hypothetical protein (pseudogene)" FT /pseudo FT CDS complement(606108..606592) FT /class="V" FT /colour=0 FT /gene="ML0500" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv2573 (Best blastx score 211)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT RBS 606830..606833 FT /note="possible RBS" FT CDS 606839..608608 FT /EC_number="6.1.1.12" FT /class="II.A.3" FT /colour=2 FT /gene="aspS" FT /gene="ML0501" FT /note="Similar to M. tuberculosis aspS, Rv2572c, FT aspartyl-tRNA synthetase, SW:SYD_MYCTU (Q50649) (596 aa); FT Fasta score E(): 0, 88.0% identity in 592 aa overlap. FT Similar to many e.g. Escherichia coli aspS, aspartyl-tRNA FT synthetase, SW:SYD_ECOLI (P21889) (590 aa); Fasta score FT E(): 0, 46.8% identity in 583 aa overlap. Previously FT sequenced as SW:SYD_MYCLE (P36429) (589 aa); Fasta score FT E(): 0, 99.8% identity in 589 aa overlap. Contains Pfam FT match to entry PF00152 tRNA-synt_2, tRNA synthetases class FT II (D, K and N). Contains PS00179 Aminoacyl-transfer RNA FT synthetases class-II signature 1." FT /product="aspartyl-tRNA synthetase" FT /tb_orthologue="aspS" FT misc_feature 607184..608515 FT /colour=0 FT /note="Pfam match to entry PF00152 tRNA-synt_2, tRNA FT synthetases class II (D, K and N), score -4.30, E-value FT 2.1e-11" FT misc_feature 607481..607534 FT /colour=8 FT /note="PS00179 Aminoacyl-transfer RNA synthetases class-II FT signature 1" FT CDS 608647..609029 FT /class="V" FT /colour=0 FT /gene="ML0502" FT /note="Possible pseudogene similar to M. tuberculosis FT Rv1558 (Best blastx score 72)" FT /product="conserved hypothetical protein (pseudogene)" FT /pseudo FT CDS 609984..610358 FT /class="IV.C.2" FT /colour=0 FT /gene="PPE" FT /gene="ML0503" FT /note="Possible pseudogene similar to M. tuberculosis PPE FT genes (Best blastx score 98)" FT /product="PPE-family protein (pseudogene)" FT /pseudo FT CDS complement(611087..612390) FT /class="IV.B.1.c" FT /colour=0 FT /gene="ML0504" FT /note="Possible pseudogene of transposase similar to FT Mycobacterium avium istA (Best blastx score 250)" FT /product="transposase (pseudogene)" FT /pseudo FT CDS complement(612560..613458) FT /class="IV.B.1.c" FT /colour=0 FT /gene="ML0505" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv2424c (Best blastx score 206)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT CDS complement(614636..614999) FT /class="V" FT /colour=0 FT /gene="ML0506" FT /note="Possible pseudogene similar to M. tuberculosis FT Rv2570 (Best blastx score 169)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT CDS 615180..617503 FT /class="V" FT /colour=0 FT /gene="ML0507" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv2567 (Best blastx score 542)" FT /product="conserved hypothetical protein (pseudogene)" FT /pseudo FT CDS 617501..618442 FT /class="V" FT /colour=10 FT /gene="ML0508" FT /note="Similar to M. tuberculosis Rv2569c, conserved FT hypothetical protein, SW:YP69_MYCTU (Q50652) (314 aa); FT Fasta score E(): 0, 84.4% identity in 301 aa overlap and FT to other hypothetical proteins from M. tuberculosis. FT Contains Pfam match to entry PF01841 Transglut_core, FT Transglutaminase-like superfamily." FT /note="Similar to ML0607" FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv2569c" FT misc_feature 618068..618280 FT /colour=0 FT /note="Pfam match to entry PF01841 Transglut_core, FT Transglutaminase-like superfamily, score 80.40, E-value FT 3.6e-20" FT CDS 618435..619450 FT /class="V" FT /colour=0 FT /gene="ML0509" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv2568c (Best blastx score 271)" FT /product="conserved hypothetical protein (pseudogene)" FT /pseudo FT CDS 619666..621087 FT /class="V" FT /colour=10 FT /gene="ML0510" FT /note="Similar to M. tuberculosis Rv2559c, conserved FT hypothetical protein, SW:YP59_MYCT (Q50739) (452 aa); FT Fasta score E(): 0, 83.4% identity in 452 aa overlapU. FT Similar to many hypothetical proteins in bacteria and FT eukaryotes e.g. Escherichia coli ycaJ, hypothetical FT protein, SW:YCAJ_ECOLI (P45526) (447 aa); Fasta score E(): FT 0, 42.7% identity in 417 aa overlap. Previously sequenced FT as TR:O69490 (EMBL:AL023591) (447 aa); Fasta score E(): 0, FT 99.8% identity in 447 aa overlap. Contains Pfam match to FT entry PF00004 AAA, ATPases associated with various FT cellular activities (AAA). Contains PS00017 FT ATP/GTP-binding site motif A (P-loop)." FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv2559c" FT misc_feature 619930..620508 FT /colour=0 FT /note="Pfam match to entry PF00004 AAA, ATPases associated FT with various cellular activities (AAA), score -4.80, FT E-value 6.2e-05" FT misc_feature 619945..619968 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT CDS complement(621128..621842) FT /class="V" FT /colour=0 FT /gene="ML0511" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv2558 (Best blastx score 199)" FT /product="conserved hypothetical protein (pseudogene)" FT /pseudo FT CDS 622159..624885 FT /EC_number="6.1.1.7" FT /class="II.A.3" FT /colour=2 FT /gene="alaS" FT /gene="ML0512" FT /note="Similar to M. tuberculosis alaS, Rv2555c, FT alanyl-tRNA synthetase, SW:SYA_MYCTU (O07438) (904 aa); FT Fasta score E(): 0, 84.7% identity in 907 aa overlap. FT Similar to many e.g. Homo sapiens aarS, alanyl-tRNA FT synthetase, SW:SYA_HUMAN (P49588) (968 aa); Fasta score FT E(): 0, 35.7% identity in 971 aa overlap. Contains Pfam FT match to entry PF01411 tRNA-synt_2c, tRNA synthetases FT class II (A). Contains PS00339 Aminoacyl-transfer RNA FT synthetases class-II signature 2." FT /product="alanyl-tRNA synthetase" FT /tb_orthologue="alaS" FT misc_feature 622171..624849 FT /colour=0 FT /note="Pfam match to entry PF01411 tRNA-synt_2c, tRNA FT synthetases class II (A), score 993.10, E-value 6.5e-295" FT misc_feature 622849..622878 FT /colour=8 FT /note="PS00339 Aminoacyl-transfer RNA synthetases class-II FT signature 2" FT CDS 624886..625440 FT /class="V" FT /colour=10 FT /gene="ML0513" FT /note="Similar to M. tuberculosis Rv2554c, hypothetical FT protein, SW:YP54_MYCTU (P94999) (170 aa); Fasta score E(): FT 0, 72.0% identity in 161 aa overlap. Similar to many FT bacterial hypothetical proteins e.g. Streptomyces FT coelicolor SC9C5.24C, hypothetical protein, TR:CAB93380 FT (EMBL:AL357523) (167 aa); Fasta score E(): 8.9e-25, 54.8% FT identity in 155 aa overlap." FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv2554c" FT RBS 625420..625423 FT /note="possible RBS" FT CDS 625433..626698 FT /class="II.C.4" FT /colour=3 FT /gene="ML0514" FT /note="Similar to M. tuberculosis Rv2553c, hypothetical FT protein, TR:P95000 (EMBL:AL123456) (417 aa); Fasta score FT E(): 0, 72.7% identity in 414 aa overlap. C-terminal half FT is similar to e.g. Streptomyces sphaeroides novB, gene FT from novobiocin biosynthetic gene cluster, TR:AAF67495 FT (EMBL:AF170880) (284 aa); Fasta score E(): 2.5e-22, 40.0% FT identity in 210 aa overlap. Shows full-length similarity FT to other hypothetical proteins e.g. Bacillus subtilis FT yrrL, hypothetical protein, TR:O34758 (EMBL:Z99117) (360 FT aa); Fasta score E(): 2.8e-10, 26.3% identity in 358 aa FT overlap. Contains hydrophobic, possible membrane-spanning FT region near the N-terminus." FT /product="putative membrane protein" FT /tb_orthologue="Rv2553c" FT CDS 626676..627512 FT /class="I.D.4" FT /colour=7 FT /gene="aroE" FT /gene="ML0515" FT /note="Similar to M. tuberculosis aroE, Rv2552c, shikimate FT 5-dehydrogenase, TR:P95001 (EMBL:AL123456) (269 aa); Fasta FT score E(): 0, 81.5% identity in 270 aa overlap. Similar to FT many e.g. Neisseria meningitidis aroE, shikimate FT dehydrogenase, TR:P95388 (EMBL:U82841) (269 aa); Fasta FT score E(): 2.5e-12, 29.6% identity in 274 aa overlap. FT Contains Pfam match to entry PF01488 Shikimate_DH, FT Shikimate / quinate 5-dehydrogenase." FT /product="putative shikimate 5-dehydrogenase" FT /tb_orthologue="aroE" FT misc_feature 626760..627464 FT /colour=0 FT /note="Pfam match to entry PF01488 Shikimate_DH, Shikimate FT / quinate 5-dehydrogenase, score 229.00, E-value 6.9e-65" FT RBS 627730..627733 FT /note="possible RBS" FT CDS 627741..628964 FT /EC_number="4.6.1.4" FT /class="I.D.4" FT /colour=7 FT /gene="aroF" FT /gene="ML0516" FT /note="Similar to M. tuberculosis aroF, Rv2540c, FT chorismate synthase, SW:AROC_MYCTU (P95013) (401 aa); FT Fasta score E(): 0, 88.0% identity in 401 aa overlap. FT Similar to many e.g. Staphylococcus aureus aroC, FT chorismate synthase, SW:AROC_STAAU (Q59803) (388 aa); FT Fasta score E(): 0, 43.1% identity in 383 aa overlap. FT Contains Pfam match to entry PF01264 Chorismate_synt, FT Chorismate synthase. Contains PS00788 Chorismate synthase FT signature 2. Contains PS00789 Chorismate synthase FT signature 3. Contains PS00787 Chorismate synthase FT signature 1." FT /product="putative chorismate synthase" FT /tb_orthologue="aroF" FT misc_feature 627744..628850 FT /colour=0 FT /note="Pfam match to entry PF01264 Chorismate_synt, FT Chorismate synthase, score 695.80, E-value 8.2e-212" FT misc_feature 627762..627809 FT /colour=8 FT /note="PS00787 Chorismate synthase signature 1" FT misc_feature 628140..628184 FT /colour=8 FT /note="PS00788 Chorismate synthase signature 2" FT misc_feature 628761..628811 FT /colour=8 FT /note="PS00789 Chorismate synthase signature 3" FT CDS 628972..629571 FT /EC_number="2.7.1.71" FT /class="I.D.4" FT /colour=7 FT /gene="aroK" FT /gene="ML0517" FT /note="Similar to M. tuberculosis aroK, Rv2539c, shikimate FT kinase, SW:AROK_MYCTU (P95014) (176 aa); Fasta score E(): FT 0, 79.6% identity in 167 aa overlap. Similar to many e.g. FT Escherichia coli aroK, shikimate kinase I, SW:AROK_ECOLI FT (P24167) (172 aa); Fasta score E(): 3.5e-13, 38.0% FT identity in 166 aa overlap. Contains Pfam match to entry FT PF01202 SKI, Shikimate kinase. Contains PS00017 FT ATP/GTP-binding site motif A (P-loop). Contains PS01128 FT Shikimate kinase signature." FT /product="putative shikimate kinase" FT /tb_orthologue="aroK" FT misc_feature 628978..629472 FT /colour=0 FT /note="Pfam match to entry PF01202 SKI, Shikimate kinase, FT score 226.20, E-value 4.9e-64" FT misc_feature 628996..629019 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature 629143..629220 FT /colour=8 FT /note="PS01128 Shikimate kinase signature" FT RBS 629557..629561 FT /note="possible RBS" FT CDS 629568..630653 FT /EC_number="4.6.1.3" FT /class="I.D.4" FT /colour=7 FT /gene="aroB" FT /gene="ML0518" FT /note="Similar to M. tuberculosis aroB, Rv2538c, FT 3-dehydroquinate synthase, SW:AROB_MYCTU (P36919) (362 FT aa); Fasta score E(): 0, 87.3% identity in 361 aa overlap. FT Contains Pfam match to entry PF01761 DHQ_synthase, FT 3-dehydroquinate synthase." FT /product="putative 3-dehydroquinate synthase" FT /tb_orthologue="aroB" FT misc_feature 629628..630638 FT /colour=0 FT /note="Pfam match to entry PF01761 DHQ_synthase, FT 3-dehydroquinate synthase, score 601.80, E-value 4.1e-177" FT CDS 630653..631090 FT /EC_number="4.2.1.10" FT /class="I.D.4" FT /colour=7 FT /gene="aroD" FT /gene="ML0519" FT /note="Similar to M. tuberculosis aroD, 3-dehydroquinate FT dehydratase, SW:AROQ_MYCTU (P36918) (146 aa); Fasta score FT E(): 0, 85.9% identity in 142 aa overlap. Similar to many FT e.g. Corynebacterium pseudotuberculosis aroQ, FT 3-dehydroquinate dehydratase, SW:AROQ_CORPS (P96750) (146 FT aa); Fasta score E(): 6.7e-33, 61.0% identity in 136 aa FT overlap. Contains Pfam match to entry PF01220 FT DHquinase_II, Dehydroquinase class II. Contains PS01029 FT Dehydroquinase class II signature." FT /product="3-dehydroquinate dehydratase" FT /tb_orthologue="aroD" FT misc_feature 630656..631087 FT /colour=0 FT /note="Pfam match to entry PF01220 DHquinase_II, FT Dehydroquinase class II, score 300.70, E-value 1.8e-86" FT misc_feature 630671..630724 FT /colour=8 FT /note="PS01029 Dehydroquinase class II signature" FT CDS complement(631179..631787) FT /class="II.C.4" FT /colour=3 FT /gene="ML0520" FT /note="Similar to M. tuberculosis Rv2536, possible FT membrane protein, TR:P95017 (EMBL:AL123456) (230 aa); FT Fasta score E(): 0, 63.2% identity in 201 aa overlap. FT Contains hydrophobic, possible membrane-spanning regions. FT Contains PS00013 Prokaryotic membrane lipoprotein lipid FT attachment site8." FT /product="putative membrane protein" FT misc_feature complement(631395..631427) FT /colour=8 FT /note="PS00013 Prokaryotic membrane lipoprotein lipid FT attachment site8" FT RBS complement(631792..631795) FT /note="possible RBS" FT CDS 631821..632951 FT /class="II.B.3" FT /colour=7 FT /gene="pepQ" FT /gene="ML0521" FT /note="Similar to M. tuberculosis pepQ, Rv2535c, putative FT cytoplasmic peptidase, TR:P95018 (EMBL:AL123456) (372 aa); FT Fasta score E(): 0, 83.0% identity in 376 aa overlap. FT Similar to many e.g. Pyrococcus furiosus cobalt-dependent FT proline dipeptidase, TR:P81535 (EMBL:AF060010) (348 aa); FT Fasta score E(): 1.6e-29, 33.7% identity in 359 aa FT overlap. Contains Pfam match to entry PF00557 FT Peptidase_M24, metallopeptidase family M24. Contains FT PS00491 Aminopeptidase P and proline dipeptidase FT signature. Contains PS00211 ABC transporters family FT signature." FT /product="putative cytoplasmic peptidase" FT /tb_orthologue="pepQ" FT misc_feature 632217..632906 FT /colour=0 FT /note="Pfam match to entry PF00557 Peptidase_M24, FT metallopeptidase family M24, score 200.70, E-value FT 2.3e-56" FT misc_feature 632454..632498 FT /colour=8 FT /note="PS00211 ABC transporters family signature" FT misc_feature 632694..632732 FT /colour=8 FT /note="PS00491 Aminopeptidase P and proline dipeptidase FT signature" FT RBS 632950..632954 FT /note="possible RBS" FT misc_feature 632967..633521 FT /colour=0 FT /note="Pfam match to entry PF01132 EFP, Elongation factor FT P (EF-P), score 438.40, E-value 6.2e-128" FT CDS 632967..633530 FT /class="II.A.6" FT /colour=2 FT /gene="efp" FT /gene="ML0522" FT /note="Similar to M. tuberculosis efp, Rv2534c, elongation FT factor P, SW:EFP_MYCTU (P95019) (187 aa); Fasta score E(): FT 0, 94.1% identity in 186 aa overlap. Similar to many e.g. FT Brevibacterium lactofermentum efp, elongation factor P, FT SW:EFP_BRELA (X99289) (187 aa); Fasta score E(): 0, 68.8% FT identity in 186 aa overlap. Contains Pfam match to entry FT PF01132 EFP, Elongation factor P (EF-P). Contains PS01275 FT Elongation factor P signature." FT /product="elongation factor P" FT /tb_orthologue="efp" FT misc_feature 633414..633473 FT /colour=8 FT /note="PS01275 Elongation factor P signature" FT CDS 633533..634105 FT /class="II.A.7" FT /colour=2 FT /gene="nusB" FT /gene="ML0523" FT /note="Similar to M. tuberculosis nusB, putative FT transcription termination protein, SW:NUSB_MYCTU (P95020) FT (156 aa); Fasta score E(): 0, 75.7% identity in 148 aa FT overlap. Similar to many e.g. Escherichia coli nusB, N FT utilization substance protein B, protein involved in FT regulation of transcription termination, SW:NUSB_ECOLI FT (P04381) (139 aa); Fasta score E(): 7.4e-08, 38.1% FT identity in 139 aa overlap. Contains Pfam match to entry FT PF01029 NusB, NusB family." FT /product="putative transcription termination protein" FT /tb_orthologue="nusB" FT misc_feature 633551..633943 FT /colour=0 FT /note="Pfam match to entry PF01029 NusB, NusB family, FT score 172.50, E-value 7.2e-48" FT RBS 634630..634636 FT /note="possible RBS" FT CDS 634643..637495 FT /class="I.A.2" FT /colour=7 FT /gene="adi" FT /gene="ML0524" FT /note="Similar to M. tuberculosis adi, Rv2531c, putative FT ornithine/arginine decarboxylase, TR:P95022 FT (EMBL:AL123456) (947 aa); Fasta score E(): 0, 86.4% FT identity in 951 aa overlap. Similar to decarboxylases of FT ornithine and lysine e.g. Escherichia coli speC, ornithine FT decarboxylase, constitutive, SW:DCOR_ECOLI (P21169) (731 FT aa); Fasta score E(): 3e-16, 26.8% identity in 650 aa FT overlap. Contains Pfam match to entry PF01276 OKR_DC_1, FT Orn/Lys/Arg decarboxylase." FT /product="putative amino acid decarboxylase" FT /tb_orthologue="adi" FT misc_feature 635513..637351 FT /colour=0 FT /note="Pfam match to entry PF01276 OKR_DC_1, Orn/Lys/Arg FT decarboxylase, score 169.50, E-value 5.4e-47" FT CDS 637492..637668 FT /class="V" FT /colour=10 FT /gene="ML0525" FT /note="Unknown function. Similar to M. tuberculosis FT Rv2493, hypothetical protein, TR:O53218 (EMBL:AL123456) FT (73 aa); Fasta score E(): 0.059, 47.7% identity in 44 aa FT overlap." FT /product="conserved hypothetical protein" FT CDS complement(638094..638979) FT /class="I.B.7" FT /colour=0 FT /gene="ML0526" FT /note="Possible pseudogene similar to M. tuberculosis FT Rv0575c (Best blastx score 73)" FT /product="possible oxidoreductase (pseudogene)" FT /pseudo FT CDS complement(639678..639932) FT /class="VI" FT /colour=8 FT /gene="ML0527" FT /note="Unknown function." FT /product="hypothetical protein" FT CDS complement(641810..642795) FT /class="II.C.3" FT /colour=0 FT /gene="ML0528" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv1367c (Best blastx score 289)" FT /product="probable penicillin binding protein FT (pseudogene)" FT /pseudo FT CDS complement(642925..643496) FT /class="IV.H" FT /colour=0 FT /gene="ML0529" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv1377c (Best blastx score 217)" FT /product="some similarity to methyltransferases FT (pseudogene)" FT /pseudo FT CDS complement(643652..645020) FT /class="V" FT /colour=0 FT /gene="ML0530" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv1378c (Best blastx score 627)" FT /product="conserved hypothetical protein (pseudogene)" FT /pseudo FT CDS 645041..645572 FT /class="I.J.1" FT /colour=0 FT /gene="pyrR" FT /gene="ML0531" FT /note="Possible pseudogene of M. tuberculosis orthologue FT pyrR (Best blastx score 355)" FT /product="regulatory protein pyrimidine biosynthesis FT (pseudogene)" FT /pseudo FT CDS 645581..646546 FT /EC_number="2.1.3.2" FT /class="I.F.2" FT /colour=7 FT /gene="pyrB" FT /gene="ML0532" FT /note="Similar to M. tuberculosis pyrB, Rv1380, aspartate FT carbamoyltransferase, SW:PYRB_MYCTU (P71808) (319 aa); FT Fasta score E(): 0, 89.9% identity in 318 aa overlap. FT Similar to many e.g. Pseudomonas putida, aspartate FT carbamoyltransferase, SW:PYRB_PSEPU (Q59711) (334 aa); FT Fasta score E(): 0, 47.3% identity in 317 aa overlap. FT Contains 2 Pfam matches to entry PF00185 OTCace, FT Aspartate/ornithine carbamoyltransferase. Contains PS00097 FT Aspartate and ornithine carbamoyltransferases signature." FT /note="Shows weak similarity to ML1410" FT /product="putative aspartate carbamoyltransferase" FT /tb_orthologue="pyrB" FT misc_feature 645590..646183 FT /colour=0 FT /note="Pfam match to entry PF00185 OTCace, FT Aspartate/ornithine carbamoyltransferase, score 173.40, FT E-value 3.7e-48" FT misc_feature 645731..645754 FT /colour=8 FT /note="PS00097 Aspartate and ornithine FT carbamoyltransferases signature" FT misc_feature 646328..646507 FT /colour=0 FT /note="Pfam match to entry PF00185 OTCace, FT Aspartate/ornithine carbamoyltransferase, score 31.40, FT E-value 8.4e-08" FT RBS 646530..646535 FT /note="possible RBS" FT CDS 646543..647835 FT /EC_number="3.5.2.3" FT /class="I.F.2" FT /colour=7 FT /gene="pyrC" FT /gene="ML0533" FT /note="Similar to M. tuberculosis pyrC, Rv1381, FT dihydroorotase, TR:P71809 (EMBL:AL123456) (430 aa); Fasta FT score E(): 0, 88.8% identity in 427 aa overlap. Similar to FT many e.g. Bacillus caldolyticus pyrC, dihydroorotase, FT SW:PYRC_BACCL (P46538) (427 aa); Fasta score E(): 0, 40.0% FT identity in 407 aa overlap. Contains Pfam match to entry FT PF00744 Dihydrooratase, Dihydroorotase-like." FT /product="putative dihydroorotase" FT /tb_orthologue="pyrC" FT misc_feature 646660..647808 FT /colour=0 FT /note="Pfam match to entry PF00744 Dihydrooratase, FT Dihydroorotase-like, score 266.90, E-value 2.7e-76" FT CDS 647832..648321 FT /class="V" FT /colour=0 FT /gene="ML0534" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv1382 (Best blastx score 331)" FT /product="hypothetical protein (pseudogene)" FT /pseudo FT RBS 648407..648413 FT /note="possible RBS" FT CDS 648422..649549 FT /EC_number="6.3.5.5" FT /class="I.F.2" FT /colour=7 FT /gene="carA" FT /gene="ML0535" FT /note="Similar to M. tuberculosis carA, Rv1383, FT carbamoyl-phosphate synthase subunit, TR:P71811 FT (EMBL:AL123456) (376 aa); Fasta score E(): 0, 85.4% FT identity in 377 aa overlap. Similar to many e.g. FT Escherichia coli carA, carbamoyl-phosphate synthase FT subunit, SW:CARA_ECOLI (P00907) (382 aa); Fasta score E(): FT 0, 43.2% identity in 389 aa overlap. Contains Pfam match FT to entry PF00988 CPSase_sm_chain, Carbamoyl-phosphate FT synthase small chain, CPSase domain. Contains Pfam match FT to entry PF00117 GATase, Glutamine amidotransferase FT class-I. Contains PS00442 Glutamine amidotransferases FT class-I active site." FT /product="putative carbamoyl-phosphate synthase subunit" FT /tb_orthologue="carA" FT misc_feature 648431..648928 FT /colour=0 FT /note="Pfam match to entry PF00988 CPSase_sm_chain, FT Carbamoyl-phosphate synthase small chain, CPSase domain, FT score 282.20, E-value 6.7e-81" FT misc_feature 648977..649531 FT /colour=0 FT /note="Pfam match to entry PF00117 GATase, Glutamine FT amidotransferase class-I, score 185.60, E-value 7.8e-52" FT misc_feature 649184..649219 FT /colour=8 FT /note="PS00442 Glutamine amidotransferases class-I active FT site" FT RBS 649596..649603 FT /note="possible RBS" FT CDS 649608..652997 FT /EC_number="6.3.5.5" FT /class="I.F.2" FT /colour=7 FT /gene="carB" FT /gene="ML0536" FT /note="Similar to M. tuberculosis carB, Rv1384, FT carbamoyl-phosphate synthase subunit. Similar to many e.g. FT Escherichia coli carB, carbamoyl-phosphate synthase FT subunit, SW:CARB_ECOLI (P00968) (1072 aa); Fasta score FT E(): 0, 51.4% identity in 1116 aa overlap. Contains 2 Pfam FT matches to entry PF00289 CPSase_L_chain, FT Carbamoyl-phosphate synthase (CPSase). Contains 2 x FT PS00867 Carbamoyl-phosphate synthase subdomain signature FT 2. Contains PS00013 Prokaryotic membrane lipoprotein lipid FT attachment site. Contains PS00866 Carbamoyl-phosphate FT synthase subdomain signature 1." FT /product="putative carbamoyl-phosphate synthase subunit" FT /tb_orthologue="carB" FT misc_feature 649656..650864 FT /colour=0 FT /note="Pfam match to entry PF00289 CPSase_L_chain, FT Carbamoyl-phosphate synthase (CPSase), score 551.50, FT E-value 5.7e-162" FT misc_feature 649671..649703 FT /colour=8 FT /note="PS00013 Prokaryotic membrane lipoprotein lipid FT attachment site" FT misc_feature 650535..650558 FT /colour=8 FT /note="PS00867 Carbamoyl-phosphate synthase subdomain FT signature 2" FT misc_feature 651330..652307 FT /colour=0 FT /note="Pfam match to entry PF00289 CPSase_L_chain, FT Carbamoyl-phosphate synthase (CPSase), score 188.30, FT E-value 5.9e-53" FT misc_feature 651801..651845 FT /colour=8 FT /note="PS00866 Carbamoyl-phosphate synthase subdomain FT signature 1" FT misc_feature 652188..652211 FT /colour=8 FT /note="PS00867 Carbamoyl-phosphate synthase subdomain FT signature 2" FT RBS 652986..652990 FT /note="possible RBS" FT CDS 652994..653842 FT /EC_number="4.1.1.23" FT /class="I.F.2" FT /colour=7 FT /gene="pyrF" FT /gene="ML0537" FT /note="Similar to M. tuberculosis pyrF, Rv1385, orotidine FT 5'-phosphate decarboxylase, SW:DCOP_MYCTU (P77898) (274 FT aa); Fasta score E(): 0, 77.3% identity in 282 aa overlap. FT Similar to many e.g. Mycobacterium smegmatis pyrF, FT orotidine 5'-phosphate decarboxylase, SW:DCOP_MYCSM FT (O08323) (276 aa); Fasta score E(): 0, 72.5% identity in FT 280 aa overlap. Contains Pfam match to entry PF00215 FT OMPdecase, Orotidine 5'-phosphate decarboxylases. Contains FT PS00156 Orotidine 5'-phosphate decarboxylase active site." FT /product="orotidine 5'-phosphate decarboxylase" FT /tb_orthologue="pyrF" FT misc_feature 653003..653839 FT /colour=0 FT /note="Pfam match to entry PF00215 OMPdecase, Orotidine FT 5'-phosphate decarboxylases, score 188.80, E-value FT 9.5e-54" FT misc_feature 653261..653302 FT /colour=8 FT /note="PS00156 Orotidine 5'-phosphate decarboxylase active FT site" FT RBS 654117..654120 FT /note="possible RBS" FT CDS 654129..654437 FT /class="IV.C.1.a" FT /colour=6 FT /gene="PE" FT /gene="ML0538" FT /note="Similar to M. tuberculosis PE, Rv1386, PE-family FT protein, SW:YD86_MYCTU (P71656) (102 aa); Fasta score E(): FT 2.8e-25, 72.5% identity in 102 aa overlap." FT /note="Similar to ML452, ML1183 and ML2129" FT /product="PE-family protein" FT /tb_orthologue="PE" FT CDS 654434..656050 FT /class="IV.C.2" FT /colour=6 FT /gene="PPE" FT /gene="ML0539" FT /note="Similar to M. tuberculosis PPE, Rv1387, PPE-family FT protein, TR:P71657 (EMBL:AL123456) (539 aa); Fasta score FT E(): 0, 69.5% identity in 544 aa overlap. Contains Pfam FT match to entry PF00823 PPE, PPE family." FT /note="Similar to ML0411, ML1182, ML1828 and ML1991" FT /product="PPE-family protein" FT /tb_orthologue="PPE" FT misc_feature 654452..654928 FT /colour=0 FT /note="Pfam match to entry PF00823 PPE, PPE family, score FT 202.80, E-value 5.3e-57" FT RBS 656886..656890 FT /note="possible RBS" FT CDS 656895..657212 FT /class="IV.B.3" FT /colour=2 FT /gene="mihF" FT /gene="ML0540" FT /note="Similar to M. tuberculosis mihF, Rv1388, possible FT integration host factor, TR:P71658 (EMBL:AL123456) (190 FT aa); Fasta score E(): 0, 98.1% identity in 105 aa overlap. FT Similar to Mycobacterium smegmatis mihF, integration host FT factor, TR:P96802 (EMBL:U75344) (105 aa); Fasta score E(): FT 7.5e-32, 94.1% identity in 102 aa overlap." FT /product="putative integration host factor" FT /tb_orthologue="mihF" FT RBS 657248..657252 FT /note="possible RBS" FT CDS 657266..657898 FT /EC_number="2.7.4.8" FT /class="I.F.1" FT /colour=7 FT /gene="gmk" FT /gene="ML0541" FT /note="Similar to M. tuberculosis gmk, Rv1389, putative FT guanylate kinase, SW:KGUA_MYCTU (P71659) (208 aa); Fasta FT score E(): 0, 79.1% identity in 201 aa overlap. Similar to FT many e.g. Saccharomyces cerevisiae guk1, guanylate kinase, FT SW:KGUA_YEAST (P15454) (186 aa); Fasta score E(): 7.1e-22, FT 42.8% identity in 180 aa overlap. Contains Pfam match to FT entry PF00625 Guanylate_kin, Guanylate kinase. Contains FT PS00017 ATP/GTP-binding site motif A (P-loop). Contains FT PS00856 Guanylate kinase signature." FT /product="putative guanylate kinase" FT /tb_orthologue="gmk" FT misc_feature 657353..657376 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature 657434..657487 FT /colour=8 FT /note="PS00856 Guanylate kinase signature" FT misc_feature 657437..657757 FT /colour=0 FT /note="Pfam match to entry PF00625 Guanylate_kin, FT Guanylate kinase, score 104.00, E-value 3e-27" FT RBS 657965..657971 FT /note="possible RBS" FT CDS 657980..658312 FT /class="V" FT /colour=10 FT /gene="ML0542" FT /note="Similar to M. tuberculosis Rv1390, conserved FT hypothetical protein, SW:YD90_MYCTU (P71660) (110 aa); FT Fasta score E(): 0, 90.0% identity in 110 aa overlap. Also FT similar to Streptomyces coelicolor SC9C5.02C, hypothetical FT protein, TR:CAB93358 (EMBL:AL357523) (90 aa); Fasta score FT E(): 2e-18, 71.3% identity in 80 aa overlap." FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv1390" FT RBS 658326..658332 FT /note="possible RBS" FT CDS 658333..659592 FT /class="I.B.7" FT /colour=7 FT /gene="dfp" FT /gene="ML0543" FT /note="Similar to M. tuberculosis dfp, Rv1391, putative FT flavoprotein, SW:DFP_MYCTU (P71661) (418 aa); Fasta score FT E(): 0, 87.0% identity in 409 aa overlap. Similar to many FT e.g. Escherichia coli dfp, DNA/pantothenate metabolism FT flavoprotein, SW:DFP_ECOLI (P24285) (430 aa); Fasta score FT E(): 0, 39.7% identity in 408 aa overlap." FT /product="putative flavoprotein" FT /tb_orthologue="dfp" FT RBS 659704..659709 FT /note="possible RBS" FT CDS 659721..660932 FT /EC_number="2.5.1.6" FT /class="I.D.2" FT /colour=7 FT /gene="metK" FT /gene="ML0544" FT /note="Similar to M. tuberculosis metK, Rv1392, putative FT S-adenosylmethionine synthase, SW:METK_MYCTU (P77899) (403 FT aa); Fasta score E(): 0, 91.3% identity in 403 aa overlap. FT Similar to Streptomyces spectabilis metK, FT S-adenosylmethionine synthase, SW:METK_STRST (Q9X4Q2) (411 FT aa); Fasta score E(): 0, 73.6% identity in 398 aa overlap. FT Contains Pfam match to entry PF00438 S-AdoMet_synt, FT S-adenosylmethionine synthetase. Contains PS00377 FT S-adenosylmethionine synthetase signature 2. Contains FT PS00376 S-adenosylmethionine synthetase signature 1." FT /product="putative S-adenosylmethionine synthase" FT /tb_orthologue="metK" FT misc_feature 659736..660893 FT /colour=0 FT /note="Pfam match to entry PF00438 S-AdoMet_synt, FT S-adenosylmethionine synthetase, score 693.20, E-value FT 3.2e-287" FT misc_feature 660111..660143 FT /colour=8 FT /note="PS00376 S-adenosylmethionine synthetase signature FT 1" FT misc_feature 660555..660581 FT /colour=8 FT /note="PS00377 S-adenosylmethionine synthetase signature FT 2" FT CDS complement(661595..662509) FT /class="II.B.5" FT /colour=0 FT /gene="lipH" FT /gene="ML0545" FT /note="Possible pseudogene of M. tuberculosis orthologue FT lipH (Best blastx score 213)" FT /product="probable lipase (pseudogene)" FT /pseudo FT CDS complement(662674..663497) FT /class="II.B.5" FT /colour=0 FT /gene="lipI" FT /gene="ML0546" FT /note="Possible pseudogene of M. tuberculosis orthologue FT lipI (Best blastx score 262)" FT /product="probable lipase (pseudogene)" FT /pseudo FT CDS 663496..663987 FT /class="II.C.5" FT /colour=0 FT /gene="ML0547" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv1401 (Best blastx score 114)" FT /product="possible membrane protein (pseudogene)" FT /pseudo FT CDS 664260..666215 FT /class="II.A.5" FT /colour=2 FT /gene="priA" FT /gene="ML0548" FT /note="Similar to M. tuberculosis priA, Rv1402, putative FT primosomal protein N', SW:PRIA_MYCTU (P71670) (655 aa); FT Fasta score E(): 0, 80.7% identity in 658 aa overlap. FT Similar to many e.g. Escherichia coli priA, primosomal FT protein N', SW:PRIA_ECOLI (P17888) (732 aa); Fasta score FT E(): 1.2e-16, 28.1% identity in 445 aa overlap." FT /product="putative primosomal protein N'" FT /tb_orthologue="priA" FT CDS complement(666224..667066) FT /class="IV.H" FT /colour=0 FT /gene="ML0549" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv1403c (Best blastx score 822)" FT /product="similar to phosphatidylethanolamine FT N-methyltransferase (pseudogene)" FT /pseudo FT CDS 667331..667816 FT /class="I.J.1" FT /colour=9 FT /gene="ML0550" FT /note="Similar to M. tuberculosis Rv1404, putative FT marR-family transcriptional regulator, TR:P71672 FT (EMBL:AL123456) (160 aa); Fasta score E(): 0, 79.1% FT identity in 158 aa overlap. Shows weak similarity to marR FT family e.g. Salmonella typhimurium marR, multiple FT antibiotic resistance protein, SW:MARR_SALTY (Q56069) (144 FT aa); Fasta score E(): 0.0027, 29.2% identity in 106 aa FT overlap. Contains Pfam match to entry PF01047 MarR, MarR FT family." FT /product="putative marR-family transcriptional regulator" FT /tb_orthologue="Rv1404" FT misc_feature 667454..667765 FT /colour=0 FT /note="Pfam match to entry PF01047 MarR, MarR family, FT score 99.80, E-value 5.2e-26" FT CDS complement(667998..668822) FT /class="IV.H" FT /colour=7 FT /gene="ML0551" FT /note="Similar to M. tuberculosis Rv1405c, hypothetical FT protein, SW:YE05_MYCTU (P71673) (274 aa); Fasta score E(): FT 0, 78.0% identity in 273 aa overlap. Shows weak similarity FT to methyltransferses e.g. Rhodobacter sphaeroides pmtA, FT phosphatidylethanolamine N-methyltransferase, FT SW:PMTA_RHOSH (Q05197) (203 aa); Fasta score E(): 7.9e-08, FT 31.3% identity in 144 aa overlap and Escherichia coli FT ubiE, ubiquinone/menaquinone biosynthesis FT methyltransferase, SW:UBIE_ECOLI (P27851) (251 aa); Fasta FT score E(): 9.1e-06, 28.0% identity in 118 aa overlap." FT /product="putative methyltransferase" FT /tb_orthologue="Rv1405c" FT RBS complement(668828..668832) FT /note="possible RBS" FT RBS 668985..668988 FT /note="possible RBS" FT CDS 669003..669959 FT /EC_number="2.1.2.9" FT /class="II.A.3" FT /colour=2 FT /gene="fmt" FT /gene="ML0552" FT /note="Similar to M. tuberculosis fmt, Rv1406, putative FT methionyl-tRNA formyltransferase, SW:FMT_MYCTU (P71674) FT (312 aa); Fasta score E(): 0, 81.0% identity in 316 aa FT overlap. Similar to many e.g. Thermus aquaticus fmt, FT methionyl-tRNA formyltransferase, SW:FMT_THETH (P43523) FT (305 aa); Fasta score E(): 8.1e-31, 41.3% identity in 315 FT aa overlap. Contains Pfam match to entry PF00551 FT formyl_transf, Formyl transferase." FT /product="putative methionyl-tRNA formyltransferase" FT /tb_orthologue="fmt" FT misc_feature 669009..669551 FT /colour=0 FT /note="Pfam match to entry PF00551 formyl_transf, Formyl FT transferase, score 105.10, E-value 3.9e-29" FT CDS 670028..671362 FT /class="II.A.4" FT /colour=0 FT /gene="fmu" FT /gene="ML0553" FT /note="Possible pseudogene of M. tuberculosis orthologue FT fmu (Best blastx score 1324)" FT /product="similar to Fmu protein (pseudogene)" FT /pseudo FT CDS 671416..672090 FT /EC_number="5.1.3.1" FT /class="I.B.5" FT /colour=7 FT /gene="rpe" FT /gene="ML0554" FT /note="Similar to M. tuberculosis rpe, Rv1408, FT ribulose-phosphate 3-epimerase, SW:RPE_MYCTU (P71676) (232 FT aa); Fasta score E(): 0, 91.0% identity in 221 aa overlap. FT Similar to many e.g. Oryza sativa D-ribulose-5-phosphate FT 3-epimerase, TR:Q9SE42 (EMBL:AF189365) (228 aa); Fasta FT score E(): 0, 47.0% identity in 215 aa overlap. Contains FT Pfam match to entry PF00834 Ribul_P_3_epim, FT Ribulose-phosphate 3 epimerase family. Contains PS01085 FT Ribulose-phosphate 3-epimerase family signature 1. FT Contains PS01086 Ribulose-phosphate 3-epimerase family FT signature 2." FT /product="putatibe ribulose-phosphate 3-epimerase" FT /tb_orthologue="rpe" FT misc_feature 671425..672021 FT /colour=0 FT /note="Pfam match to entry PF00834 Ribul_P_3_epim, FT Ribulose-phosphate 3 epimerase family, score 410.10, FT E-value 2e-119" FT misc_feature 671503..671547 FT /colour=8 FT /note="PS01085 Ribulose-phosphate 3-epimerase family FT signature 1" FT misc_feature 671809..671877 FT /colour=8 FT /note="PS01086 Ribulose-phosphate 3-epimerase family FT signature 2" FT CDS 672087..673106 FT /EC_number="3.5.4.26" FT /EC_number="1.1.1.193" FT /class="I.G.9" FT /colour=7 FT /gene="ribG" FT /gene="ML0555" FT /note="Similar to M. tuberculosis ribG, Rv1409, putative FT riboflavin biosynthesis protein, SW:RIBD_MYCTU (P71677) FT (339 aa); Fasta score E(): 0, 78.2% identity in 339 aa FT overlap. Similar to many e.g. Bacillus subtilis ribD, FT diaminohydroxyphosphoribosylaminopyrimidine deaminase / FT 5-amino-6-(5-phosphoribosylamino)-uracil reductase, FT SW:RIBD_BACSU (P17618) (361 aa); Fasta score E(): 7.9e-33, FT 39.2% identity in 357 aa overlap. Contains Pfam match to FT entry PF00383 dCMP_cyt_deam, Cytidine and deoxycytidylate FT deaminase zinc-binding region. Contains Pfam match to FT entry PF01872 RibD_C, RibD C-terminal domain. Contains FT PS00903 Cytidine and deoxycytidylate deaminases FT zinc-binding region signature." FT /product="putative bifunctional riboflavin-specific FT deaminase/reductase" FT /tb_orthologue="ribG" FT misc_feature 672162..672395 FT /colour=0 FT /note="Pfam match to entry PF00383 dCMP_cyt_deam, Cytidine FT and deoxycytidylate deaminase zinc-binding region, score FT 114.30, E-value 2.4e-30" FT misc_feature 672255..672371 FT /colour=8 FT /note="PS00903 Cytidine and deoxycytidylate deaminases FT zinc-binding region signature" FT misc_feature 672549..673058 FT /colour=0 FT /note="Pfam match to entry PF01872 RibD_C, RibD C-terminal FT domain, score 258.40, E-value 9.8e-74" FT CDS complement(673150..674679) FT /class="III.A.6" FT /colour=3 FT /gene="ML0556" FT /note="Similar to M. tuberculosis Rv1410c, probable drug FT resistance transporter, TR:P71678 (EMBL:AL123456) (518 FT aa); Fasta score E(): 0, 82.0% identity in 506 aa overlap. FT Similar to many e.g. Bacillus subtilis bmr3, multidrug FT transporter, TR:P96712 (EMBL:D50098) (512 aa); Fasta score FT E(): 5.4e-24, 27.1% identity in 446 aa overlap. Contains FT hydrophobic, probable membrane-spanning regions. Contains FT Pfam match to entry PF00083 sugar_tr, Sugar (and other) FT transporter. Contains PS00216 Sugar transport proteins FT signature 1." FT /note="Similar to ML1562" FT /product="putative integral membrane drug transport FT protein" FT /tb_orthologue="Rv1410c" FT misc_feature complement(673459..674640) FT /colour=0 FT /note="Pfam match to entry PF00083 sugar_tr, Sugar (and FT other) transporter, score -86.10, E-value 0.00086" FT misc_feature complement(674431..674481) FT /colour=8 FT /note="PS00216 Sugar transport proteins signature 1" FT CDS complement(674679..675395) FT /class="II.C.1" FT /colour=3 FT /gene="lprG" FT /gene="ML0557" FT /note="Similar to M. tuberculosis lprG, Rv1411c, putative FT lipoprotein, SW:LPRG_MYCTU (P71679) (236 aa); Fasta score FT E(): 0, 68.1% identity in 238 aa overlap and to other M. FT tuberculosis lipoproteins. 27 kDa antigen (Mycobacterium FT bovis). Contains probable N-terminal signal sequence. FT Contains PS00013 Prokaryotic membrane lipoprotein lipid FT attachment site." FT /note="Similar to ML0136" FT /product="putative lipoprotein" FT /tb_orthologue="lprG" FT misc_feature complement(675315..675347) FT /colour=8 FT /note="PS00013 Prokaryotic membrane lipoprotein lipid FT attachment site" FT CDS 675552..676175 FT /EC_number="2.5.1.9" FT /class="I.G.9" FT /colour=7 FT /gene="ribC" FT /gene="ML0558" FT /note="Similar to M. tuberculosis ribC, Rv1412, riboflavin FT synthase [alpha] chain, SW:RISA_MYCTU (P71680) (201 aa); FT Fasta score E(): 0, 82.4% identity in 199 aa overlap. FT Similar to many e.g. Bacillus subtilis ribE, riboflavin FT synthase alpha chain, SW:RISA_BACSU (P16440) (215 aa); FT Fasta score E(): 9.5e-28, 43.4% identity in 198 aa FT overlap. Contains 2 Pfam matches to entry PF00677 FT Lum_binding, Lumazine binding domain. Contains 2 x PS00693 FT Riboflavin synthase alpha chain family signature." FT /product="putative riboflavin synthase [alpha] chain" FT /tb_orthologue="ribC" FT misc_feature 675585..675812 FT /colour=0 FT /note="Pfam match to entry PF00677 Lum_binding, Lumazine FT binding domain, score 59.90, E-value 5.6e-14" FT misc_feature 675768..675806 FT /colour=8 FT /note="PS00693 Riboflavin synthase alpha chain family FT signature" FT misc_feature 675849..676112 FT /colour=0 FT /note="Pfam match to entry PF00677 Lum_binding, Lumazine FT binding domain, score 77.10, E-value 3.7e-19" FT misc_feature 676068..676106 FT /colour=8 FT /note="PS00693 Riboflavin synthase alpha chain family FT signature" FT CDS 676302..677609 FT /EC_number="3.5.4.25" FT /class="I.G.9" FT /colour=7 FT /gene="ribA" FT /gene="ML0559" FT /note="Similar to M. tuberculosis ribA2, Rv1415, putative FT GTP cyclohydrolase II, SW:GCH2_MYCTU (P71684) (425 aa); FT Fasta score E(): 0, 93.4% identity in 425 aa overlap. FT Similar to many e.g. Actinobacillus pleuropneumoniae ribA, FT riboflavin biosynthesis protein, SW:GCH2_ACTPL (P50855) FT (401 aa); Fasta score E(): 0, 52.4% identity in 401 aa FT overlap. Contains Pfam match to entry PF00926 FT DHBP_synthase, 3,4-dihydroxy-2-butanone 4-phosphate FT synthase. Contains Pfam match to entry PF00925 FT GTP_cyclohydro2, GTP cyclohydrolase II." FT /product="putative GTP cyclohydrolase FT II/3,4-dihydroxy-2-butanone-4-phosphate synthase" FT /tb_orthologue="ribA2" FT misc_feature 676350..676943 FT /colour=0 FT /note="Pfam match to entry PF00926 DHBP_synthase, FT 3,4-dihydroxy-2-butanone 4-phosphate synthase, score FT 455.00, E-value 6.3e-133" FT misc_feature 676950..677477 FT /colour=0 FT /note="Pfam match to entry PF00925 GTP_cyclohydro2, GTP FT cyclohydrolase II, score 402.80, E-value 3.3e-117" FT CDS 677606..678088 FT /EC_number="2.5.1.9" FT /class="I.G.9" FT /colour=7 FT /gene="ribH" FT /gene="ML0560" FT /note="Similar to M. tuberculosis ribH, Rv1416, riboflavin FT synthase [beta] chain, SW:RISB_MYCTU (P71685) (154 aa); FT Fasta score E(): 0, 78.9% identity in 152 aa overlap. FT Similar to many e.g. Actinobacillus pleuropneumoniae ribH, FT 6,7-dimethyl-8-ribityllumazine synthase, SW:RISB_ACTPL FT (P50856) (153 aa); Fasta score E(): 1.7e-15, 44.3% FT identity in 140 aa overlap. Contains Pfam match to entry FT PF00885 DMRL_synthase, 6,7-dimethyl-8-ribityllumazine FT synthase." FT /product="6,7-dimethyl-8-ribityllumazine synthase" FT /tb_orthologue="ribH" FT misc_feature 677648..678073 FT /colour=0 FT /note="Pfam match to entry PF00885 DMRL_synthase, FT 6,7-dimethyl-8-ribityllumazine synthase, score 250.90, FT E-value 1.7e-71" FT CDS 678085..678555 FT /class="II.C.4" FT /colour=3 FT /gene="ML0561" FT /note="Similar to M. tuberculosis Rv1417, hypothetical FT protein, SW:YE17_MYCTU (P71686) (154 aa); Fasta score E(): FT 0, 75.5% identity in 143 aa overlap. Similar to other FT hypothetical proteins e.g. Corynebacterium ammoniagenes FT ribX, hypothetical protein, TR:O24754 (EMBL:AB003693) (184 FT aa); Fasta score E(): 2.1e-15, 34.5% identity in 148 aa FT overlap. Contains hydrophobic, possible membrane-spanning FT regions." FT /product="putative membrane protein" FT /tb_orthologue="Rv1417" FT CDS 678870..680813 FT /class="II.A.5" FT /colour=2 FT /gene="uvrC" FT /gene="ML0562" FT /note="Similar to M. tuberculosis uvrC, Rv1420, FT excinuclease ABC subunit C, SW:UVRC_MYCTU (P71689) (646 FT aa); Fasta score E(): 0, 87.6% identity in 646 aa overlap. FT Similar to many e.g. Escherichia coli uvrC, excinuclease FT ABC subunit C, SW:UVRC_ECOLI (P07028) (231 aa); BlastP FT Expect 8.9. Contains Pfam match to entry PF01541 FT Exci_endo_N, Endo/excinuclease amino terminal domain. FT Contains Pfam match to entry PF02151 UVR, UvrB/uvrC motif. FT Contains Pfam match to entry PF00633 HHH, FT Helix-hairpin-helix motif." FT /product="putative excinuclease ABC subunit C" FT /tb_orthologue="uvrC" FT misc_feature 678918..679190 FT /colour=0 FT /note="Pfam match to entry PF01541 Exci_endo_N, FT Endo/excinuclease amino terminal domain, score 55.10, FT E-value 1.5e-12" FT misc_feature 679491..679598 FT /colour=0 FT /note="Pfam match to entry PF02151 UVR, UvrB/uvrC motif, FT score 42.80, E-value 7.7e-09" FT misc_feature 680691..680780 FT /colour=0 FT /note="Pfam match to entry PF00633 HHH, FT Helix-hairpin-helix motif., score 28.10, E-value 0.00021" FT CDS 680810..681706 FT /class="V" FT /colour=10 FT /gene="ML0563" FT /note="Similar to M. tuberculosis Rv1421, conserved FT hypothetical protein, SW:YE21_MYCTU (P71690) (301 aa); FT Fasta score E(): 0, 92.3% identity in 285 aa overlap. FT Conserved in many bacteria." FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv1421" FT CDS 681703..682782 FT /class="V" FT /colour=10 FT /gene="ML0564" FT /note="Similar to M. tuberculosis Rv1422, conserved FT hypothetical protein, SW:YE22_MYCTU (P71691) (342 aa); FT Fasta score E(): 0, 85.7% identity in 350 aa overlap. FT Conserved in many bacteria." FT /product="conserved hypothetical protein" FT /tb_orthologue="Rv1422" FT CDS 682779..683756 FT /class="I.J.1" FT /colour=9 FT /gene="ML0565" FT /note="Similar to M. tuberculosis Rv1423, putative FT transcriptional regulator, TR:P71692 (EMBL:AL123456) (325 FT aa); Fasta score E(): 0, 92.0% identity in 325 aa overlap. FT Similar to Streptomyces coelicolor whiA, sporulation FT regulatory protein, TR:Q9S4Y1 (EMBL:AF106003) (330 aa); FT Fasta score E(): 0, 67.6% identity in 324 aa overlap." FT /product="putative transcriptional regulator" FT /tb_orthologue="Rv1423" FT CDS 683866..684275 FT /class="V" FT /colour=0 FT /gene="ML0566" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv1425 (Best blastx score 264)" FT /product="conserved hypothetical protein (pseudogene)" FT /pseudo FT CDS 684845..686398 FT /class="II.C.5" FT /colour=0 FT /gene="ML0567" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv1431 (Best blastx score 550)" FT /product="possible transporter (pseudogene)" FT /pseudo FT RBS 686803..686806 FT /note="possible RBS" FT CDS 686813..687406 FT /class="V" FT /colour=10 FT /gene="ML0568" FT /note="Similar to M. tuberculosis Rv1435c, hypothetical FT protein, TR:O06823 (EMBL:AL123456) (202 aa); Fasta score FT E(): 1.7e-07, 38.9% identity in 203 aa overlap. Pro- and FT Val-rich protein." FT /product="hypothetical protein" FT repeat_region 687053..687177 FT /note="5.6 copies of 27 bp direct repeat, Consensus FT CCGGTGGTGCCGCCTGGTGGGTTTCCC" FT /colour=5 FT repeat_region complement(690412..691665) FT /note="LEPRPT, copy 1, 1254 bp. Shows 99-100% identity FT with regions 727207..728460, 1539937..1541188, FT 1480312..1481018, 2203983..2204515, 691673..691731" FT /label=LEPRPT FT repeat_region complement(690413..690473) FT /note="61 bp repeat found at 3'-end of LEPRPT and 5' to FT REPLEP" FT CDS complement(693611..694426) FT /class="II.C.4" FT /colour=3 FT /gene="ML0569" FT /note="Similar to M. tuberculosis Rv1433, putative FT membrane protein, TR:O06825 (EMBL:AL123456) (271 aa); FT Fasta score E(): 0, 68.3% identity in 271 aa overlap. FT Shows weak similarity to other hypothetical proteins in M. FT tuberculosis. Previously sequenced as TR:Q49706 FT (EMBL:U00013) (271 aa); Fasta score E(): 0, 100.0% FT identity in 271 aa overlap." FT /note="Similar to ML0426, ML2446 and ML2664" FT /product="putative membrane protein" FT /tb_orthologue="Rv1433" FT RBS 694876..694882 FT /note="possible RBS" FT CDS 694889..695908 FT /EC_number="1.2.1.12" FT /class="I.B.1" FT /colour=7 FT /gene="gap" FT /gene="ML0570" FT /note="Similar to M. tuberculosis gap, Rv1436, FT glyceraldehyde 3-phosphate dehydrogenase, SW:G3P_MYCTU FT (O06822) (339 aa); Fasta score E(): 0, 89.1% identity in FT 339 aa overlap. Similar to many e.g. Mycobacterium avium FT gap, glyceraldehyde 3-phosphate dehydrogenase, FT SW:G3P_MYCAV (P94915) (339 aa); Fasta score E(): 0, 87.9% FT identity in 339 aa overlap. Previously sequenced as FT SW:G3P_MYCLE (P46713) (339 aa); Fasta score E(): 0, 99.7% FT identity in 339 aa overlap. Contains Pfam match to entry FT PF00044 gpdh, glyceraldehyde 3-phosphate dehydrogenases. FT Contains PS00071 Glyceraldehyde 3-phosphate dehydrogenase FT active site." FT /product="glyceraldehyde 3-phosphate dehydrogenase" FT /tb_orthologue="gap" FT misc_feature 694892..695902 FT /colour=0 FT /note="Pfam match to entry PF00044 gpdh, glyceraldehyde FT 3-phosphate dehydrogenases, score 733.80, E-value FT 7.9e-219" FT misc_feature 695354..695377 FT /colour=8 FT /note="PS00071 Glyceraldehyde 3-phosphate dehydrogenase FT active site" FT misc_feature 695911..697140 FT /colour=0 FT /note="Pfam match to entry PF00162 PGK, Phosphoglycerate FT kinases, score 757.00, E-value 7.9e-224" FT CDS 695911..697161 FT /EC_number="2.7.2.3" FT /class="I.B.1" FT /colour=7 FT /gene="pgk" FT /gene="ML0571" FT /note="Similar to M. tuberculosis pgk, Rv1437, FT phosphoglycerate kinase, SW:PGK_MYCTU (O06821) (412 aa); FT Fasta score E(): 0, 80.6% identity in 412 aa overlap. FT Similar to many e.g. Corynebacterium glutamicum pgk, FT phosphoglycerate kinase, SW:PGK_CORGL (Q01655) (403 aa); FT Fasta score E(): 0, 59.2% identity in 407 aa overlap. FT Previously sequenced as SW:PGK_MYCLE (P46712) (416 aa); FT Fasta score E(): 0, 99.8% identity in 416 aa overlap. FT Contains Pfam match to entry PF00162 PGK, Phosphoglycerate FT kinases. Contains PS00111 Phosphoglycerate kinase FT signature." FT /product="phosphoglycerate kinase" FT /tb_orthologue="pgk" FT misc_feature 695962..695994 FT /colour=8 FT /note="PS00111 Phosphoglycerate kinase signature" FT RBS 697149..697153 FT /note="possible RBS" FT CDS 697158..697943 FT /EC_number="5.3.1.1" FT /class="I.B.1" FT /colour=7 FT /gene="tpi" FT /gene="ML0572" FT /note="Similar to M. tuberculosis tpi, Rv1438, FT triosephosphate isomerase, SW:TPIS_MYCTU (O08408) (261 FT aa); Fasta score E(): 0, 83.9% identity in 261 aa overlap. FT Similar to many e.g. Corynebacterium glutamicum tpi, FT triosephosphate isomerase, SW:TPIS_CORGL (P19583) (259 FT aa); Fasta score E(): 0, 64.5% identity in 256 aa overlap. FT Previously sequenced as SW:TPIS_MYCLE (P46711) (261 aa); FT Fasta score E(): 0, 99.6% identity in 261 aa overlap. FT Contains Pfam match to entry PF00121 TIM, Triosephosphate FT isomerase. Contains PS00171 Triosephosphate isomerase FT active site." FT /product="triosephosphate isomerase" FT /tb_orthologue="tpi" FT misc_feature 697164..697931 FT /colour=0 FT /note="Pfam match to entry PF00121 TIM, Triosephosphate FT isomerase, score 524.60, E-value 3.7e-169" FT misc_feature 697665..697697 FT /colour=8 FT /note="PS00171 Triosephosphate isomerase active site" FT CDS 697927..698202 FT /class="VI" FT /colour=8 FT /gene="ML0573" FT /note="Unknown function. Previously sequenced as TR:Q49684 FT (EMBL:U00013) (91 aa); Fasta score E(): 0, 98.9% identity FT in 91 aa overlap. Contains Pfam match to entry PF00121 FT TIM, Triosephosphate isomerase." FT /product="hypothetical protein" FT CDS 698199..698516 FT /class="VI" FT /colour=8 FT /gene="ML0574" FT /note="Unknown function. Previously sequenced as TR:Q49680 FT (EMBL:U00013) (105 aa); Fasta score E(): 0, 99.0% identity FT in 105 aa overlap." FT /product="hypothetical protein" FT CDS 698674..698892 FT /class="VI" FT /colour=8 FT /gene="ML0575" FT /note="Unknown function." FT /product="hypothetical protein" FT CDS 699708..699938 FT /class="VI" FT /colour=8 FT /gene="ML0576" FT /note="Unknown function. Previously sequenced as TR:Q49681 FT (EMBL:U00013) (76 aa); Fasta score E(): 1.5e-31, 100.0% FT identity in 76 aa overlap." FT /product="hypothetical protein" FT CDS 699950..700183 FT /class="III.D" FT /colour=3 FT /gene="ML0577" FT /note="Similar to M. tuberculosis secG, Rv1440, probable FT protein-export membrane protein, SW:SECG_MYCTU (O06819) FT (77 aa); Fasta score E(): 1.1e-25, 96.1% identity in 77 aa FT overlap. Similar to many e.g. Escherichia coli secG, FT protein-export membrane protein, SW:SECG_ECOLI (P33582) FT (110 aa); Fasta score E(): 0.06, 29.0% identity in 69 aa FT overlap. Previously sequenced as SW:SECG_MYCLE (P38388) FT (77 aa); Fasta score E(): 3.1e-26, 100.0% identity in 77 FT aa overlap. Contains hydrophobic, possible FT membrane-spanning regions." FT /product="putative protein-export membrane protein" FT CDS 700214..703018 FT /EC_number="4.1.1.31" FT /class="I.C.1" FT /colour=7 FT /gene="ppc" FT /gene="ML0578" FT /note="Similar to many e.g. Rhodopseudomonas palustris FT ppc, phosphoenolpyruvate carboxylase, SW:CAPP_RHOPA FT (O32483) (936 aa); Fasta score E(): 0, 45.7% identity in FT 936 aa overlap. Previously sequenced as SW:CAPP_MYCLE FT (P46710) (907 aa); Fasta score E(): 0, 100.0% identity in FT 907 aa overlap. Contains 2 Pfam matches to entry PF00311 FT PEPcase, Phosphoenolpyruvate carboxylase. Contains PS00781 FT Phosphoenolpyruvate carboxylase active site 1. Contains FT PS00393 Phosphoenolpyruvate carboxylase active site 2." FT /product="putative phosphoenolpyruvate carboxylase" FT misc_feature 700454..701158 FT /colour=0 FT /note="Pfam match to entry PF00311 PEPcase, FT Phosphoenolpyruvate carboxylase, score 49.50, E-value FT 1.2e-14" FT misc_feature 700682..700717 FT /colour=8 FT /note="PS00781 Phosphoenolpyruvate carboxylase active site FT 1" FT misc_feature 701390..702934 FT /colour=0 FT /note="Pfam match to entry PF00311 PEPcase, FT Phosphoenolpyruvate carboxylase, score 347.00, E-value FT 1.2e-103" FT misc_feature 701963..702001 FT /colour=8 FT /note="PS00393 Phosphoenolpyruvate carboxylase active site FT 2" FT CDS complement(703242..703985) FT /EC_number="3.1.1.31" FT /class="I.B.5" FT /colour=7 FT /gene="pgl" FT /gene="ML0579" FT /note="Similar to M. tuberculosis devB, Rv1445c, FT 6-phosphogluconolactonase, SW:6PGL_MYCTU (O06814) (247 FT aa); Fasta score E(): 0, 72.8% identity in 246 aa overlap. FT Similar to many e.g. C-terminal half of Homo sapiens FT gdh/6pgl endoplasmic bifunctional protein precursor FT (6-phosphogluconolactonase), SW:. Previously sequenced as FT SW:6PGL_MYCLE (Q49700) (247 aa); Fasta score E(): 0, 99.6% FT identity in 247 aa overlap. Contains Pfam match to entry FT PF01182 Glucosamine_iso, Glucosamine-6-phosphate FT isomerase." FT /product="putative 6-phosphogluconolactonase" FT /tb_orthologue="devB" FT misc_feature complement(703269..703913) FT /colour=0 FT /note="Pfam match to entry PF01182 Glucosamine_iso, FT Glucosamine-6-phosphate isomerase, score 4.50, E-value FT 1.4e-06" FT CDS complement(704001..704798) FT /class="V" FT /colour=10 FT /gene="ML0580" FT /note="Similar to M. tuberculosis Rv1446c, hypothetical FT protein, TR:O06813 (EMBL:AL123456) (303 aa); Fasta score FT E(): 0, 70.3% identity in 239 aa overlap. Similar to FT hypothetical proteins from Streptomyces coelicolor e.g. FT SCC22.20, hypothetical protein, TR:Q9XAB8 (EMBL:AL096839) FT (351 aa); Fasta score E(): 7.1e-21, 36.0% identity in 203 FT aa overlap, although these have a short N-terminal FT extension relative to this homologue. Previously sequencd FT as TR:Q49699 (EMBL:U00013) (265 aa); Fasta score E(): 0, FT 100.0% identity in 265 aa overlap." FT /product="conserved hypothetical protein" FT RBS complement(704813..704818) FT /note="possible RBS" FT CDS complement(704918..706434) FT /class="I.B.5" FT /colour=0 FT /gene="zwf2" FT /gene="ML0581" FT /note="Possible pseudogene of M. tuberculosis orthologue FT zwf2 (Best blastx score 638)" FT /product="glucose-6-phosphate 1-dehydrogenase FT (pseudogene)" FT /pseudo FT CDS complement(706461..707588) FT /EC_number="2.2.1.2" FT /class="I.B.5" FT /colour=7 FT /gene="tal" FT /gene="ML0582" FT /note="Similar to M. tuberculosis tal, Rv1448c, FT transaldolase, SW:TAL_MYCTU (O06812) (373 aa); Fasta score FT E(): 0, 78.9% identity in 370 aa overlap. Similar to many FT e.g. Escherichia coli tal, transaldolase, SW:TALA_ECOLI FT (P78258) (316 aa); Fasta score E(): 7e-05, 29.6% identity FT in 270 aa overlap. Previously sequenced as SW:TAL_MYCLE FT (P55193) (375 aa); Fasta score E(): 0, 100.0% identity in FT 375 aa overlap. Contains Pfam match to entry PF00923 FT Transaldolase, Transaldolase. Contains PS01054 FT Transaldolase signature 1. Contains PS00958 Transaldolase FT active site." FT /product="putative transaldolase" FT /tb_orthologue="tal" FT misc_feature complement(706746..707522) FT /colour=0 FT /note="Pfam match to entry PF00923 Transaldolase, FT Transaldolase, score 413.80, E-value 1.6e-120" FT misc_feature complement(707112..707165) FT /colour=8 FT /note="PS00958 Transaldolase active site" FT misc_feature complement(707427..707453) FT /colour=8 FT /note="PS01054 Transaldolase signature 1" FT CDS complement(707605..709704) FT /EC_number="2.2.1.1" FT /class="I.B.5" FT /colour=7 FT /gene="tkt" FT /gene="ML0583" FT /note="Similar to M. tuberculosis tkt, Rv1449c, FT transketolase, SW:TKT_MYCTU (O06811) (700 aa); Fasta score FT E(): 0, 89.1% identity in 700 aa overlap. Similar to many FT e.g. Saccharomyces cerevisiae tkl2, transketolase 2, FT SW:TKT2_YEAST (P33315) (681 aa); Fasta score E(): 0, 42.8% FT identity in 684 aa overlap. Previously sequenced as FT SW:TKT_MYCLE (P46708) (699 aa); Fasta score E(): 0, 99.9% FT identity in 699 aa overlap. Contains Pfam match to entry FT PF00456 transketolase, Transketolase. Contains PS00801 FT Transketolase signature 1. Contains PS00802 Transketolase FT signature 2." FT /product="transketolase" FT /tb_orthologue="tkt" FT misc_feature complement(707638..709611) FT /colour=0 FT /note="Pfam match to entry PF00456 transketolase, FT Transketolase, score 1459.70, E-value 0" FT misc_feature complement(708166..708216) FT /colour=8 FT /note="PS00802 Transketolase signature 2" FT misc_feature complement(709552..709614) FT /colour=8 FT /note="PS00801 Transketolase signature 1" FT RBS complement(709712..709716) FT /note="possible RBS" FT CDS 709904..710869 FT /EC_number="2.5.1.-" FT /class="I.B.6.a" FT /colour=7 FT /gene="ctaB" FT /gene="ML0584" FT /note="Similar to M. tuberculosis ctaB, Rv1451, cytochrome FT c oxidase assembly factor, TR:O06809 (EMBL:AL123456) (308 FT aa); Fasta score E(): 0, 82.7% identity in 307 aa overlap. FT Similar to many e.g. Bacillus firmus ctaB, protoheme IX FT farnesyltransferase, SW:COXX_BACFI (Q04444) (312 aa); FT Fasta score E(): 7.8e-24, 33.6% identity in 283 aa FT overlap. Previously sequenced as TR:Q49685 (EMBL:U00013) FT (300 aa); Fasta score E(): 0, 99.7% identity in 300 aa FT overlap. Contains hydrophobic, possible membrane-spanning FT regions. Contains Pfam match to entry PF01040 UbiA, UbiA FT prenyltransferase family." FT /product="putative protoheme IX farnesyltransferase" FT /tb_orthologue="ctaB" FT misc_feature 710036..710845 FT /colour=0 FT /note="Pfam match to entry PF01040 UbiA, UbiA FT prenyltransferase family, score 360.30, E-value 2e-104" FT CDS complement(710904..711810) FT /class="I.B.7" FT /colour=0 FT /gene="qor" FT /gene="ML0585" FT /note="Possible pseudogene of M. tuberculosis orthologue FT qor (Best blastx score 228)" FT /product="probable quinone oxidoreductase (pseudogene)" FT /pseudo FT CDS 711832..712694 FT /class="V" FT /colour=0 FT /gene="ML0586" FT /note="Possible pseudogene of M. tuberculosis orthologue FT Rv1455 (Best blastx score 414)" FT /product="conserved hypothetical protein (pseudogene)" FT /pseudo FT CDS complement(712668..713603) FT /class="II.C.4" FT /colour=3 FT /gene="ML0587" FT /note="Similar to M. tuberculosis Rv1456c, putative FT membrane protein, TR:O53148 (EMBL:AL123456) (310 aa); FT Fasta score E(): 0, 83.3% identity in 300 aa overlap. FT Similar to bacterial hypothetical proteins e.g. FT Mycobacterium smegmatis fxtF, hypothetical protein, FT TR:O87318 (EMBL:AF027770) (236 aa); Fasta score E(): 0, FT 67.5% identity in 228 aa overlap. Previously sequenced as FT TR:O33142 (EMBL:Z99125) (311 aa); Fasta score E(): 0, FT 99.7% identity in 311 aa overlap. Contains hydrophobic, FT possible membrane-spanning regions." FT /product="putative membrane protein" FT /tb_orthologue="Rv1456c" FT CDS 713858..714100 FT /class="VI" FT /colour=8 FT /gene="ML0588" FT /note="Unknown function. Previously sequenced as TR:Q49686 FT (EMBL:U00013) (80 aa); Fasta score E(): 0, 98.8% identity FT in 80 aa overlap." FT /product="hypothetical protein" FT CDS complement(714234..715031) FT /class="II.C.4" FT /colour=3 FT /gene="ML0589" FT /note="Similar to M. tuberculosis Rv1457c, putative FT membrane protein, TR:O86349 (EMBL: